Phytophthora sojae psfbp21 protein, psfbp21 gene and biological material and application thereof

Abstract

The present application relates to the biological field, and particularly to a soybean Phytophthora psFBP21 protein, a psFBP21 gene and biological materials and application thereof.The amino acid sequence of the soybean Phytophthora psFBP21 protein provided in the present application is shown as SEQ ID NO.2; and the nucleotide sequence of the coding gene is shown as SEQ ID NO.1.Through experiments, it is proved that the soybean Phytophthora psFBP21 protein provided in the present application plays an important role in the growth and development of the soybean Phytophthora itself, and specifically, after the protein is deleted, the mycelium growth of the soybean Phytophthora is slowed down, the number of oospores is reduced, the pathogenicity is reduced, and the like.The above conclusion provides a technical basis for exploring the development and pathogenic molecular mechanism of the soybean Phytophthora, and provides a molecular target for the future research and development of a new fungicide.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biology, in particular to a soybean Phytophthora psFBP21 protein, a soybean Phytophthora psFBP21 gene and a biological material and application thereof. BACKGROUND

[0002] Soybean Phytophthora is a very important plant pathogenic oomycete, which mainly causes soybean Phytophthora root rot. The disease belongs to soil-borne disease and occurs in the major soybean producing areas of more than 20 countries in the world. The disease was first discovered and reported in North America in the 1950s. At present, it occurs in the major soybean producing areas of more than 20 countries in Asia, Africa, Europe, North and South America and Oceania. Soybean Phytophthora can infect soybean at the entire growth period and can cause devastating disaster, causing more than 1 billion US dollars of economic loss every year. At present, it is classified as one of the top ten important pathogenic oomycetes.

[0003] Unlike fungal diseases, soybean Phytophthora belongs to the class Oomycetes. Due to the complex life history of soybean Phytophthora, it can infect soybean at the entire growth period. Soybean Phytophthora root rot can cause 20-50% reduction of soybean yield, or even absolute yield, and is particularly serious in heavy rotation or continuous cropping plots, and has been one of the important plant diseases that have been widely concerned and studied by domestic and foreign scholars.

[0004] The life history of soybean Phytophthora is divided into different stages such as mycelium, zoosporangium, zoospore and oospore, all of which have the ability to infect soybean, and the zoospore is the main reinfection source of disease cycle. Therefore, the growth rate of soybean Phytophthora mycelium, the formation of zoospore and the formation of oospore are important factors affecting the occurrence and development of the disease. Reducing the growth rate of soybean Phytophthora mycelium, blocking the formation of oospore and reducing the ability of the pathogen to infect the host plant are effective methods for preventing and controlling soybean Phytophthora root rot.

[0005] During the growth and development or pathogenic process of soybean Phytophthora, proteins with important functions are often important potential molecular targets for the development of fungicides, and the absence of such proteins often affects the infection process and the growth of soybean Phytophthora, thereby controlling the occurrence and cycle of soybean Phytophthora disease and reducing its harm. SUMMARY

[0006] The purpose of the present application is to provide a soybean Phytophthora psFBP21 protein, a soybean Phytophthora psFBP21 gene and a biological material and application thereof, so as to solve the problems existing in the prior art. By inhibiting the expression of the psFBP21 gene in soybean Phytophthora or inhibiting the activity of the soybean Phytophthora psFBP21 protein, the growth rate of soybean Phytophthora mycelium, the oospore yield of soybean Phytophthora, the ability of soybean Phytophthora to infect the host and the pathogenicity of soybean Phytophthora to the host can be reduced.

[0007] To achieve the above purpose, the present application provides the following solutions:

[0008] The present application provides the application of the Phytophthora sojae psFBP21 protein in any one of the following aspects:

[0009] (1) in regulating the mycelium growth rate of Phytophthora sojae;

[0010] (2) in regulating the oospore yield of Phytophthora sojae;

[0011] (7) in regulating the host infection ability of Phytophthora sojae;

[0012] (4) in regulating the pathogenicity of Phytophthora sojae to host;

[0013] The amino acid sequence of the Phytophthora sojae psFBP21 protein is shown in SEQ ID NO. 2.

