Mesothelin binding molecules and uses thereof

Abstract

The invention provides a mesothelin binding molecule, the mesothelin binding molecule comprises an anti-mesothelin single-domain antibody, and a complementary determining region (CDR) of the single-domain antibody comprises a CDR1 shown as SEQ ID NO: 1, a CDR2 shown as SEQ ID NO: 2 and a CDR3 shown as SEQ ID NO: 3.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine or biopharmaceuticals, and more specifically to a mesothelin binding molecule and application thereof. Background Art

[0002] The mesothelin (MSLN) gene is located on chromosome 1p13.3, with a total length of 8kD. The gene contains an open reading frame of 1884bp, encoding 17 exons and 628 amino acids. The precursor protein of MSLN is a glycoprotein of about 69kD anchored to the cell membrane by glycosylphosphatidylinositol, which can be hydrolyzed by proteolytic enzymes into two parts, of which the N-terminal is a 31kD soluble protein with megakaryocyte stimulating activity, known as megakaryocyte potentiating factor (MPF); and the C-terminal is a membrane-bound protein of about 40kD with cell adhesion, known as MSLN. The structure of MSLN in the membrane protein can be divided into three different segments, of which zone I is the binding site of the ligand CA125.

[0003] Mesothelin, as a differentiation antigen, is highly expressed in a variety of malignant tumors and is closely related to the occurrence and development of tumors. This target is one of the most promising anti-tumor targets. Many large pharmaceutical companies have targeted this target for development. Currently, the drug forms entering clinical trials include CAR-T, monoclonal antibodies, ADC, etc. In the past nearly 20 years, a variety of anti-mesothelin monoclonal antibodies have been developed, mainly including SS1P immunotoxin and MORAB-009. SS1P is a recombinant immunotoxin composed of a fusion of scFv and a truncated pseudoexotoxin, which mainly mediates cell killing; MORAB-009 is an IgG1 antibody recombined with the SS1P sequence, which mainly causes antibody-dependent cell-mediated cytotoxicity (ADCC).

[0004] SS1P antibody binds to the mesothelin I region and can block the binding of CA125 and mesothelin. This antibody has also been used in CAR-T treatment, but the efficacy is not ideal (Jiang, H. et al., Protein Cell 8, 926–931, 2017; Adusumilli, PS et al., Sci. Transl. Med. 6, 261ra151, 2014; Lanitis, E. et al., Mol. Ther. 20, 633–643, 2012).

[0005] Nanobodies have the natural advantages of high stability, strong penetration, and wide binding epitopes (Muyldermans S. Annu Rev Biochem. 2013; 82: 775-97.). Developing a new type of anti-mesothelin nanobody with good specificity, blocking activity, clinical efficacy, simple production, low cost, and reduced medication burden has become an urgent problem to be solved. Summary of the invention

[0006] The purpose of the present invention is to provide a novel anti-mesothelin binding molecule and its application.

[0007] In a first aspect, the present invention provides a mesothelin binding molecule comprising an anti-mesothelin single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO:1, CDR2 comprises the sequence shown in SEQ ID NO:2, and CDR3 comprises the sequence shown in SEQ ID NO:3.

[0008] In one or more embodiments, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8X9X 10 X 11 , wherein X1 is G, A, D, E, F, N, R, T or V, X2 is D, F, G, I, L, M, N, P, R, S, T or V, X3 is A, D, F, I, L, M, N, P, R, S or T, X4 is A, D, E, F, G, H, I, L, P, R, S, T or V, X5 is A, D, E, G, K, N, Q, R, S, T, V, W or Y, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, Y or none, X7 is A, D, F, H, K, L, N, P, R, S, T, W, Y or none, X8 is A, D, F, G, H, I, L, N, P, Q, S, T, V, Y or none, X9 is E, V, Y or none, X 10 Y, F or None, X 11 A or None.

[0009] In one or more embodiments, SEQ ID NO: 1 is XXXXXXXXX, wherein X1 is G, A, D, E, R, T, or V, X2 is D, F, G, I, L, M, N, P, R, S, T, or V, X3 is A, D, F, I, L, M, N, P, R, S, or T, X4 is A, D, E, F, G, H, I, L, S, T, or V, X5 is A, D, E, G, K, N, R, S, T, or V, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, or Y, X7 is A, D, F, H, K, L, N, R, S, T, W, or Y, and X8 is A, D, F, G, H, I, L, N, P, Q, S, T, V, or Y.

[0010] In one or more embodiments, SEQ ID NO: 1 is GXXXXXX, wherein X2 is D, F, G, I, L, R, S, T, or V, X3 is A, D, F, I, L, P, R, S, or T, X4 is A, D, E, F, H, I, L, S, T, or V, X5 is A, D, E, G, K, N, R, S, or T, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, or Y, X7 is A, D, F, H, K, L, N, R, S, T, W, or Y, and X8 is A, D, G, H, I, L, N, P, Q, S, T, V, or Y.

[0011] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-81.

[0012] In one or more embodiments, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X16X 17 , wherein X1 is A, F, H, I, K, L, M, R, S or V, X2 is A, D, F, G, I, K, L, M, N, P, R, S, T, V, W or Y, X3 is A, D, E, G, H, I, K, L, M, N, P, R, S, T, V, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K, N, S or T, X6 is A, D, E, F, G, H, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, X8 is A, G, I, K, N, P, Q, R, T or none, X9 is F, G, H, S, T or none, X 10 G, P, Y or none, X11 A, S, V or None, X 12 D, T or None, X 13 T, S or None, X 14 V or None, X 15 N or None, X 16 S or None, X 17 T or None.

[0013] In one or more embodiments, SEQ ID NO:2 is XXXXXXXXXXXX, wherein X1 is A, F, H, I, K, L, M, R, S, or V, X2 is A, D, F, G, K, L, M, N, P, R, S, T, V, W, or Y, X3 is A, D, E, G, H, I, L, M, N, P, R, S, T, V, W, or Y, X4 is A, D, E, G, L, N, R, S, T, or V, X5 is D, E, G, H, K, N, or S, X6 is A, D, F, G, H, L, M, N, R, S, T, or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V, or none, and X8 is A, G, I, K, P, R, T, or none.

[0014] Preferably, SEQ ID NO:2 is IX2XXXXXXXXX, wherein X2 is A, D, G, K, L, N, P, R, S, T, V or Y, X3 is A, D, E, G, I, L, M, N, P, R, S, T, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K or S, X6 is A, D, F, G, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, and X8 is A, G, I, K, P, R, T or none.

[0015] In one or more embodiments, CDR2 comprises a sequence as shown in any one of SEQ ID NOs: 82-165. In one or more embodiments, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20, wherein X1 is A, E, H, K, N, Q, R, S, T, V or Y, X2 is A, E, F, G, I, K, L, Q, R, S, T or V, X3 is A, D, E, F, G, I, K, L, M, N, P, R, S, T, V or W, X4 is A, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y, and X5 is A, D, E, F, G, I, K, L, M, N, P, Q, R, S, T, V, W or Y, X6 is A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, Y or none, X7 is A, C, D, E, F, G, I, K, L, N, P, Q, R, S, T, V, W, Y or none, X8 is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or none, X9 is A, C, D, E, G, H, I, K, L, N, Q, R, S, T, V, W, Y or none, X 10 A, D, G, I, K, L, N, P, R, S, V, Y or None, X 11 A, C, D, E, F, H, I, P, Q, R, S, T, V, Y or None, X 12 A, C, D, E, G, K, L, R, S, T, V, Y or none, X 13 D, F, G, H, I, K, M, N, P, R, S, T, Y or None, X 14 D, E, G, L, N, P, Q, S, V, Y or none, X 15 A, E, F, P, R, T, W, Y or none, X 16 A, R, S, Y or none, X 17 D, I, N, Y or None, X 18 G, N, S or None, X 19 G, N or None, X 20 S or None.

[0016] In one or more embodiments, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 166-253.

[0017] In one or more embodiments, the CDR1 of the single domain antibody comprises a sequence as shown in any one of SEQ ID NOs: 4-81, CDR2 comprises a sequence as shown in any one of SEQ ID NOs: 82-165, and CDR3 comprises a sequence as shown in any one of SEQ ID NOs: 166-253.

[0018] In one or more embodiments, the single domain antibody contains CDR1, CDR2 and CDR3 shown in any one of Group a1 to Group a111 of the following SEQ ID NO:

[0019]

[0020]

[0021]

[0022]

[0023] In one or more embodiments, FR1 of the single-domain antibody VHH can be selected from FR1 of the VHH of each antibody number in Table 1, FR2 of VHH can be selected from FR2 of the VHH of each antibody number in Table 1, FR3 of VHH can be selected from FR3 of the VHH of each antibody number in Table 1, and FR4 of VHH can be selected from FR4 of the VHH of each antibody number in Table 1.

[0024] In one or more embodiments, the FR region of the single domain antibody is a FR region of any VHH selected from SEQ ID NOs: 254-364.

[0025] In one or more embodiments, the single domain antibody VHH is as shown in any one of SEQ ID NOs: 254-364.

[0026] In one or more embodiments, the mesothelin binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen binding fragment thereof, an antibody or an antigen binding fragment thereof comprising one, two or more anti-mesothelin single domain antibodies described herein.

