Application of sisalgenin in the preparation of medicines for treating influenza and viral pneumonia

Abstract

The present invention discloses the use of sisal sapogenin in preparing a medicament for treating influenza and viral pneumonia thereof, wherein the influenza virus is influenza A and the viral pneumonia is influenza A viral pneumonia. The sisal sapogenin (Tigogenin) can reduce the expression of influenza virus mRNA and influenza virus NP protein in vitro. In vivo, it can inhibit the inflammatory pathology of lung tissue caused by influenza virus and reduce the lung index. Since sisal sapogenin has a significant inhibitory effect on the replication of influenza virus, the sisal sapogenin provided by the present invention provides a new medicament for treating influenza and viral pneumonia thereof.

Description

Technical Field

[0001] The present invention belongs to the field of medicinal chemistry, and in particular to an antiviral drug molecule targeting influenza A virus NP protein and a preparation method thereof. Background Art

[0002] Influenza A virus (IAV) infection can cause respiratory illness, with a wide range of hosts and high infectivity. Over the past century, several IAV pandemics have occurred worldwide, resulting in at least tens of millions of deaths. Influenza causes seasonal outbreaks and unpredictable pandemics each year, resulting in high morbidity and mortality, posing a serious threat to human public health.

[0003] Currently, the predominant anti-influenza drug pipeline globally is focused on M2 neuraminidase inhibitors. These four neuraminidase inhibitors, including oseltamivir, zanamivir, peramivir, and laninamivir, are all sialic acid derivatives. While their advantages include high activity, they also suffer from multiple chiral centers and complex synthesis. Furthermore, various M2 neuraminidase inhibitors are resistant to these four currently marketed drugs. For example, the H274Y subtype of influenza virus (H1N1 or H5N1) and the W119V subtype of influenza virus (H3N2) are the most common M2 mutants, resistant to both zanamivir and oseltamivir. This severely limits the synergistic application of the oral drug oseltamivir. Therefore, the development of a new generation of novel targets and their associated traditional Chinese medicine inhibitors is urgently needed.

[0004] Sisal sapogenin (Tigogenin) is an active ingredient extracted from the Anemarrhena rhizome in the patented formula of Yinqiao Baidu San (Yinqiao Baidu San) through preliminary network pharmacology. Its main component is tigogenin, chemically known as 5α,25D-spirostane-3b-hydroxyl. It is a pharmaceutical intermediate and important raw material for the synthesis of steroid hormones. Pharmacological studies have shown that sisal sapogenin exhibits significant anti-inflammatory, antibacterial, hemostatic, anti-aging, and hypoglycemic activities. Patent application publication number CN118852316A discloses a sisal sapogenin derivative, its preparation method, and its use in hypoglycemic drugs or formulations. Furthermore, another published patent application provides patent search information for a method for preparing tigogenin-cellobioside and its heptaacetate, as well as pharmaceutical compositions containing tigogenin-cellobioside. However, no research has yet reported on the mechanism of action and preventive and therapeutic effects of sisal sapogenin against influenza virus.

[0005] The present invention is the first to discover that sisal sapogenin has the use of anti-influenza A virus. Experimental results show that sisal sapogenin inhibits the expression of influenza virus mRNA and NP protein, affects the replication of the virus, and has anti-influenza virus effects in vivo and in vitro, revealing that it has the prospect of being developed into a drug for treating influenza and its induced viral pneumonia. Summary of the Invention

[0006] The present invention aims to overcome the shortcomings of the prior art and provide a new use of sisalgenin. The sisalgenin has significant anti-influenza A virus activity and can be developed as a new generation of anti-influenza virus drugs with broad application prospects.

[0007] In order to achieve the above object, the present invention provides an application in an anti-influenza virus drug, wherein the influenza virus is influenza A virus.

[0008] Another aspect of the present invention provides sisalogenin for use in the preparation of a preparation for inhibiting the infection and replication of influenza virus pneumonia.

[0009] The present invention also provides sisal sapogenin which inhibits the expression of the M gene of influenza virus H1N1 to achieve an antiviral effect.

[0010] The present invention also provides the inhibitory effect of sisalgenin on influenza virus NP protein.

[0011] The sisal sapogenin also inhibits the expression of influenza virus pneumonia in mice.