[0014] Preferably, by inhibiting the activity of the Phytophthora sojae psFBP21 protein in Phytophthora sojae, the mycelium growth rate, oospore yield, host infection ability or pathogenicity of Phytophthora sojae to host are reduced.

[0015] As an additional case, the Phytophthora sojae psFBP21 protein provided by the present application is as follows:

[0016] A1) a protein with the amino acid sequence shown in SEQ ID NO. 2;

[0017] A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a protein with the amino acid sequence shown in SEQ ID NO. 2;

[0018] A3) a protein derived from a protein with the amino acid sequence shown in SEQ ID NO. 2, which has the same function and is obtained by substitution and / or deletion and / or addition of one or more amino acid residues.

[0019] As an additional case, in order to facilitate the purification of the Phytophthora sojae psFBP21 protein of the present application, a Poly-Arg (RRRRR, SEQ ID NO. 16), Poly-His (HHHHHH, SEQ ID NO. 17), FLAG (DYKDDDDK, SEQ ID NO. 18), Strep-tag II (WSHPQFEK, SEQ ID NO. 19), C-myc (EQKLISEEDL, SEQ ID NO. 20) or the like can be connected to the amino-terminal end or carboxyl-terminal end of the amino acid shown in SEQ ID NO. 2.

[0020] The psFBP21 protein of the invention can be artificially synthesized, or the coding gene thereof can be synthesized first and then expressed biologically.

[0021] The coding gene of the protein in A2)-A3) can be obtained by deleting one or several amino acid residues in the DNA sequence shown in SEQ ID NO. 1; and / or performing a missense mutation of one or several nucleotide pairs; and / or connecting the coding sequence of the above-mentioned tag at the 5' end and / or 3' end.

[0022] As an additional case, the invention provides the use of a nucleic acid molecule encoding the psFBP21 protein of Phytophthora sojae in any one of the following:

[0023] (1) in regulating the mycelial growth rate of P. sojae;

[0024] (2) in regulating the oospore yield of P. sojae;

[0025] (7) in regulating the host infection ability of P. sojae;

[0026] (4) in regulating the pathogenicity of P. sojae to the host;

[0027] Further preferably, the nucleic acid molecule comprises an RNA nucleic acid molecule or a DNA nucleic acid molecule.

[0028] Further preferably, the DNA nucleic acid molecule comprises cDNA, genomic DNA or recombinant DNA.

[0029] The invention provides the use of the psFBP21 gene of P. sojae in any one of the following:

[0030] (1) in regulating the mycelial growth rate of P. sojae;

[0031] (2) in regulating the oospore yield of P. sojae;

[0032] (7) in regulating the host infection ability of P. sojae;

[0033] (4) in regulating the pathogenicity of P. sojae to the host;

[0034] The nucleotide sequence of the psFBP21 gene of P. sojae is shown in SEQ ID NO. 1.

[0035] Preferably, the mycelial growth rate, oospore yield, host infection ability or pathogenicity of P. sojae to the host is reduced by deleting the psFBP21 gene of P. sojae.

[0036] The soybean Phytophthora psFBP21 gene consists of 1397 nucleotides; the 1-276th, 403-945th and 1050-1397th nucleotides from the 5' end of SEQ ID NO. 1 are coding sequences, which encode the soybean Phytophthora psFBP21 protein as shown in SEQ ID NO. 2.

[0037] As an additional case, the application provides the use of the RNA molecule obtained by transcription of the soybean Phytophthora psFBP21 gene in any of the following applications:

[0038] (1) in regulating the mycelium growth rate of the soybean Phytophthora;

[0039] (2) in regulating the sporangium production of the soybean Phytophthora;

[0040] (3) in regulating the host infection ability of the soybean Phytophthora;

[0041] (4) in regulating the pathogenicity of the soybean Phytophthora to the host;

[0042] The application provides the use of the biological material containing the soybean Phytophthora psFBP21 gene in any of the following applications:

[0043] (1) in regulating the mycelium growth rate of the soybean Phytophthora;

[0044] (2) in regulating the sporangium production of the soybean Phytophthora;

[0045] (3) in regulating the host infection ability of the soybean Phytophthora;

[0046] (4) in regulating the pathogenicity of the soybean Phytophthora to the host;

[0047] The nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown in SEQ ID NO. 1.

[0048] Preferably, the biological material includes an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line.