[0027] In one or more embodiments, the multivalent single domain antibody or multispecific single domain antibody is connected to multiple single domain antibodies via a linker. The linker consists of 1-15 amino acids selected from G and S.

[0028] In one or more embodiments, the antigen-binding fragment of the heavy chain antibody is a single-chain heavy chain antibody.

[0029] In one or more embodiments, the heavy chain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0030] In one or more embodiments, the heavy chain antibody further comprises a heavy chain constant region.

[0031] In one or more embodiments, the heavy chain constant region is a constant region of a camel heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the mesothelin binding molecule is a chimeric antibody, comprising the single domain antibody and an Fc region, preferably, the Fc region is the Fc of human IgG, such as the Fc of IgG1. Preferably, the sequence of the Fc region is as shown in SEQ ID NO: 365.

[0032] In one or more embodiments, the Fc region is the Fc of rabbit IgG, preferably, the sequence of the Fc region is shown in SEQ ID NO:366.

[0033] In one or more embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4 and CH5.

[0034] In one or more embodiments, the antibody is an antibody comprising the anti-mesothelin single domain antibody as a heavy chain variable domain.

[0035] In one or more embodiments, the antibody further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain.

[0036] In one or more embodiments, the antigen-binding fragment of an antibody is selected from Fab, F(ab')2, Fv, scFv.

[0037] In one or more embodiments, the binding molecule described in any embodiment of the present invention is a chimeric antibody or a fully human antibody; preferably a fully human antibody.

[0038] The present invention also provides an immunoconjugate comprising the mesothelin binding molecule described in any embodiment herein.

[0039] The present invention also provides a polynucleotide selected from:

[0040] (1) the coding sequence of the mesothelin-binding molecule or antigen-binding fragment thereof described in any embodiment of the present invention;

[0041] (2) the complementary sequence of (1);

[0042] (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

[0043] In one or more embodiments, the fragment is a primer.

[0044] The present invention also provides a nucleic acid construct comprising the polynucleotide described herein.

[0045] In one or more embodiments, the nucleic acid construct is a recombinant vector or an expression vector.

[0046] The present invention also provides a phage comprising the mesothelin binding molecule described in any of the embodiments herein.

[0047] In one or more embodiments, the mesothelin binding molecule is displayed on the surface of the bacteriophage.

[0048] The present invention also provides a host cell, wherein:

[0049] (1) expressing a mesothelin-binding molecule or immunoconjugate as described in any embodiment of the present invention;

[0050] (2) comprising a polynucleotide as described herein; and / or

[0051] (3) comprising the nucleic acid construct described herein.

[0052] In one or more embodiments, the cell is an immune effector cell.

[0053] The present invention also provides a method for producing a mesothelin-binding molecule, comprising: culturing the host cell described herein under conditions suitable for producing a mesothelin-binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof), and optionally purifying the mesothelin-binding molecule from the culture.

[0054] The present invention also provides a pharmaceutical composition comprising the mesothelin-binding molecule, immunoconjugate, polynucleotide, nucleic acid construct, phage or host cell described in any embodiment herein, and a pharmaceutically acceptable excipient.

[0055] In one or more embodiments, the pharmaceutical composition is used to treat cancer.

[0056] In one or more embodiments, the cancer is a mesothelin-related cancer. Preferably, the cancer includes: mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, etc.

[0057] The present invention also provides use of the mesothelin-binding molecule described in any embodiment herein in the preparation of a medicament for preventing or treating cancer.

[0058] In one or more embodiments, the mesothelin binding molecule serves as a moiety that targets mesothelin.

[0059] In one or more embodiments, the cancer is a mesothelin-related cancer. Preferably, the cancer includes: mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, etc.

[0060] The present invention also provides use of the mesothelin-binding molecule described in any embodiment herein in the preparation of an immunoconjugate or an immune effector cell.

[0061] In one or more embodiments, the immune effector cells express a mesothelin binding molecule or a polypeptide molecule comprising a mesothelin binding molecule.

[0062] In one or more embodiments, the mesothelin binding molecule is located on the surface of the immune effector cell.

[0063] The present invention also provides a method for treating or preventing cancer, comprising administering to a patient in need thereof a therapeutically effective amount of the mesothelin binding molecule or immunoconjugate described in any embodiment of the present invention, or a pharmaceutical composition containing the mesothelin binding molecule or immunoconjugate described in any embodiment of the present invention.

[0064] In one or more embodiments, the cancer is a mesothelin-related cancer. Preferably, the cancer includes: mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, etc.

[0065] The present invention also provides a kit for detecting mesothelin, which is used for evaluating the effect of drug treatment or diagnosing cancer, and the kit comprises the mesothelin binding molecule, immunoconjugate, polynucleotide, nucleic acid construct, bacteriophage, and host cell described in any embodiment of the present invention.

[0066] In one or more embodiments, the kit further comprises a reagent for detecting the binding of mesothelin to the single domain antibody, antibody or antigen binding fragment thereof, for example, a reagent for detecting the binding by enzyme-linked immunosorbent assay.

[0067] In one or more embodiments, the detection binding agent is a detectable label that can be linked to the mesothelin binding molecule, such as biotin. The detectable label is linked to the mesothelin binding molecule or exists separately in the kit.

[0068] The present invention also provides a non-diagnostic method for detecting the presence of mesothelin in a sample, the method comprising: incubating the sample with the mesothelin binding molecule described in any embodiment of the present invention, and detecting the binding of mesothelin to a single domain antibody, an antibody or an antigen-binding fragment thereof, thereby determining the presence of mesothelin in the sample. The detection is an enzyme-linked immunosorbent assay.

[0069] The present invention also provides the use of the mesothelin-binding molecule described in any embodiment herein in the preparation of a kit for detecting mesothelin in a sample, evaluating the effect of drug treatment, or diagnosing cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1-6 This is the ELISA curve of antibody binding to MSLN antigen.

[0071] Figure 7-8 The binding of candidate antibodies to MSLN on the surface of H226 cells. DETAILED DESCRIPTION

[0072] The inventors have conducted extensive and in-depth research and found a class of mesothelin binding molecules including anti-mesothelin single domain antibodies after a large number of screenings. The experimental results show that the binding molecules of the present invention can specifically recognize mesothelin, bind to mesothelin or cells expressing mesothelin and tumor cells with high affinity, and have no tissue cross-reaction. The single domain antibody of the present invention is easy to generate.

[0073] Antibody

[0074] As used herein, "mesothelin binding molecules" or "MSLN binding molecules" are proteins that specifically bind to mesothelin, including but not limited to antibodies, antigen-binding fragments of antibodies, heavy chain antibodies, nanobodies, minibodies, affibodies, target binding regions of receptors, cell adhesion molecules, ligands, enzymes, cytokines, and chemokines.

[0075] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions having multiple epitope specificities, multispecific antibodies (e.g., bispecific antibodies), diabodies and single-chain molecules, as well as antibody fragments, especially antigen-binding fragments, e.g., Fab, F(ab')2 and Fv). As used herein, the terms "immunoglobulin" (Ig) and "antibody" are used interchangeably.

[0076] The basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light chains (L) and two identical heavy chains (H). IgM antibodies consist of 5 basic heterotetrameric units and an additional polypeptide called J chain, containing 10 antigen binding sites; while IgA antibodies contain 2-5 basic 4-chain units, which can be combined with J chains to form multivalent assemblies. In the case of IgG, the 4-chain unit is usually about 150,000 Daltons. Each light chain is connected to the heavy chain by one covalent disulfide bond, while the two heavy chains are connected to each other by one or more disulfide bonds, the number of which depends on the isotype of the heavy chain. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has a variable domain (VH) at the N-terminus, followed by three (CH1, CH2 and CH3 for each α and γ chain) and four (CH1, CH2, CH3 and CH4 for μ and ε isotypes) constant domains (CH) and a hinge region (Hinge) between the CH1 domain and the CH2 domain. Each light chain has a variable domain (VL) at the N-terminus, followed by a constant domain (CL) at the other end. VL is arranged with VH, while CL is arranged with the first constant domain (CH1) of the heavy chain. Specific amino acid residues are considered to form an interface between the light chain and heavy chain variable domains. Pairs of VH and VL together form an antigen binding site. For the structure and properties of different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw, ed., Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6. Light chains from any vertebrate species can be assigned to one of two distinct types, called kappa and lambda, based on their constant domain amino acid sequences. Immunoglobulins can be assigned to different classes or isotypes based on their heavy chain constant domain (CH) amino acid sequences. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains called α, δ, ε, γ, and μ, respectively. Based on relatively minor differences in CH sequence and function, the γ and α classes can be further divided into subclasses, for example humans express the following subclasses: IgG1, IgG2A, IgG2B, IgG3, IgG4, IgA1, and IgA2.

[0077] The "heavy chain antibody" described herein is an antibody derived from a camelid or cartilaginous fish. Compared with the above-mentioned 4-chain antibody, the heavy chain antibody lacks the light chain and the heavy chain constant region 1 (CH1), and only contains 2 heavy chains composed of a variable region (VHH) and other constant regions, and the variable region is connected to the constant region by a hinge region structure. Each heavy chain of the camelid heavy chain antibody contains 1 variable region (VHH) and 2 constant regions (CH2 and CH3), and each heavy chain of the cartilaginous fish heavy chain antibody contains 1 variable region and 5 constant regions (CH1-CH5). The antigen-binding fragment of the heavy chain antibody includes VHH and a single-chain heavy chain antibody. By fusing with the constant region of human IgG Fc, the heavy chain antibody can have CH2 and CH3 of human IgG Fc.