[0012] In summary, the present invention has the following advantages and effects compared with the prior art:

[0013] 1. Sisal saponins can inhibit the infection of influenza A virus H1N1 to cells and have a wide range of antiviral activity

[0014] 2. Sisal saponin has low cytotoxicity and has a significant advantage in inhibiting H1N1-infected cells at an almost non-toxic microdose (12.5 ng / ml concentration). It can be used as a safe, effective and cost-effective antiviral drug for development.

[0015] 3. Sisal saponin can act on the NP protein target of influenza virus and has a significant inhibitory effect on its expression.

[0016] 4. Sisal saponin can inhibit the inflammatory pathology of lung tissue caused by influenza virus and reduce lung index.

[0017] To achieve the above object, the present invention provides the following solutions:

[0018] The present invention provides the use of sisal sapogenin in the preparation of anti-influenza virus drugs, and the structural molecular formula of the sisal sapogenin is:

[0019]

[0020] Sisal saponin molecular structure

[0021] The present invention discloses the following technical effects:

[0022] The present invention discloses the use of sisal sapogenin in preparing a drug for treating influenza and viral pneumonia thereof, wherein the influenza virus is influenza A and the viral pneumonia is influenza A viral pneumonia. The sisal sapogenin has a significant inhibitory effect on influenza virus, reduces the expression of influenza virus NP protein, and can inhibit the inflammatory pathology of lung tissue in mice with influenza virus-infected viral pneumonia. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In the accompanying drawings, unless otherwise specified, the same reference numerals throughout the multiple drawings represent the same or similar components or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings only depict some embodiments disclosed in this application and should not be construed as limiting the scope of this application.

[0024] Figure 1 Toxicity assay of Tigogenin on A549 cells

[0025] Figure 2 Tigogenin anti-influenza virus activity assay

[0026] Figure 3 PCR detection of the inhibitory effect of Tigogenin on H1N1 M gene

[0027] Figure 4 WB detection of the inhibitory effect of Tigogenin on H1N1 NP protein

[0028] Figure 5 Immunofluorescence detection of the inhibitory effect of Tigogenin on H1N1 NP protein

[0029] Figure 6 Effect of Tigogenin on the weight changes of H1N1 influenza mice

[0030] Figure 7 Effect of Tigogenin on lung index of H1N1 influenza mice

[0031] Figure 8 Tigogenin on pathological sections of H1N1 influenza mice DETAILED DESCRIPTION

[0032] In order to better understand the content of the present invention, the application of sisalgenin in resisting influenza A virus is further explained below in combination with experiments and experimental results.

[0033] Materials cells and viruses used in the present invention:

[0034] Cell lines and virus strains: Human non-small cell lung cancer A549 cells [A-549] (CL-0016) were provided by Wuhan Punosai Life Science Co., Ltd., and influenza virus A / FM1 / 47 / (H1N1) was provided by the Science and Technology Innovation Center of Guangzhou University of Chinese Medicine. Reagents: F-12K medium (GIBCO), penicillin-streptomycin antibodies (GIBCO), fetal bovine serum (GIBCO), PBS solution (GIBCO), 0.25% EDTA trypsin (GIBCO), dimethyl sulfoxide (Sigma), TPCK-treated trypsin (Sigma), thiazolyl blue (Sigma). All virus-related experiments were performed in a biosafety level 2 laboratory.

[0035] Example 1

[0036] In this example, the cytotoxicity of sisalogenin was detected.

[0037] The cytotoxicity of sisalogenin was detected by MTT method, and the specific method is as follows:

[0038] A549 cells were seeded in 96-well plates, with 100 μl per well and a cell concentration of 2 × 10 5 / ml, cultured in a 37℃, 5% CO2 incubator for 24h, the next experiment can be carried out when the cells grow to 80-90%. Use DMSO as a cosolvent to dissolve the active ingredient of sisal saponin and add F-12K cell culture medium to dilute the drug to a concentration of 1mg / ml. Use a 0.22um filter to filter and sterilize it as a mother solution, and dilute it in 5-fold ratios for a total of 8 gradient concentrations of the drug solution. After A549 cells grow to 80-90%, add the prepared drug solution, 100ul per well, 5 replicates for each concentration, and set up a 6-well blank control group and a 10-well normal control group. After continuing to culture in the incubator for 48h, use a multifunctional enzyme reader to detect the absorbance at 490nm. The cell survival rate is used as an indicator of the toxicity of sisal saponin to A549 cells.