[0049] As an alternative, the application includes the above-mentioned applications achieved by inhibiting the transcription or inactivation of the soybean Phytophthora psFBP21 gene;

[0050] and / or, the above-mentioned applications achieved by inhibiting the translation of the RNA molecule obtained by transcription of the soybean Phytophthora psFBP21 gene;

[0051] and / or, the above-mentioned applications achieved by inhibiting or inactivating the activity of the soybean Phytophthora psFBP21 protein;

[0052] The amino acid sequence of the soybean Phytophthora psFBP21 protein is shown as SEQ ID NO. 2; the nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown as SEQ ID NO. 1.

[0053] As an alternative, the recombinant vector can be a recombinant expression vector or a recombinant cloning vector;

[0054] In the biological material, the vector can be a plasmid, cosmid, bacteriophage or viral vector; the microorganism can be a yeast or a bacterium; the transgenic plant cell line does not include propagation material.

[0055] As an alternative, the biological material is any of the following D1 to D10:

[0056] D1) an expression cassette containing the soybean Phytophthora psFBP21 gene;

[0057] D2) a recombinant vector containing the soybean Phytophthora psFBP21 gene or a recombinant vector containing the expression cassette of D1);

[0058] D3) a recombinant microorganism containing the soybean Phytophthora psFBP21 gene, a recombinant microorganism containing the expression cassette of D1) or a recombinant microorganism containing the recombinant vector of D2);

[0059] D4) a transgenic plant cell line containing the soybean Phytophthora psFBP21 gene or a transgenic plant cell line containing the expression cassette of D1);

[0060] D5) a transgenic plant tissue containing the soybean Phytophthora psFBP21 gene or a transgenic plant tissue containing the expression cassette of D2);

[0061] D6) a transgenic plant organ containing the soybean Phytophthora psFBP21 gene or a transgenic plant organ containing the expression cassette of D2);

[0062] D7) a nucleic acid molecule inhibiting the expression of the soybean Phytophthora psFBP21 gene;

[0063] D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule of D7);

[0064] D9) a nucleic acid molecule inhibiting the translation of an RNA molecule obtained by inhibiting the transcription of the soybean Phytophthora psFBP21 gene;

[0065] D10) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule of D9).

[0066] The application provides application of a soybean Phytophthora psFBP21 protein, a soybean Phytophthora psFBP21 gene or a biological material containing the soybean Phytophthora psFBP21 gene in screening and / or auxiliary screening of a soybean Phytophthora fungicide and / or bactericide, wherein an amino acid sequence of the soybean Phytophthora psFBP21 protein is shown as SEQ ID NO. 2, and a nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown as SEQ ID NO. 1.

[0067] Preferably, the biological material comprises an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line.

[0068] As an additional case, the application provides application of a nucleic acid molecule encoding the soybean Phytophthora psFBP21 protein or an RNA molecule obtained by transcription of the soybean Phytophthora psFBP21 gene in screening and / or auxiliary screening of a soybean Phytophthora fungicide and / or bactericide.

[0069] The application provides a method for screening or auxiliary screening of a soybean Phytophthora fungicide and / or bactericide, comprising the step of detecting the expression amount of the soybean Phytophthora psFBP21 gene in the soybean Phytophthora before and after administration; and a nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown as SEQ ID NO. 1.

[0070] Further preferably, when the pesticide preparation can inhibit transcription of the soybean Phytophthora psFBP21 gene, inhibit translation of an RNA nucleic acid molecule obtained by transcription of the soybean Phytophthora psFBP21 gene, inhibit activity of the soybean Phytophthora psFBP21 protein or inactivate the soybean Phytophthora psFBP21 protein, the pesticide preparation can be used as the fungicide and / or bactericide of the soybean Phytophthora.

[0071] An amino acid sequence of the soybean Phytophthora psFBP21 protein is shown as SEQ ID NO. 2, and a nucleotide sequence of the soybean Phytophthora psFBP21 gene is shown as SEQ ID NO. 1.