[0078] As used herein, the terms "single domain antibody", "anti-mesothelin single domain antibody", "heavy chain variable region domain of heavy chain antibody", "VHH", and "nanobody" are used interchangeably and refer to single domain antibodies that specifically recognize and bind to mesothelin. A single domain antibody is a variable region of a heavy chain antibody. Typically, a single domain antibody contains three CDRs and four FRs. Preferably, the single domain antibody of the present invention has CDR1 shown in SEQ ID NO: 1, CDR2 shown in SEQ ID NO: 2, and CDR3 shown in SEQ ID NO: 3. A single domain antibody is the smallest functional antigen-binding fragment. Usually, an antibody naturally lacking the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody consisting of only one heavy chain variable region.

[0079] A binding molecule comprising two or more single domain antibodies is a multivalent single domain antibody; a binding molecule comprising two or more single domain antibodies of different specificities is a multispecific single domain antibody. A multivalent single domain antibody or a multispecific single domain antibody connects multiple single domain antibodies via a linker. The linker is generally composed of 1-15 amino acids selected from G and S.

[0080] In this article, heavy chain antibodies and antibodies are intended to distinguish different combinations of antibodies. Due to the similarity of their structures, the following description of antibodies is also applicable to heavy chain antibodies in addition to light chains.

[0081] The "variable region" or "variable domain" of an antibody refers to the amino terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL", respectively. These domains are usually the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen binding site.

[0082] The term "variable" refers to the situation that certain segments in the variable domain vary widely in the antibody sequence. The variable domain mediates antigen binding and defines the specificity of a particular antibody to its specific antigen. However, the variability is not evenly distributed over all the amino acids spanned by the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVRs) (in both the light chain and heavy chain variable domains), namely, HCDR1, HCDR2, HCDR3 (heavy chain antibodies can be referred to as CDR1, CDR2, CDR3) of the heavy chain variable region and LCDR1, LCDR2 and LCDR3 of the light chain variable region. The more highly conserved parts of the variable domain are called framework regions (FRs). The variable domains of natural heavy and light chains each contain four FR regions (FR1, FR2, FR3 and FR4), most of which adopt a β-folded conformation, connected by three HVRs that form a loop connection and in some cases form a part of the β-folded structure. The HVR in each chain is held together in close proximity by the FR region and contributes to the formation of the antigen binding site of the antibody together with the HVR of the other chain. Typically, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domain is not directly involved in the binding of the antibody to the antigen, but exhibits a variety of effector functions, such as the participation of the antibody in antibody-dependent cell-mediated cytotoxicity.

[0083] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates the binding of an immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or binding to the first component (C1q) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments from the CH2 domain and the CH3 domain of the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is generally defined as a sequence segment from an amino acid residue at position C226 or P230 of the heavy chain to the carboxyl terminus, wherein the numbering is according to the EU index, as in Kabat. As used herein, the Fc region may be a native sequence Fc or a variant Fc.

[0084] The sequence of the constant region in the heavy chain antibody is within the scope of the general knowledge of those skilled in the art. Similar to traditional antibodies, the function of the constant region in the heavy chain antibody is to stabilize the structure and function of the antibody, bind to Fc receptors, etc., and its sequence and structure are relatively conservative. By fusing with the constant region of human IgG Fc, the heavy chain antibody can have CH2 and CH3 of human IgG Fc.

[0085] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding and / or variable regions of an intact antibody. Antibody fragments are preferably antigen binding fragments of antibodies. Examples of antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragments that should be able to increase half-life by chemical modification or by incorporation into liposomes. Digestion of antibodies with papain produces two identical antigen binding fragments called "Fab" fragments, and a residual "Fc" fragment, the name of which reflects its ability to crystallize easily. Fab fragments consist of an intact light chain and heavy chain variable domain (VH) and one heavy chain first constant domain (CH1). Each Fab fragment is monovalent in terms of antigen binding, i.e., it has a single antigen binding site. Pepsin treatment of antibodies produces a larger F(ab')2 fragment, which is roughly equivalent to two Fab fragments linked by disulfide bonds, with different antigen binding activities and still able to cross-link antigen. Fab' fragments differ from Fab fragments by the addition of some additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. F(ab')2 antibody fragments were originally generated as pairs of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known. The Fc fragment contains the carboxyl terminal portions of the two heavy chains held together by disulfide bonds. The effector functions of antibodies are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcR) found on certain types of cells.

[0086] As described above, the antigen-binding fragment of the heavy chain antibody includes a fragment containing VHH, such as VHH and a single-chain heavy chain antibody. It is known in the art that the relationship between VHH and heavy chain antibodies corresponds to the relationship between scFV and antibodies. As described in Nanobody—A versatile tool for cancer diagnosis and therapeutics. WIREs Nanomedicine and Nanobiotechnology, doi: 10.1002 / wnan.1697 by Manman Liu. The antigen-binding ability of the heavy chain antibody is determined by VHH, and more specifically by the three CDRs on VHH. Therefore, a heavy chain antibody or an antigen-binding fragment thereof containing the same CDR group can bind to the antigen with a similar or identical affinity to VHH.

[0087] "Fv" is the smallest antibody fragment that contains a complete antigen recognition and binding site. The fragment consists of a dimer of a heavy chain variable domain and a light chain variable domain in tight, non-covalent association. Six hypervariable loops (3 loops each in the heavy chain and light chain) protrude from the folding of these two domains, contributing the amino acid residues for antigen binding and giving the antibody antigen binding specificity. However, even a single variable domain (or half an Fv containing only three HVRs specific for an antigen) has the ability to recognize and bind to an antigen, although the affinity is lower than that of a complete binding site. "Single-chain Fv", also abbreviated as "sFv" or "scFv", is an antibody fragment comprising the antibody VH and VL domains connected into one polypeptide chain. Preferably, the sFv polypeptide also contains a polypeptide linker between the VH and VL domains so that the sFv forms a desired antigen binding structure.

[0088] Herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, that is, except for possible natural mutations and / or post-translational modifications (e.g., isomerization, amidation) that may exist in small amounts, the individual antibodies constituting the group are identical. Monoclonal antibodies are highly specific and are directed to a single antigenic site. Compared with polyclonal antibody preparations (which typically include different antibodies directed to different determinants (epitopes)), each monoclonal antibody is directed to a single determinant on the antigen. In addition to their specificity, the advantage of monoclonal antibodies is that they are synthesized by hybridoma culture without being contaminated by other immunoglobulins. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody group and should not be interpreted as requiring the production of antibodies by any ad hoc method. For example, the monoclonal antibody used according to the present invention can be generated by a variety of techniques, including, for example, hybridoma method, phage display method, recombinant DNA method, and technology, single cell sequencing method for generating human or human-like antibodies from animals with part or all of the human immunoglobulin locus or genes encoding human immunoglobulin sequences.

[0089] Monoclonal antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0090] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that contains at least a sequence derived from a non-human immunoglobulin. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with a sequence found in a human antibody. Typically in a humanized antibody, the entire antibody (except for the CDR) is encoded by a polynucleotide of human origin or is identical to such an antibody (except for the CDR). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-folded skeleton of the variable region of a human antibody to produce an antibody, the specificity of which is determined by the transplanted CDR. The production methods of such antibodies are well known in the art, for example, using mice with a genetically engineered immune system. In the present invention, antibodies, single domain antibodies, heavy chain antibodies, etc. all include humanized variants of each of the antibodies.

[0091] "Human antibody" refers to an antibody having an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human and / or produced using any of the techniques disclosed herein for producing human antibodies. This definition of human antibody explicitly excludes humanized antibodies comprising non-human antigen-binding residues. Human antibodies can be produced using a variety of techniques known in the art, including phage display libraries.

[0092] In some embodiments, the present invention also provides a single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof that binds to the same epitope of mesothelin as any anti-mesothelin single domain antibody of the present invention, i.e., a single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof that can cross-compete with any single domain antibody of the present invention for binding to mesothelin.

[0093] In the present invention, the CDR1 of the single domain antibody comprises the sequence shown in SEQ ID NO: 1. In one or more embodiments, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8X9X 10 X 11, wherein X1 is G, A, D, E, F, N, R, T or V, X2 is D, F, G, I, L, M, N, P, R, S, T or V, X3 is A, D, F, I, L, M, N, P, R, S or T, X4 is A, D, E, F, G, H, I, L, P, R, S, T or V, X5 is A, D, E, G, K, N, Q, R, S, T, V, W or Y, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, Y or none, X7 is A, D, F, H, K, L, N, P, R, S, T, W, Y or none, X8 is A, D, F, G, H, I, L, N, P, Q, S, T, V, Y or none, X9 is E, V, Y or none, X 10 Y, F or None, X 11 A or None.