[0039] Cell viability (%) = absorbance of drug group - absorbance of blank group / absorbance of normal group - absorbance of blank group * 100%

[0040] The results are as follows Figure 1 As shown in the figure, sisalogenin has almost no toxicity to A549 cells within the concentration range of 200ng / ml. The drug concentration selected in the experimental study of the present invention is within 12.5ng / ml, which is within the safe and non-toxic concentration range.

[0041] Example 2

[0042] This example tested the in vitro anti-influenza A virus activity of sisalgenin.

[0043] The specific method is as follows:

[0044] A549 cells were cultured at a concentration of 2×10 5 Cells were plated in 96-well plates, 100 μl per well, and cultured in a 37°C, 5% CO2 incubator for 24 h. When the cells reached 80-90% growth, the next step of the experiment could be performed. 100 TCID 50 The cells were infected with a virus dilution of the FM1 strain of influenza A virus (containing 1ug / ml TPCK). After 2 hours of virus adsorption, the virus solution was discarded, the cells were washed with PBS, and a gradient dilution of sisal saponin was added, 100ul per well, and the cells were cultured for another 48 hours. The antiviral activity of sisal saponin was determined by its protective effect on cells, including observing the inhibition of virus-induced cytopathic effect (CPE) and detecting cell survival rate, and further calculating the half effective concentration (IC) 50 , oseltamivir served as a positive control.

[0045] The results are as follows Figure 2 As shown: Sisal saponin has a significant inhibitory effect on influenza virus H1N1 at a concentration of 6.25ng / ml, with an inhibition rate of more than 90%.

[0046] Example 3

[0047] This example evaluates the inhibition of influenza A virus replication by sisalgenin.

[0048] In order to evaluate the inhibitory effect of sisal sapogenin on influenza virus replication, the present invention uses three experiments: q-PCR, Western blotting, and immunofluorescence to detect the effects of sisal sapogenin on the replication of the M gene and NP protein of influenza virus at the gene and protein expression levels, respectively. The specific methods are as follows:

[0049] A549 cells were seeded in 6-well plates with 2 ml per well and a cell concentration of 3 × 10 5 The cells were divided into 6 groups (normal group, virus group, oseltamivir group, low-dose Tigogenin group, medium-dose Tigogenin group, and high-dose Tigogenin group), with 3 replicates in each group. The cells were cultured in a 37°C, 5% CO2 incubator for 24 h. When the cells reached 80-90% growth, the plates were washed with PBS. 1 ml of virus dilution was added to each group except the normal group, with a concentration of 100 TCID 50 ,After 2 hours of virus adsorption, the plate was discarded, and Tigogenin was used at high, medium and low modeling concentrations: 0.0125μg / ml, 0.00625μg / ml, and 0.003125μg / ml, respectively. After 48 hours of incubation in 1ml per well, RNA was extracted to detect the expression levels of related genes.

[0050] Primers were designed as follows:

[0051] H1N1 M gene:

[0052] Forward primer CTAAGGCTATGGAGCAAAT

[0053] Reverse primer CACTGGAGCTAGGATGAGT

[0054] IL-6 gene:

[0055] Forward primer GAACTCCTTCTCCACAAGCG

[0056] Reverse primer CCGTCGAGGATGTACCGAAT

[0057] The results are as follows Figure 3 As shown, compared with the positive drug oseltamivir, Tigogenin has obvious therapeutic effects on different genes at low, medium and high concentrations. Although there are fluctuations in the treatment trends of different low, medium and high concentrations, considering the experimental errors, overall, Tigogenin has obvious therapeutic effects on genes related to viral infection.