[0072] As an optional solution, the method for screening or auxiliary screening of a soybean Phytophthora fungicide and / or bactericide provided by the application comprises the following steps: applying a to-be-detected substance to the soybean Phytophthora, and when the to-be-detected substance can inhibit transcription of the soybean Phytophthora psFBP21 gene, inhibit translation of an RNA nucleic acid molecule obtained by transcription of the soybean Phytophthora psFBP21 gene, inhibit the soybean Phytophthora psFBP21 protein or inactivate the soybean Phytophthora psFBP21 protein, the to-be-detected substance is a candidate of the soybean Phytophthora fungicide and / or bactericide.

[0073] As an optional solution, in the above method, the inactivation of the soybean Phytophthora psFBP21 protein is achieved by inhibiting the expression of the coding gene (soybean Phytophthora psFBP21 gene) of the soybean Phytophthora psFBP21 protein, and specifically, the inactivation can be achieved by gene knockout or by gene silencing.

[0074] As an optional solution, the method for gene knockout of the above gene is a CRISPR / Cas9-based gene knockout method.

[0075] As an optional solution, the sgRNA and Cas9 co-expression plasmid is a vector for co-expressing an sgRNA fragment targeting a gene to be knocked out and a coding of Cas9, wherein the gene to be knocked out is the soybean Phytophthora psFBP21 gene, and the sgRNA sequence targeting the soybean Phytophthora psFBP21 gene is GTCGTCGTGGGAGGTCCCTG, SEQ ID NO. 15.

[0076] The present application discloses the following technical effects:

[0077] The present application provides a soybean Phytophthora psFBP21 protein, a psFBP21 gene, and a biomaterial and applications thereof. The results of specific embodiments of the present application show that the soybean Phytophthora psFBP21 protein provided by the present application plays a role in the growth and development of soybean Phytophthora itself. The knockout mutant obtained by using the CRISPR / Cas9 gene editing technology has obvious changes in growth and development compared with the wild-type parent strain, mainly manifested as: the mycelial growth rate of the soybean Phytophthora psFBP21 gene single knockout mutant is slowed down, the oospore is reduced, and the ability to infect host plants is weakened; therefore, the soybean Phytophthora psFBP21 protein can play an important role in each process of the vegetative growth, sexual reproduction, and infection of the host of soybean Phytophthora. The present application provides technical support for the pathogenic mechanism research of soybean Phytophthora, and provides a potential molecular target for the research and development of new fungicides in the future. BRIEF DESCRIPTION OF DRAWINGS

[0078] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0079] Figure 1 is a columnar statistical diagram of the mycelial growth rate of different strains;

[0080] Figure 2 is a columnar statistical diagram of the oospore yield of different strains;

[0081] Figure 3 Column chart of pathogenicity of different strains. DETAILED DESCRIPTION

[0082] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. Such description, however, is to be considered in all respects only as illustrative, and not restrictive.

[0083] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the broader ranges is also specifically included in the present application. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0084] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials that are related to the present application. In the case of conflict between the present specification and any document incorporated by reference, the present specification will control.

[0085] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0086] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional elements or steps.

[0087] The experimental methods in the following examples are routine unless otherwise stated. The materials, reagents used in the following examples are commercially available unless otherwise stated.

[0088] Phytophthora sojae strain P6497 (WT) and the vectors used PYF 515, pBluescript II SK + Donated by the Oomycete and Fungal Molecular Lab, Nanjing Agricultural University.

[0089] The present application provides a FBP21 (Formin Binding Protein) protein derived from Phytophthora sojae, and names it as psFBP21 protein of Phytophthora sojae. The protein is closely related to the growth rate of mycelium of Phytophthora sojae and the yield of oospores, which are related to the infection cycle of plant diseases. Therefore, the growth of mycelium can be slowed down, the normal oospore production can be blocked, and the ability of Phytophthora sojae to infect host can be affected by regulating the psFBP21 protein of Phytophthora sojae, so as to control the occurrence and development of Phytophthora sojae root rot. The specific verification is carried out through the following examples.

[0090] Example 1: Obtaining of FBP21 protein (psFBP21) of Phytophthora sojae and its encoding gene

[0091]

[0092] The above Phytophthora sojae psFBP21 protein or Phytophthora sojae psFBP21 gene can also be artificially synthesized.