[0094] In one or more embodiments, SEQ ID NO: 1 is XXXXXXXXX, wherein X1 is G, A, D, E, R, T, or V, X2 is D, F, G, I, L, M, N, P, R, S, T, or V, X3 is A, D, F, I, L, M, N, P, R, S, or T, X4 is A, D, E, F, G, H, I, L, S, T, or V, X5 is A, D, E, G, K, N, R, S, T, or V, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, or Y, X7 is A, D, F, H, K, L, N, R, S, T, W, or Y, and X8 is A, D, F, G, H, I, L, N, P, Q, S, T, V, or Y.

[0095] In one or more embodiments, SEQ ID NO: 1 is GXXXXXX, wherein X2 is D, F, G, I, L, R, S, T, or V, X3 is A, D, F, I, L, P, R, S, or T, X4 is A, D, E, F, H, I, L, S, T, or V, X5 is A, D, E, G, K, N, R, S, or T, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, or Y, X7 is A, D, F, H, K, L, N, R, S, T, W, or Y, and X8 is A, D, G, H, I, L, N, P, Q, S, T, V, or Y.

[0096] In one or more embodiments, CDR1 comprises the sequence shown in any one of SEQ ID NOs: 4-81.

[0097] In the present invention, the CDR2 of the single domain antibody comprises the sequence shown in SEQ ID NO: 2. In one or more embodiments, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11X 12 X 13 X 14 X 15 X 16 X 17 , wherein X1 is A, F, H, I, K, L, M, R, S or V, X2 is A, D, F, G, I, K, L, M, N, P, R, S, T, V, W or Y, X3 is A, D, E, G, H, I, K, L, M, N, P, R, S, T, V, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K, N, S or T, X6 is A, D, E, F, G, H, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, X8 is A, G, I, K, N, P, Q, R, T or none, X9 is F, G, H, S, T or none, X 10 G, P, Y or none, X 11 A, S, V or None, X 12 D, T or None, X 13 T, S or None, X 14 V or None, X 15 N or None, X 16 S or None, X 17 T or None.

[0098] In one or more embodiments, SEQ ID NO:2 is XXXXXXXXXXXX, wherein X1 is A, F, H, I, K, L, M, R, S, or V, X2 is A, D, F, G, K, L, M, N, P, R, S, T, V, W, or Y, X3 is A, D, E, G, H, I, L, M, N, P, R, S, T, V, W, or Y, X4 is A, D, E, G, L, N, R, S, T, or V, X5 is D, E, G, H, K, N, or S, X6 is A, D, F, G, H, L, M, N, R, S, T, or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V, or none, and X8 is A, G, I, K, P, R, T, or none.

[0099] Preferably, SEQ ID NO:2 is IX2XXXXXXXXX, wherein X2 is A, D, G, K, L, N, P, R, S, T, V or Y, X3 is A, D, E, G, I, L, M, N, P, R, S, T, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K or S, X6 is A, D, F, G, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, and X8 is A, G, I, K, P, R, T or none.

[0100] In one or more embodiments, CDR2 comprises the sequence set forth in any one of SEQ ID NOs: 82-165.

[0101] In the present invention, the CDR3 of the single domain antibody comprises the sequence shown in SEQ ID NO: 3. In one or more embodiments, SEQ ID NO: 3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 , wherein X1 is A, E, H, K, N, Q, R, S, T, V or Y, X2 is A, E, F, G, I, K, L, Q, R, S, T or V, X3 is A, D, E, F, G, I, K, L, M, N, P, R, S, T, V or W, X4 is A, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y, and X5 is A, D, E, F, G, I, K, L, M, N, P, Q, R, S, T, V, W or Y, X6 is A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, Y or none, X7 is A, C, D, E, F, G, I, K, L, N, P, Q, R, S, T, V, W, Y or none, X8 is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or none, X9 is A, C, D, E, G, H, I, K, L, N, Q, R, S, T, V, W, Y or none, X 10 A, D, G, I, K, L, N, P, R, S, V, Y or None, X 11 A, C, D, E, F, H, I, P, Q, R, S, T, V, Y or None, X 12 A, C, D, E, G, K, L, R, S, T, V, Y or none, X13 D, F, G, H, I, K, M, N, P, R, S, T, Y or None, X 14 D, E, G, L, N, P, Q, S, V, Y or none, X 15 A, E, F, P, R, T, W, Y or none, X 16 A, R, S, Y or none, X 17 D, I, N, Y or None, X 18 G, N, S or None, X 19 G, N or None, X 20 S or None.

[0102] In one or more embodiments, CDR3 comprises the sequence shown in any one of SEQ ID NOs: 166-253.

[0103] In one or more embodiments, the CDR1 of the single domain antibody comprises a sequence as shown in any one of SEQ ID NOs: 4-81, CDR2 comprises a sequence as shown in any one of SEQ ID NOs: 82-165, and CDR3 comprises a sequence as shown in any one of SEQ ID NOs: 166-253.

[0104] In one or more embodiments, the single domain antibody comprises CDR1, CDR2 and CDR3 shown in any one of Group a1 to Group a111 of SEQ ID NO in Table 1:

[0105] Table 1

[0106]

[0107]

[0108]

[0109]

[0110] In Table 1, group a1 refers to a single domain antibody having a CDR1 sequence as shown in SEQ ID NO: 4, a CDR2 sequence as shown in SEQ ID NO: 82, and a CDR3 sequence as shown in SEQ ID NO: 166. The specific sequence of the corresponding single domain antibody is shown in SEQ ID NO: 254.

[0111] In one or more embodiments, FR1 of the single-domain antibody VHH can be selected from FR1 of the VHH of each antibody number in Table 1, FR2 of VHH can be selected from FR2 of the VHH of each antibody number in Table 1, FR3 of VHH can be selected from FR3 of the VHH of each antibody number in Table 1, and FR4 of VHH can be selected from FR4 of the VHH of each antibody number in Table 1.

[0112] In a preferred embodiment, the FR region of the single-domain antibody VHH of the present invention is a FR region of any VHH selected from SEQ ID NO: 254-364. Further preferably, the CDR of such an antibody is selected from any of the aforementioned groups a1 to a117. In one or more embodiments, the single-domain antibody VHH is as shown in any of SEQ ID NO: 254-364.

[0113] The mesothelin binding molecule described herein can be a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen binding fragment thereof, an antibody or an antigen binding fragment thereof comprising one, two or more anti-mesothelin single domain antibodies described herein. The heavy chain antibody further comprises a heavy chain constant region, such as a constant region of a camel heavy chain antibody, a human antibody and a rabbit antibody. Preferably, the heavy chain constant region is as shown in SEQ ID NO: 365 or 366.

[0114] The present invention also includes the antibody derivatives and analogs. "Derivatives" and "analogs" refer to polypeptides that substantially maintain the same biological function or activity as the antibodies of the present invention. The derivatives or analogs of the present invention may be (i) polypeptides having a substitution group in one or more amino acid residues, or (ii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iii) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). According to the teachings herein, these derivatives and analogs are within the scope known to those skilled in the art.

[0115] Without substantially affecting the activity of the antibody, a person skilled in the art may change one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more) amino acids in the sequence of the present invention to obtain variants of the antibody or its functional fragment sequence. These variants include (but are not limited to): one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acid deletions, insertions and / or substitutions, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. In the art, conservative substitutions with amino acids with similar or similar properties generally do not change the function of the protein. For example, amino acids with similar properties are substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. For another example, adding one or more amino acids to the C-terminus and / or N-terminus will generally not change the function of the protein. They are all considered to be included in the scope of protection of the present invention.

[0116] Variant forms of the antibodies described herein include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibodies of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antiserum against the antibodies of the present invention.

[0117] In some embodiments, the sequence of the variant of the present invention may have at least 95%, 96%, 97%, 98% or 99% identity to its source sequence. The sequence identity of the present invention can be measured using sequence analysis software. For example, the computer program BLAST, especially BLASTP or TBLASTN, using default parameters is used. The present invention also includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs have more than 90% (preferably more than 95%, and most preferably more than 98%) homology with the CDRs identified herein.

[0118] The antibodies of the present invention can be prepared by conventional methods in the art, such as hybridoma technology well known in the art. The heavy chain antibodies of the present invention can be prepared by conventional methods in the art, such as phage display technology well known in the art. Alternatively, the antibodies or heavy chain antibodies of the present invention can be expressed in other cell lines. Suitable mammalian host cells can be transformed with sequences encoding antibodies of the present invention. Transformation can be carried out by any known method, for example, including packaging the polynucleotide in a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, and direct microinjection of DNA into the nucleus. Mammalian cell lines that can be used as hosts for expression are well known in the art and include, but are not limited to, a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), etc. Particularly preferred cell lines are selected by determining which cell lines have high expression levels and produce antibodies with essential mesothelin binding properties.

[0119] Immunoconjugates

[0120] In the present application, the term "immunoconjugate" generally refers to a conjugate formed by conjugating (e.g., covalently linked via a linker molecule) other agents (e.g., chemotherapeutic agents, radioactive elements, cytostatic agents and cytotoxic agents) to a mesothelin-binding molecule, which can deliver the other agents to target cells (e.g., tumor cells) through the specific binding of the mesothelin-binding molecule to antigens on the target cells.