[0058] Western-blot analysis of the expression levels of related signaling pathway proteins in cells: Cells were collected to extract total cell / lung tissue protein and determine the protein concentration. Samples were loaded and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to the membrane using a semi-dry electrotransfer device. After blocking, the relevant target protein [virus-associated protein (NP)] was added; incubate at 4°C overnight. The membrane was washed three times, and horseradish peroxidase-labeled secondary antibody diluted in the rinse buffer was added and shaken. The PVDF membrane was incubated at room temperature with shaking. ECL staining was performed, and X-ray film was exposed. The results were observed after development, fixing, and scanning. The absorbance of the target bands in the scanned image was analyzed using Image-J software. The absorbance ratio of each target band to the B-action was the relative expression level of the target protein.

[0059] result Figure 4 As shown: When the protein expression of NP protein was detected in the Tigogenin-treated group, the protein expression was reduced to varying degrees, indicating that Tigogenin has the effect of treating influenza virus.

[0060] Immunofluorescence assay: Modeling was performed as described above. After 48 hours of incubation, cells were fixed and permeabilized. The coverslips, on which cells had been grown, were washed three times with 1× PBS. The coverslips were fixed with 4% paraformaldehyde for 15 minutes and then rinsed three times with 1× PBS for 3 minutes each. Cells were permeabilized with 0.5% Triton X-100 (prepared in 1× PBS) for 15 minutes at room temperature. The slides were then rinsed three times with 1× PBS for 3 minutes each. Blocking: The 1× PBS was blotted with absorbent paper. 5% normal serum (same or similar species as the secondary antibody) was added to the slides and blocked at room temperature for 1 hour. Antibody incubation: The blocking solution was removed with absorbent paper. Without washing, a sufficient amount of diluted primary antibody was added to each slide and placed in a humidified chamber for overnight incubation at 4°C. Add fluorescent secondary antibody: Rinse slides three times with PBST (3 minutes each). Blot any excess liquid with absorbent paper, then add diluted fluorescent secondary antibody. Incubate in a humidified chamber at 37°C for 1 hour. Rinse slides three times with PBST (3 minutes each). Fix and photograph: Counterstain nuclei: Add DAPI and incubate in the dark for 5 minutes. Remove excess DAPI by washing with PBST four times for 5 minutes. Blot slides with absorbent paper, mount with mounting solution containing a fluorescence quencher, and observe and acquire images under a fluorescence microscope.

[0061] The results are as follows Figure 5 As shown: Tigogenin has a good inhibitory effect on viral expression in the detection of Influenza gene expression compared with the virus group, and the results are statistically significant.

[0062] Example 4

[0063] This example studies the anti-influenza virus effect of sisal saponin Tigogenin in vivo.

[0064] Sixty 4-week-old SPF-grade BALB / C female mice weighing 12-15 g were randomly divided into a normal group, a virus group, an oseltamivir group, an E7820 group, a low-dose Tigogenin group, and a high-dose Tigogenin group, with 10 mice in each group. Adaptive feeding was performed for one day, and the next day 15 LD 50 The infected mice were anesthetized with FM1 virus dilution of a certain concentration and intranasally injected with Tigogenin at a low dose of 10 mg / Kg and a high dose of 20 mg / Kg, twice a day for 4 days. After the mice became ill, their body weight and lung wet weight were weighed, and the lung index was calculated and the lung tissue pathology section experiments were conducted.

[0065] The results are as follows Figure 8As shown: Compared with the normal group, the intercellular congestion, edema and inflammatory infiltration of mice infected with influenza virus were significantly increased, and the Tigogenin and oseltamivir control groups alleviated them to varying degrees. Asterisks indicate significant levels, *P<0.05, **P<0.01, ***P<0.001.

[0066] The above description is merely a specific embodiment of the present application, but the scope of protection of the present application is not limited thereto. Any person skilled in the art can easily conceive of various modifications or substitutions within the technical scope disclosed in the present invention, and such modifications or substitutions should be included in the scope of protection of the present application. Therefore, the scope of protection of the present application should be based on the scope of protection of the claims.

Claims

1. Use of sisalgenin as the sole active ingredient in the preparation of a drug for treating influenza and viral pneumonia thereof; the influenza is influenza A, and the viral pneumonia is pneumonia induced by influenza A virus.

2. The use according to claim 1, characterized in that The drug can inhibit the expression of the M gene and NP protein of N1N1.

3. The use according to claim 1, characterized in that The drug can inhibit the inflammatory pathology of lung tissue caused by influenza virus and reduce the lung index.

Images