[0093] Table 1 Amplification primers of the coding gene of full-length Phytophthora sojae psFBP21 protein

[0094]

[0095] Example 2 Construction of Phytophthora sojae psFBP21 gene knockout vector

[0096] The Donor vector used in this embodiment is pBS-NPT II-psFBP21; the sgRNA and Cas 9 co-expression plasmid is PYF515-psFBP21;

[0097] The specific construction method is as follows:

[0098] 1) Construction of pBS-NPT II-psFBP21:

[0099] 2+ 10 μL, dNTP Mixture (2.5 mM each) 1.6 μL, PrimeSTAR HS DNA Polymerase (2.5 U / μL) 0.2 μL, psFBP21-F1 11 μL, psFBP21-R1 11 μL, template DNA 1 μL, ddH2O 5.2 μL; PCR reaction program: 98 °C pre-denaturation 10 min; 98 °C denaturation 10 s, 55 °C annealing 5 s, 72 °C extension 1 min, a total of 35 cycles; finally 72 °C extension 10 min, one cycle. The three amplified fragments were fused into the cloning vector pBluescript II SK + (EcoR V digestion), and the ligation product was transformed into E. coli DH5α competent cells. After overnight culture at 37 °C, the recombinant expression vector containing the 1000 bp sequence upstream of the psFBP21 gene, the NPTII gene sequence, and the 1000 bp sequence downstream of the psFBP21 gene was verified by amplification and sequencing using the universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3', SEQ ID NO. 7) / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3', SEQ ID NO. 8). The verified recombinant expression vector was named pBS-NPT II-psFBP21.

[0100] Table 2 primer sequences for vector construction

[0101]

[0102] 2) Construction of PYF 515-sgFBP21:

[0103] The sgRNA sequence specifically targeting the psFBP21 gene and having a weak secondary structure (sgFBP21, the sequence of which is shown in SEQ ID NO. 15, specifically GTCGTCGTGGGAGGTCCCTG, targeting the 102-121th position of SEQ ID NO. 1 of the psFBP21 gene) was selected by using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the online RNA structure analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predictl / Predictl.html), and the forward and reverse sgRNA sequences with Nhe I and Bsa I enzyme cutting sites and HH ribozyme were synthesized and ligated to the vector PYF 515 to obtain the recombinant vector of sgRNA, which was named PYF 515-sgFBP21.

[0104] Example 3: Obtaining of the psFBP21 gene knockout transformant of Phytophthora sojae

[0105] The psFBP21 gene knockout transformant was prepared by using the CaCl2-PEG mediated protoplast transformation method, and the method of oomycete genetic transformation was disclosed in the literature “Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology” (Fang, Y., and Tyler, B. M. (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139).

[0106] After screening the transformants by G418 resistance, the mycelial DNA of the suspected transformants was extracted for PCR sequencing verification, and the psFBP21 gene single knockout transformant of Phytophthora sojae, z-9 strain, was obtained.

[0107] Example 4: Biological trait analysis of the psFBP21 gene knockout transformant (z-9 strain) of Phytophthora sojae

[0108] I. Mycelial growth rate detection

[0109] Wild type P. sojae strain P6497 (WT), control transformant (CK, constructed as in Example 3, but without knocking out the P. sojae psFBP21 gene) and the P. sojae psFBP21 single knock-out transformant (z-9 strain) obtained in Example 3 were inoculated in the center of sterile Petri dishes (9 cm in diameter) with 15 mL V8 solid medium, and incubated at 25°C in the dark for 5 days. The colony diameters of the strains were measured by cross method, and each strain was repeated for 3 times. The results are shown in Figure 1 The results show that the mycelial growth rates of all the P. sojae psFBP21 single knock-out transformants (z-9 strain) are significantly lower than those of the wild type P. sojae strain P6497 (WT) and the control transformant (CK).

[0110] The experimental results show that the P. sojae psFBP21 gene or the P. sojae psFBP21 protein is involved in the regulation of the mycelial growth of P. sojae.

[0111] II. Oospore number statistics

[0112] Wild type P. sojae strain P6497 (WT), control transformant (CK) and the P. sojae psFBP21 single knock-out transformant (z-9 strain) obtained in Example 3 were inoculated in the center of sterile Petri dishes (9 cm in diameter) with 15 mL V8 solid medium, and incubated at 25°C in the dark for 14 days. The number and morphology of the oospores were observed under a microscope, and the deformity rate was calculated. Each strain was repeated for 3 times. The results are shown in Figure 2 The results show that the oospore number of the P. sojae psFBP21 single knock-out transformant (z-9 strain) obtained in Example 3 is lower than that of the wild type P. sojae strain P6497 (WT) and the control transformant (CK).