[0121] In certain embodiments, the mesothelin binding molecules described herein can be connected to another agent, such as a chemotherapeutic agent, a toxin, an immunotherapeutic agent, an imaging probe, a spectroscopic probe, etc. The connection can be through one or more covalent bonds, or non-covalent interactions, and can include chelation. A variety of linkers (the linkers can be known in the art) can be used to form immunoconjugates. In addition, immunoconjugates can be provided in the form of fusion proteins, which can be expressed by polynucleotides encoding immunoconjugates. The immunoconjugates can also include, for example, antibody-drug conjugates (ADCs). Suitable drugs can include cytotoxins, alkylating agents, DNA minor groove binding molecules, DNA intercalators, DNA cross-linking agents, histone deacetylase inhibitors, nuclear export inhibitors, proteasome inhibitors, inhibitors of topoisomerase I or II, heat shock protein inhibitors, tyrosine kinase inhibitors, antibiotics, and anti-mitotic agents. In ADCs, antibodies and therapeutic agents can be cross-linked by linkers that can be cut, such as peptide linkers, disulfide linkers, or hydrazone linkers.

[0122] The present invention also provides the use of the mesothelin binding molecules described herein in the preparation of immunoconjugates.

[0123] Nucleic Acids

[0124] The present invention also provides polynucleotides encoding the mesothelin binding molecules described herein. Provided herein are polynucleotides encoding the heavy chain variable region, the light chain variable region, the heavy chain, the light chain, and each CDR. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.

[0125] As will be appreciated by those skilled in the art, due to the degeneracy of the genetic code, a very large number of nucleic acids can be produced, all of which encode the mesothelin binding molecules of the present invention. Thus, once a specific amino acid sequence has been identified, one skilled in the art can produce any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not alter the amino acid sequence encoding the protein. Therefore, the present invention also relates to polynucleotides that hybridize with the above-mentioned polynucleotide sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refers to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0126] The full-length nucleotide sequence of the mesothelin binding molecule of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. A feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is short. Generally, a fragment with a very long sequence can be obtained by synthesizing multiple small fragments first and then connecting them. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein.

[0127] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the host cells after proliferation by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0128] Therefore, the present invention also relates to nucleic acid constructs, such as expression vectors and recombinant vectors, comprising the above-mentioned appropriate DNA sequences and appropriate promoters or control sequences. These vectors can be used to transform appropriate host cells to enable them to express proteins. The vectors usually contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. The sequences (collectively referred to as "flanking sequences" in certain embodiments) usually include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splice sites, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a multilinker region for inserting a nucleic acid encoding a mesothelin binding molecule to be expressed, and a selectable marker element.

[0129] Host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS7, 293 cells, etc.

[0130] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0131] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0132] The polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0133] Uses and pharmaceutical compositions

[0134] By constructing a nanobody library, the inventors discovered, expressed and purified 117 nanobodies that can bind to MSLN protein. Protein-level affinity testing verified the ability of these antibodies to bind to antigens and cells.

[0135] Therefore, all aspects of the mesothelin binding molecules described herein can be used to prepare drugs for preventing or treating various conditions and diseases described herein, especially diseases or conditions associated with cells expressing mesothelin. In some embodiments, the conditions and diseases are cancers, especially mesothelin-related cancers. Herein, mesothelin-related cancers include cancers in which mesothelin is expressed on the surface of tumor cells, preferably including but not limited to: mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, gastric cancer, etc.

[0136] The pharmaceutical compositions herein contain binding molecules as described herein, and pharmaceutically acceptable excipients, including but not limited to diluents, carriers, solubilizers, emulsifiers, preservatives and / or adjuvants. Excipients are preferably non-toxic to the recipient at the dose and concentration used. Such excipients include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, the pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are known in the prior art. The optimal pharmaceutical composition can be determined based on the expected route of administration, delivery method, and required dosage.

[0137] Pharmaceutical compositions for in vivo administration are usually provided in the form of sterile preparations. Sterilization is achieved by filtering through a sterile filtration membrane. When the composition is freeze-dried, this method can be used for sterilization before or after freeze-drying and rehydration. The pharmaceutical composition of the present invention can be selected for parenteral delivery. The composition for parenteral administration can be stored in a freeze-dried form or in a solution. For example, it is prepared by conventional methods with physiological saline or an aqueous solution containing glucose and other adjuvants. Parenteral compositions are usually placed in a container with a sterile access hole, such as an intravenous solution strip or a vial with a stopper that can be pierced by a hypodermic injection needle. Alternatively, the composition can be selected for inhalation or delivery through the digestive tract (such as oral). The preparation of the pharmaceutically acceptable composition is within the technology of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations containing antibodies in sustained or controlled release delivery formulations. Technologies for preparing a variety of other sustained or controlled delivery methods (such as liposome carriers, bioerodible microparticles or porous beads and accumulated injections) are also known to those skilled in the art.

[0138] Once the pharmaceutical composition is formulated, it is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal or in the form of a dehydrated or lyophilized powder. The formulation can be stored in a ready-to-use form or in a form of rehydration before administration (e.g., lyophilization). The present invention also provides a kit for producing a single-dose administration unit. The kit of the present invention can each contain a first container with a dried protein and a second container with an aqueous formulation. In certain embodiments of the present invention, a kit containing a single-chamber and multi-chamber prefilled syringe (e.g., a liquid syringe and a lyophilized syringe) is provided.

[0139] The present invention also provides a method for treating a patient (especially a patient's mesothelin-related disease) by administering a binding molecule or a pharmaceutical composition thereof as described in any embodiment of the present invention. As used herein, the terms "patient," "subject," "individual," and "object" are used interchangeably herein and include any organism, preferably an animal, more preferably a mammal (e.g., rats, mice, dogs, cats, rabbits, etc.), and most preferably a human. "Treatment" refers to the use of a treatment regimen described herein to a subject to achieve at least one positive therapeutic effect (e.g., a decrease in the number of cancer cells, a decrease in tumor volume, a decrease in the rate of cancer cell infiltration to peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth). A treatment regimen that effectively treats a patient may vary according to a variety of factors, such as the patient's disease state, age, weight, and the ability of the therapy to stimulate an anti-cancer response in the subject.

[0140] The therapeutically effective amount of the pharmaceutical composition containing the binding molecules of the present invention that will be adopted will depend on, for example, the degree of treatment and the target. It will be appreciated by those skilled in the art that the appropriate dosage level for the treatment of will depend in part on the size (body weight, body surface or organ size) and / or condition (age and general health status) of the delivered molecule, indication, route of administration and the patient and change. In certain embodiments, the clinician can titrate the dosage and change the route of administration to obtain the best therapeutic effect. For example, about 10 micrograms / kg body weight-about 50 milligrams / kg body weight every day.

[0141] The frequency of administration will depend on the pharmacokinetic parameters of the binding molecule in the formulation used. The clinician typically administers the composition until a dose is achieved to achieve the desired effect. The composition can therefore be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via an implant device or catheter.

[0142] The route of administration of the pharmaceutical composition is according to known methods, for example, orally, by injection via intravenous, intraperitoneal, intracerebral (intracerebroparenchymal), intracerebroventricular, intramuscular, intraocular, intraarterial, portal vein or intralesional routes; by sustained release systems or by implant devices.

[0143] The present invention also provides the use of the mesothelin binding molecules described herein in the preparation of immune effector cells. The immune effector cells express the mesothelin binding molecules or polypeptide molecules containing the mesothelin binding molecules. In one or more embodiments, the mesothelin binding molecules are located on the surface of the immune effector cells. In one or more embodiments, the polypeptide molecules are transmembrane molecules that transmit signals targeting mesothelin to the cell, such as CAR or TCR.

[0144] Diagnostics, Tests and Kits

[0145] The binding molecules of the present invention can be used in assays, such as binding assays, to detect and / or quantify mesothelin expressed in tissues or cells due to their high affinity for mesothelin. Binding molecules such as single domain antibodies can be used in studies to further study the role of mesothelin in disease. The method for detecting mesothelin is generally as follows: obtaining a cell and / or tissue sample; detecting the level of mesothelin in the sample.

[0146] The mesothelin binding molecules of the present invention can be used for diagnostic purposes to detect, diagnose or monitor diseases and / or conditions associated with mesothelin. The present invention provides for detecting the presence of mesothelin in a sample using classical immunohistological methods known to those skilled in the art. Detection of mesothelin can be performed in vivo or in vitro. Examples of methods suitable for detecting the presence of mesothelin include ELISA, FACS, RIA, etc.

[0147] For diagnostic applications, binding molecules such as single domain antibodies are typically labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinyl groups, or predetermined polypeptide epitopes recognized by secondary reporters (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents. Various methods for labeling proteins are known in the art and can be used to perform the present invention.

[0148] Another aspect of the invention provides a method for detecting the presence of a test molecule that competes with a mesothelin binding molecule of the invention, such as a single domain antibody, for binding to mesothelin. One example of such an assay would involve detecting the amount of free antibody in a solution containing a certain amount of mesothelin in the presence or absence of the test molecule. An increase in the amount of free mesothelin binding molecule (i.e., a single domain antibody that is not bound to mesothelin) would indicate that the test molecule is able to compete with the antibody for binding to mesothelin. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0149] The present invention also provides a detection kit for detecting mesothelin levels, which includes a mesothelin binding molecule, a lysis medium for dissolving a sample, and common reagents and buffers required for detection, such as various buffers, detection markers, detection substrates, etc. The detection kit can be an in vitro diagnostic device.