[0113] III. Pathogenicity detection

[0114] The soybean variety was Hefeng 50. A zoospore suspension (2 x 10 4 The zoospore suspension (2 x 10 Figure 3 The results show that the pathogenicity of the P. sojae psFBP21 single knock-out transformant (z-9 strain) obtained in Example 3 is significantly lower than that of the wild type P. sojae strain P6497 (WT).

[0115] The experimental results show that the soybean Phytophthora psFBP21 gene or the soybean Phytophthora psFBP21 protein has the ability to participate in the regulation of the soybean Phytophthora infection of the host plant.

[0116] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.

Claims

1. Use of a Phytophthora sojae psFBP21 protein in any one of the following: (1) reducing the growth rate of P. sojae mycelium; (2) reducing the production of P. sojae oospores; (3) reducing the ability of P. sojae to infect a host; the amino acid sequence of the P. sojae psFBP21 protein is shown as SEQ ID NO. 2; inactivating the P. sojae psFBP21 protein in P. sojae to reduce the growth rate of P. sojae mycelium, the production of P. sojae oospores, or the ability of P. sojae to infect a host.

2. Use of a Phytophthora sojae psFBP21 protein to reduce the pathogenicity of Phytophthora sojae on a host, characterized in that, the amino acid sequence of the P. sojae psFBP21 protein is shown as SEQ ID NO. 2; inactivating the P. sojae psFBP21 protein in P. sojae to reduce the pathogenicity of P. sojae to a host.

3. Use of a P. sojae psFBP21 gene in any one of the following: (1) reducing the growth rate of P. sojae mycelium; (2) reducing the production of P. sojae oospores; (3) reducing the ability of P. sojae to infect a host; the nucleotide sequence of the P. sojae psFBP21 gene is shown as SEQ ID NO. 1; knocking out the P. sojae psFBP21 gene in P. sojae to reduce the growth rate of P. sojae mycelium, the production of P. sojae oospores, or the ability of P. sojae to infect a host.

4. Use of a Phytophthora sojae psFBP21 gene to reduce the pathogenicity of Phytophthora sojae on a host, characterized in that, the nucleotide sequence of the P. sojae psFBP21 gene is shown as SEQ ID NO. 1; knocking out the P. sojae psFBP21 gene in P. sojae to reduce the pathogenicity of P. sojae to a host.

5. Use of a biological material in any one of the following: (1) reducing the growth rate of P. sojae mycelium; (2) reducing the production of P. sojae oospores; (3) reducing the ability of P. sojae to infect a host; the nucleotide sequence of the P. sojae psFBP21 gene is shown as SEQ ID NO. 1; the biological material is any one of the following: 1) a nucleic acid molecule inhibiting the expression of the P. sojae psFBP21 gene; 2) an expression cassette, a recombinant vector, a recombinant microorganism, or a transgenic plant cell line containing the nucleic acid molecule of 1); 3) a nucleic acid molecule inhibiting the translation of an RNA molecule obtained by inhibiting the transcription of the P. sojae psFBP21 gene; 4) an expression cassette, a recombinant vector, a recombinant microorganism, or a transgenic plant cell line producing the nucleic acid molecule of 3).

6. Use of a biomaterial in reducing the pathogenicity of Phytophthora sojae to a host, characterized in that, the nucleotide sequence of the P. sojae psFBP21 gene is shown as SEQ ID NO. 1; the biological material is any one of the following: 1) a nucleic acid molecule inhibiting the expression of the P. sojae psFBP21 gene; 2) an expression cassette, a recombinant vector, a recombinant microorganism, or a transgenic plant cell line containing the nucleic acid molecule of 1); 3) a nucleic acid molecule inhibiting the translation of an RNA molecule obtained by inhibiting the transcription of the P. sojae psFBP21 gene; 4) an expression cassette, a recombinant vector, a recombinant microorganism, or a transgenic plant cell line producing the nucleic acid molecule of 3).

Images