[0150] The present invention will be described below in the form of specific examples. It should be understood that these examples are merely illustrative and are not intended to limit the scope of the present invention. The methods and materials used in the examples are, unless otherwise stated, conventional materials and methods in the art.

[0151] Example

[0152] Example 1, Alpaca Immunization

[0153] 1.1 Preparation of immunogens:

[0154] According to the mesothelin protein sequence queried on NCBI, it was fused with the human IgG Fc fragment sequence and commissioned Nanjing GenScript to synthesize and construct the eukaryotic expression vector of pCDNA3.4 (Thermo) plasmid. The synthesized plasmid was cloned into the eukaryotic expression vector of ExpiCHO TMThe protein was expressed using the Thermo Fisher expression system and then subjected to one-step affinity purification using a 5 mL Protein A prepacked column (GE). The purified sample was replaced with PBS buffer and its purity was identified by SDS-PAGE electrophoresis gel and HPLC. Its activity was identified by ELISA and then aliquoted and stored in a -80°C refrigerator for subsequent immunization.

[0155] 1.2 Alpaca Immunity:

[0156] The first immunization antigen (MSLN.hFc) was 400 μg, mixed with adjuvant (GERBU FAMA), and injected subcutaneously at four points on the back of the alpaca, with an immunization volume of 1 mL. The second to sixth immunizations: The immunization antigen was 200 μg, injected subcutaneously at four points on the back of the alpaca, with an immunization volume of 1 mL. The interval between each immunization was one week.

[0157] 1.3 Immune serum titer detection:

[0158] 1.3.1 Protein level titer detection

[0159] The MSLN.His antigen was coated overnight at 4°C, blocked and washed, and the gradient diluted serum was added to the ELISA plate for incubation, and then incubated with anti-llama IgG HRP (Abcam) antibody, washed, and TMB colorimetric solution was added for color development, and the reaction was terminated with 2M HCl, and then the absorbance at OD450 nanometers was detected with an enzyme reader. After 6 immunizations, the alpaca titer reached a high level (>243,000).

[0160] 1.3.2 Cell-level titer detection

[0161] HEK293T cells transfected with MSLN were plated in 96-well plates at a cell volume of 3 × 10 5 cells / well. Then the cells were incubated with serum diluted 3 times. After incubation and washing, anti-llama IgG PE (Jackson) antibody was added for incubation, and the cells were resuspended in PBS after washing, and then the fluorescence intensity (MFI) was detected by flow cytometry (Beckman).

[0162] Example 2: Construction and screening of nanoantibody immune library targeting MSLN

[0163] (1) After the 6 immunizations, 100 mL of peripheral blood lymphocytes were extracted from camels and total RNA was extracted. RNA extraction was performed according to the instructions of RNAiso reagent of TAKARA.

[0164] (2) Using RNA as template and oligo dT as primer, synthesize the first strand of cDNA according to the instruction manual of TAKARA reverse transcriptase.

[0165] (3) Using PrimeSTAR high-fidelity DNA polymerase, nested PCR was used to obtain the variable region encoding gene of the heavy chain antibody. Nested PCR was used to amplify the variable region fragment of the heavy chain antibody:

[0166] First round of PCR:

[0167] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID NO: 367)

[0168] Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 368)

[0169] The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55°C for 30 cycles; a DNA fragment of about 600 bp was recovered and used as a template for the second round of PCR.

[0170] Second round of PCR:

[0171] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO: 369)

[0172] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID NO: 370)

[0173] The fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long fragments and short fragments) were amplified, annealed at 55°C for 30 cycles, and the target fragments were recovered.

[0174] (4) The phagemid pME207 and the PCR amplification product were double-digested with Sfi I and Not I (NEB), respectively. After recovery and quantification, the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 at 16°C overnight.

[0175] (5) After ethanol precipitation, the ligation product was dissolved in 100 μL sterile water and electroporated to transform E. coli TG1 ten times. Take 100 μL of the bacterial solution after electroporation and culture, dilute it in multiple proportions, spread it on the ampicillin LB culture plate, calculate the reservoir capacity, and spread the rest on the ampicillin 2×YT culture plate, invert and culture at 37°C for 13 to 16 hours. Use 10 mL of 2×YT culture medium to scrape the bacterial moss on the culture plate, add glycerol at a final concentration of 25%, divide it into aliquots, and store it at -80°C for later use. The reservoir capacity is 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0176] (6) Based on the calculated reservoir capacity, 10 times the reservoir capacity of live cells was inoculated into 200 mL of 2×YT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C, 200 r / min until OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1. The culture was allowed to stand at 37°C for 30 min and then incubated at 37°C, 200 r / min for 30 min. The culture was centrifuged and the precipitate was resuspended in 200 mL of 2×YT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin). After culturing at 37°C, 250 r / min overnight, the supernatant was centrifuged at 8000 rpm, 5×PEG / NaCl solution was added, the solution was placed on ice for 60 min, and the solution was centrifuged at 8000 rpm for 30 min. The precipitate was resuspended in 5 mL of PBS to obtain an anti-MSLN single domain heavy chain antibody (VHH) immune library. 10 μL was taken for titer determination and the rest was aliquoted and stored at -80°C for later use.

[0177] (7) Use the full-length mesothelin antigen at 10 μg / mL, 100 μL per well is coated on the ELISA plate, and placed at 4°C overnight. At the same time, set up a negative control. The next day, add 200 μL of 3% BSA to each of the five wells and block at room temperature for 2 hours. After 2 hours, wash three times with PBST (PBS containing 0.05% Tween 20). After washing the plate, add 200 μL of phage (2-3×10 600 μL) pre-blocked with 5% skim milk to each negative sieve hole. 11 pfu immune camel nanoantibody phage display gene library), act at room temperature for 1.5 hours, then transfer the supernatant after negative screening to the target antigen coated well and act at room temperature for 1.5 hours. Wash 12 times with PBST (PBS contains 0.05% Tween 20) to wash away the unbound phage. Use Glycine (SIGMA) to dissociate the phage that specifically binds to MSLN, and the eluted phage is neutralized with Tris (Invitrogen, 1M, PH 8.0) and then infects TG1 in the logarithmic phase. After reproduction and amplification, the next round of "adsorption-elution" is carried out. Finally, the eluted phage is infecting TG1, IPTG (Thermo) is used to induce TG1 to express nanoantibodies, and the ELISA plate is coated with MSLN protein. The supernatant is taken for ELISA detection, and the clones with OD450>0.5 are selected for sequencing.

[0178] Example 3, Expression and purification of candidate antibodies

[0179] The nanobody was constructed on the pCDNA3.4-IgG4 vector and then expressed by the ExpiCHOTM (Thermo Fisher) expression system. After one week of expression, the supernatant was collected for Protein A (GE) purification. The protein concentration was then detected by Nanodrop and the protein purity was detected by HPLC. The purity and yield of the obtained protein met the needs of subsequent experiments.

[0180] Example 4, Characterization of Candidate Antibodies

[0181] Protein level ELISA test:

[0182] The affinity of the antibody for human MSLN antigen was determined using enzyme-linked immunosorbent assay (ELISA). The MSLN antigen was diluted to 2 μg / mL with coating solution, and 100 μL / well was added to a 96-well plate strip and incubated at 37°C for 2 hours. Wash 3 times. After washing, 200 μL of 3% BSA blocking solution was added to each well and incubated at 37°C for 2 hours. Wash 3 times. Add 100 μL / well MSLN antibody, which was obtained by chimerizing MSLN single domain antibody with human IgG1 Fc or rabbit IgG Fc. The initial concentration of antibody dilution was 4 μg / mL, and 8 gradients were diluted 4-fold. Incubate at 37°C for 1 hour. Wash each plate 3 times. Add 100 μL of enzyme-labeled secondary antibody to each well and incubate for 30 minutes. Wash 3 times. Add 100 μL of TMB to each well and color for 5 minutes. Add 100 μL of hydrochloric acid stop solution to each well to terminate the reaction, and read the plate at a wavelength of 450 nm.

[0183] Among them, some VHH chimeras were human IgG1 Fc (IgG1 for short), and the ELISA curve results of different concentrations showed as follows Figure 1-6 As shown; some VHH chimeric rabbit IgG Fc (rFc for short), the ELISA numerical results at a concentration of 100nM are shown in Table 2. Among them, the negative control Isotype (1194) is a PD-1 nanobody, and the sequence is shown in SEQ ID NO: 200 of CN114685655A. It can be seen that the antibodies in the figure and Table 2 have affinity for human MSLN antigen, and some antibodies such as LT-1128-IgG1, NBL501#128-rFc, etc. have a higher affinity for human MSLN antigen.

[0184] Table 2

[0185]

[0186]

[0187] Example 5, Immunohistochemical staining of tonsil tissue

[0188] Tonsillar tissue was selected for frozen sections, dried at room temperature, and fixed with acetone. Use reagent A and reagent B of the endogenous biotin blocking kit (Sangong, E674001) for blocking. Incubate the biotin-labeled antibody sample for 30 minutes, wash, and add horseradish peroxidase-labeled goat anti-mouse / rabbit secondary antibody (30-50μL / slice, Leica DS9800) and incubate for 30 minutes. Use DAB for color development and hematoxylin for counterstaining, seal with neutral plastic, and air dry naturally for microscopic examination. The results of immunohistochemical staining are shown in the following table:

[0189]

[0190]

[0191] Example 6: Specific detection of chimeric antibodies on 34 human tissues

[0192] Select some chimeric antibodies, NBL501#128-rFc, NBL501#289-rFc, NBL501#300-rFc, NBL501#301-rFc, NBL501-A030L2P1-R2-D23-2C-47-rFc, NBL501-A030L2P1-R2-D23-2D-48-rFc, NBL501-A030L2P1-R2-D23-3B-51-rFc, NBL501-A030L2P1-R2-D23-5D-67-rFc and NBL501-A2B1-S11-C82-rFc; perform antibody specificity detection on 34 human tissues, and the detection step is the experimental steps of Example 5.

[0193] The results are shown in the following table. The results of the 9 chimeric antibodies are similar, with typical cell membrane staining positive reactions on tonsil epithelial cells and thoracoperitoneal mesothelial cells, but no positive reactions with other tissue cells, which reflects that the chimeric antibodies have good tissue specificity.

[0194]

[0195] Example 7: Binding of Antibodies to MSLN on the Surface of H226 Cells

[0196] 1. Take 5×10 6 Centrifuge H226 cells at 300 × g for 5 minutes. Add 0.75 mL of permeabilization buffer (Thermo, 89842) to the cell pellet. Vortex briefly to obtain a homogenous cell suspension. Incubate at 4°C for 10 minutes with constant mixing. Centrifuge the permeabilized cells at 16,000 × g for 15 minutes. Carefully remove the supernatant containing cytoplasmic proteins and transfer to a new tube.

[0197] 2. Add 0.5 mL of solubilization buffer (Thermo, 89842) to the pellet and resuspend by pipetting up and down. Incubate at 4°C for 30 minutes with constant mixing. Centrifuge the tube at 16,000 × g for 15 minutes at 4°C. Transfer the supernatant containing soluble membrane proteins and membrane-associated proteins to a new tube.

[0198] 3. Take 35 μg of protein sample in a 1.5 mL EP tube, add SDS-Loading Buffer (Biyuntian, P0015) at a ratio of 1:4 to denature it, vortex the sample to mix well, and then treat it at 95-100℃ for 5 minutes.

[0199] 4. Assemble the electrophoresis tank and protein precast gel in order, pour the electrophoresis liquid to fill the inner tank and the liquid level in the outer tank to half of the total height, unplug the comb on the precast gel, and add the marker and sample to the loading hole of the precast gel in order.

[0200] 5. Turn on the power supply and perform electrophoresis at 150V for 30-60 minutes until bromophenol blue runs out of the gel, then terminate the electrophoresis.

[0201] 6. Remove the precast gel, wash it in purified water, remove the electrophoresis solution on the gel, and then cut the gel into appropriate size, leaving the lane with the sample for further detection.

[0202] 7. Cut the PVDF membrane (Biyuntian, FFP32) and thick filter paper to be slightly larger than the gel. Hold the PVDF membrane with tweezers and transfer it to methanol (Shanghai Test 100141190) for 15 seconds to fully activate the membrane until it is translucent. Then transfer it to deionized water and soak it for 2 minutes. Wash off the methanol on the membrane, and then soak the membrane in transfer buffer for 2 minutes to ensure that the membrane is immersed in the buffer.

[0203] 8. Soak the thick filter paper in transfer buffer (GenScript, M00680-500) for 2 minutes, and then stack them on the anode plate of the semi-dry transfer apparatus in the order of filter paper-membrane-protein gel-filter paper. Be careful not to leave bubbles between the PVDF membrane and the gel. Use a clean plastic test tube in between to push out the bubbles, and buckle the cathode plate of the transfer apparatus on the top.

[0204] 9. Assemble the transfer chamber into the transfer instrument, turn on the power, and transfer the membrane for 10-30 minutes under the conditions of 25V and 1.3A. The transfer time depends on many factors such as protein molecular weight, charge, gel size, etc.

[0205] 10. After the transfer is completed, turn off the power, use tweezers to remove the membrane, cut off a corner of the membrane to mark the direction of the membrane, place the membrane in TBST, and wash it in an oscillating incubator for 5 minutes to wash away the transfer buffer remaining on the membrane.

[0206] 11. Transfer the membrane to the prepared blocking solution so that the membrane is immersed, incubate on a shaker for 1-2 hours or at 4°C overnight, and discard the blocking solution.

[0207] 12. The membrane was incubated with primary antibodies (10 μg / mL, NBL501-#128-rFc, NBL501-#289-rFc, NBL501-#300-rFc, NBL501-#301-rFc, NBL501-A030L2P1-R2-D23-2C-47-rFc, H226+NBL501-A030L2P1-R2-D23-2D-48-rFc, NBL501-A030L2P1-R2-D23-3B-51-rFc, NBL501-A030L2P1 -R2-D23-5D-67-rFc, NBL501-A2B1-S11-C82-rFc, NBL501-1070-rFc, NBL501-1092-rFc, NBL501-1119-rFc, NBL501-1479-rFc, NBL501#009-rFc, NBL501-2308-rFc, NBL501-1339-rFc, NBL501-3721-rFc; positive control Mesothelin (D9R5G) XP (R) Rabbit mAb (1:1K); negative control anti-V5-rFc. ) were incubated on a shaker for 1-2 h, and then washed 2-6 times with TBST (PBS containing 0.05% Tween 20), each time for 5-10 min.

[0208] 13. Incubate the membrane with secondary antibody Goat Anti Rabbit (IgG) secondary antibody HRP (Abcam, ab97051) on an oscillator for 1 hour, and wash the membrane 2-6 times with TBST, each time for 5-10 minutes.

[0209] 14. Take out the chemiluminescent detection reagent from the 4°C refrigerator 20 minutes in advance and return it to room temperature. Take 1 mL of Clarity Western Peroxide Reagent and 1 mL of Clarity Western Luminol / Enhancer Reagent (Bio-Rad, 1705061) respectively, mix them evenly, cover them evenly on the membrane, let it stand at room temperature for 2 minutes, discard the working solution, absorb the excess liquid with absorbent paper, and then place it in the chemiluminescent detection system iBright CL1000 for imaging detection.

[0210] The experimental results are as follows Figure 7-8 shown. Figure 7In the figure, the lanes are: M: Marker (KDa); 1: H226 + NBL501-#128-rFc; 2: H226 + NBL501-#289-rFc; 3: H226 + NBL501-#300-rFc; 4: H226 + NBL501-#301-rFc; 5: H226 + NBL501-A030L2P1-R2-D23-2C-47-rFc; Lane 6: H226 + NBL501-A03 0L2P1-R2-D23-2D-48-rFc; 7:H226+NBL501-A030L2P1-R2-D23-3B-51-rFc; 8:H226+NBL501-A030L2P1-R 2-D23-5D-67-rFc; 9: H226+NBL501-A2B1-S11-C82-rFc; 10: H226+Mesothelin(D9R5G)XP(R)RabbitmAb.

[0211] Figure 8 In the figure, the lanes are: M: Marker (KDa); 1: H226 + NBL501-1070-rFc; 2: H226 + NBL501-1070-rFc; 3: H226 + NBL501-1119-rFc; 4: H226 + NBL501-1479-rFc; 5: H226 + NBL501-#009-rFc; 6: H226 + NBL501-2308-rFc; 7: H226 + NBL501-1339-rFc; 8: H226 + NBL501-3721-rFc; 9: H226 + anti-V5-rFc; 10: H226 + Mesothelin (D9R5G) XP (R) Rabbit mAb.

[0212] The results showed that the above antibodies had good binding activity with MSLN on the surface of H226 cells.

Claims

1. A mesothelin binding molecule, comprising an anti-mesothelin single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3, wherein CDR1 comprises the sequence shown in SEQ ID NO: 1, CDR2 comprises the sequence shown in SEQ ID NO: 2, and CDR3 comprises the sequence shown in SEQ ID NO: 3, wherein, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8X9X 10 X 11 , wherein X1 is G, A, D, E, F, N, R, T or V, X2 is D, F, G, I, L, M, N, P, R, S, T or V, X3 is A, D, F, I, L, M, N, P, R, S or T, X4 is A, D, E, F, G, H, I, L, P, R, S, T or V, X5 is A, D, E, G, K, N, Q, R, S, T, V, W or Y, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W, Y or none, X7 is A, D, F, H, K, L, N, P, R, S, T, W, Y or none, X8 is A, D, F, G, H, I, L, N, P, Q, S, T, V, Y or none, X9 is E, V, Y or none, X 10 Y, F or None, X 11 is A or None, SEQ ID NO: 2 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 , wherein X1 is A, F, H, I, K, L, M, R, S or V, X2 is A, D, F, G, I, K, L, M, N, P, R, S, T, V, W or Y, X3 is A, D, E, G, H, I, K, L, M, N, P, R, S, T, V, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K, N, S or T, X6 is A, D, E, F, G, H, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, X8 is A, G, I, K, N, P, Q, R, T or none, X9 is F, G, H, S, T or none, X 10 G, P, Y or none, X 11 A, S, V or None, X 12 D, T or None, X 13 T, S or None, X 14 V or None, X 15 N or None, X 16 S or None, X 17 is T or None, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 , wherein X1 is A, E, H, K, N, Q, R, S, T, V or Y, X2 is A, E, F, G, I, K, L, Q, R, S, T or V, X3 is A, D, E, F, G, I, K, L, M, N, P, R, S, T, V or W, X4 is A, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y, and X5 is A, D, E, F, G, I, K, L, M, N, P, Q, R, S, T, V, W or Y, X6 is A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, Y or none, X7 is A, C, D, E, F, G, I, K, L, N, P, Q, R, S, T, V, W, Y or none, X8 is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or none, X9 is A, C, D, E, G, H, I, K, L, N, Q, R, S, T, V, W, Y or none, X 10 A, D, G, I, K, L, N, P, R, S, V, Y or None, X 11 A, C, D, E, F, H, I, P, Q, R, S, T, V, Y or None, X 12 A, C, D, E, G, K, L, R, S, T, V, Y or none, X 13 D, F, G, H, I, K, M, N, P, R, S, T, Y or None, X 14 D, E, G, L, N, P, Q, S, V, Y or none, X 15 A, E, F, P, R, T, W, Y or none, X 16 A, R, S, Y or none, X 17 D, I, N, Y or None, X 18 G, N, S or None, X 19 G, N or None, X 20 S or None.

2. The mesothelin-binding molecule according to claim 1, wherein SEQ ID NO: 1 is X1X2X3X4X5X6X7X8, wherein X1 is G, A, D, E, R, T or V, X2 is D, F, G, I, L, M, N, P, R, S, T or V, X3 is A, D, F, I, L, M, N, P, R, S or T, X4 is A, D, E, F, G, H, I, L, S, T or V, X5 is A, D, E, G, K, N, R, S, T or V, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W or Y, X7 is A, D, F, H, K, L, N, R, S, T, W or Y, and X8 is A, D, F, G, H, I, L, N, P, Q, S, T, V or Y; preferably, SEQ ID NO: 1 is X1X2X3X4X5X6X7X8, wherein X1 is G, A, D, E, R, T or V, X2 is D, F, G, I, L, M, N, P, R, S, T or V, X3 is A, D, F, I, L, M, N, P, R, S or T, X4 is A, D, E, F, G, H, I, L, S, T or V, X5 is A, D, E, G, K, N, R, S, T or V NO:1 is GX2X3X4X5X6X7X8, wherein X2 is D, F, G, I, L, R, S, T or V, X3 is A, D, F, I, L, P, R, S or T, X4 is A, D, E, F, H, I, L, S, T or V, X5 is A, D, E, G, K, N, R, S or T, X6 is A, D, E, F, G, I, L, M, N, R, S, T, V, W or Y, X7 is A, D, F, H, K, L, N, R, S, T, W or Y, X8 is A, D, G, H, I, L, N, P, Q, S, T, V or Y, SEQ ID NO:2 is X1X2X3X4X5X6X7X8, wherein X1 is A, F, H, I, K, L, M, R, S or V, X2 is A, D, F, G, K, L, M, N, P, R, S, T, V, W or Y, X3 is A, D, E, G, H, I, L, M, N, P, R, S, T, V, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K, N or S, X6 is A, D, F, G, H, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, and X8 is A, G, I, K, P, R, T or none; preferably, SEQ ID NO:2 is X1X2X3X4X5X6X7X8, wherein X1 is A, F, H, I, K, L, M, R, S or V, X2 is A, D, F, G, K, L, M, N, P, R, S, T, V or none, and X8 is A, G, I, K, P, R, T or none; preferably, SEQ ID NO:2 is X1X2X3X4X5X6X7X8, wherein X1 is A, F, H, I, K, L, M, Q, R, S, T, V or none, and X8 is A, G, I, K, P, R, T or none. NO:2 is IX2X3X4X5X6X7X8, wherein X2 is A, D, G, K, L, N, P, R, S, T, V or Y, X3 is A, D, E, G, I, L, M, N, P, R, S, T, W or Y, X4 is A, D, E, G, L, N, R, S, T or V, X5 is D, E, G, H, K or S, X6 is A, D, F, G, L, M, N, R, S, T or V, X7 is A, D, E, F, G, I, K, L, M, Q, R, S, T, V or none, X8 is A, G, I, K, P, R, T or none, SEQ ID NO:3 is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 , wherein X1 is A, E, H, K, N, Q, R, S, T, V or Y, X2 is A, E, F, G, I, K, L, Q, R, S, T or V, X3 is A, D, E, F, G, I, K, L, M, N, P, R, S, T, V or W, X4 is A, D, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W or Y, and X5 is A, D, E, F, G, I, K, L, M, N, P, Q, R, S, T, V, W or Y, X6 is A, C, D, E, F, G, H, I, L, M, N, P, Q, R, S, T, V, W, Y or none, X7 is A, C, D, E, F, G, I, K, L, N, P, Q, R, S, T, V, W, Y or none, X8 is A, C, D, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, Y or none, X9 is A, C, D, E, G, H, I, K, L, N, Q, R, S, T, V, W, Y or none, X 10 A, D, G, I, K, L, N, P, R, S, V, Y or None, X 11 A, C, D, E, F, H, I, P, Q, R, S, T, V, Y or None, X 12 A, C, D, E, G, K, L, R, S, T, V, Y or none, X 13 D, F, G, H, I, K, M, N, P, R, S, T, Y or None, X 14 D, E, G, L, N, P, Q, S, V, Y or none, X 15 A, E, F, P, R, T, W, Y or none, X 16 A, R, S, Y or none, X 17 D, I, N, Y or None, X 18 G, N, S or None, X 19 G, N or None, X 20 S or None.

3. The mesothelin-binding molecule according to claim 1 or 2, characterized in that The CDR1 of the single-domain antibody comprises a sequence shown in any one of SEQ ID NOs: 4-81, the CDR2 comprises a sequence shown in any one of SEQ ID NOs: 82-165, and the CDR3 comprises a sequence shown in any one of SEQ ID NOs: 166-253, Preferably, the single-domain antibody contains CDR1, CDR2 and CDR3 shown in any one of Group a1 to Group a111 of the following SEQ ID NO:

4. The mesothelin-binding molecule according to claim 1 or 2, characterized in that The FR region of the single-domain antibody comprises the FR region of any VHH selected from SEQ ID NO: 254-364, and / or The single domain antibody VHH is shown in any one of SEQ ID NOs: 254-364, and / or The mesothelin binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen binding fragment thereof, an antibody or an antigen binding fragment thereof comprising one, two or more of the single domain antibodies.

5. The mesothelin-binding molecule according to claim 4, characterized in that The mesothelin binding molecule further comprises an Fc region, Preferably, the sequence of the Fc region is shown in SEQ ID NO: 365 or 366.

6. A polynucleotide, characterized in that The polynucleotide is selected from: (1) The coding sequence of the mesothelin-binding molecule according to any one of claims 1 to 5; (2) the complementary sequence of (1); (3) A 5-50 bp fragment of any of the sequences in (1) or (2).

7. A nucleic acid construct, characterized in that The nucleic acid construct comprises the polynucleotide according to claim 6, Preferably, the nucleic acid construct is a recombinant vector or an expression vector.

8. A host cell, characterized in that The host cell: (1) expressing the mesothelin-binding molecule of any one of claims 1 to 5; and / or (2) comprising the polynucleotide according to claim 6; and / or (3) comprising the nucleic acid construct according to claim 7.

9. A method for producing a mesothelin binding molecule, comprising: Cultivating the host cell of claim 8 under conditions suitable for producing the mesothelin binding molecule, and optionally purifying the mesothelin binding molecule from the culture.

10. A pharmaceutical composition comprising the mesothelin-binding molecule according to any one of claims 1 to 5, the polynucleotide according to claim 6, the nucleic acid construct according to claim 7 or the host cell according to claim 8, and a pharmaceutically acceptable excipient, Preferably, the pharmaceutical composition is used to treat cancer.

11. Use of the mesothelin-binding molecule according to any one of claims 1 to 5 in the preparation of a medicament for preventing or treating cancer.

12. A kit for detecting mesothelin, for evaluating drug treatment effects or diagnosing cancer, the kit comprising the mesothelin-binding molecule according to any one of claims 1 to 5, the polynucleotide according to claim 6, the nucleic acid construct according to claim 7, or the host cell according to claim 8, Preferably, the kit further comprises a reagent for detecting the binding of mesothelin to a single domain antibody, an antibody or an antigen-binding fragment thereof, More preferably, the reagent is a reagent for detecting the binding by enzyme-linked immunosorbent assay.

13. A non-diagnostic method for detecting the presence of mesothelin in a sample, the method comprising: The mesothelin binding molecule described in any one of claims 1 to 5 is incubated with a sample, and the binding of mesothelin to a single domain antibody, an antibody or an antigen binding fragment thereof is detected, thereby determining the presence of mesothelin in the sample.

14. Use of the mesothelin-binding molecule according to any one of claims 1 to 5 in the preparation of a kit for detecting mesothelin in a sample, evaluating the effect of drug treatment or diagnosing cancer.

Images