Recombinant microorganism for high-yield lysine and application of recombinant microorganism

Abstract

The invention relates to the technical field of gene engineering, in particular to a recombinant microorganism for high-yield lysine and application thereof. In the recombinant microorganism, the expression level of endogenous protein is reduced; the endogenous protein comprises any one or more of the amino acid sequences in SEQ ID NO.1 to SEQ ID NO.3. The invention also discloses a preparation method of the endogenous protein. Three endogenous proteins related to the amino acid production capacity of microorganisms are obtained through research, and the amino acid production capacity of the microorganisms can be improved by reducing the expression level of any one of the proteins. On the basis, the invention provides a recombinant microorganism capable of reducing at least one endogenous protein, and the capacity of producing amino acid is remarkably improved compared with that before editing, so that the recombinant microorganism has important significance in the field of improving the yield of amino acid.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a recombinant microorganism with high lysine production and application thereof. Background Art

[0002] Corynebacterium glutamicum is one of the main production bacteria used in the amino acid fermentation industry in the prior art. The bacteria can produce amino acids using glucose, fructose, sucrose and some organic acids such as acetic acid, lactic acid, succinic acid, etc. as a single carbon source. Under the microscope, the bacteria are short rods with blunt ends. They are Gram-positive bacteria, strictly aerobic, non-motile, and do not produce spores.

[0003] Lysine is an important amino acid product that is widely used in animal feed, medicine and food industries. Among them, it is mainly used in the animal feed industry. In addition, some are also used in the food and pharmaceutical industries. Using lysine in animal feed additives helps to improve the quality of feed because lysine can enhance the body's absorption capacity of other amino acids. This can improve the nutritional absorption effect of animals and promote their growth and healthy development.

[0004] From a biochemical perspective, lysine belongs to the aspartate family of amino acids. Corynebacterium glutamicum synthesizes lysine, starting from aspartate, and obtains lysine through multiple steps of enzyme-catalyzed reactions. The yield of lysine is related to the distribution of key genes and metabolic flows in the biosynthetic pathway. The expression level of related enzymes can be increased by strengthening the related genes of the lysine synthesis pathway. Or the expression level of related genes of central carbon metabolism can be optimized to redistribute the carbon flow ratio. Or the supply of reducing power cofactors can be strengthened to remove the related rate-limiting bottlenecks. In addition, there are also literature reports that improving the regulatory mechanism of cells by interfering with global regulation or stress response can also have a positive effect on amino acid synthesis. However, there have been no related reports so far that the inactivation of non-pathway-related genes has an effect on the synthesis of lysine. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a recombinant microorganism with high lysine production and application thereof.

[0006] The present invention has found in many years of research and practice that the inactivation of the site-specific DNA methyltransferase encoded by the NCgl0866 gene, the transposase encoded by the NCgl0864 gene or the protein encoded by the Cgl1893 gene (the protein is the protein with corresponding functions found for the first time by the present invention) can significantly improve the efficiency of lysine synthesis by Corynebacterium. Based on this, the present invention constructs the corresponding recombinant microorganism.

[0007] In a first aspect, the present invention provides a recombinant microorganism, in which the expression level of an endogenous protein is reduced;

[0008] The endogenous protein includes any one or more amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.3.

[0009] Furthermore, the endogenous protein is encoded by any one or more nucleotide sequences shown in SEQ ID NO.4-SEQ ID NO.6.

[0010] Furthermore, the decreased expression level includes:

[0011] The expression level of the endogenous protein is decreased by at least 30%, and / or the activity of the endogenous protein is decreased by at least 30%.

[0012] Furthermore, the gene encoding the endogenous protein is edited by one or more methods including RNA interference, gene knockout, gene mutation, replacement of promoter or inhibition of transcription or translation activity to reduce the expression level of the endogenous protein in the recombinant microorganism.

[0013] The gene knockout of the present invention may be the insertion, replacement or deletion of any number of nucleotide sequences in the endogenous protein encoding gene, or the direct knockout of the entire encoding gene.

[0014] Furthermore, the endogenous protein includes any one or more of the amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.3.

[0015] Furthermore, the starting strain of the recombinant microorganism is a microorganism capable of producing amino acids.

[0016] Furthermore, the starting strain of the recombinant microorganism is Corynebacterium glutamicum, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

[0017] In a second aspect, the present invention further provides the use of the recombinant microorganism in the production of aspartic acid family amino acids or their derivatives, preferably lysine.

[0018] In a third aspect, the present invention provides a method for improving the amino acid production capacity or sugar-acid conversion rate of a microorganism, comprising:

[0019] The expression level of endogenous protein in the microorganism to be edited is reduced; the endogenous protein includes any one or more amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.3.

[0020] Furthermore, the amino acid is an aspartic acid family amino acid, and the microorganism to be edited is a strain capable of producing aspartic acid family amino acids or their derivatives.

[0021] The Corynebacterium lysigenum CGMCC No. 13407 involved in the preferred embodiment of the present invention has been disclosed in patent application CN106635944A. Corynebacterium lysigenum CGMCC No. 11942 has been disclosed in patent CN105734004B.

[0022] The present invention has the following beneficial effects:

[0023] The present invention has found in many years of research and practice that the inactivation of the site-specific DNA methyltransferase encoded by the NCgl0866 gene, or the transposase encoded by the NCgl0864 gene, or the hypothetical protein encoded by the Cgl1893 gene can significantly improve the synthesis efficiency of microbial production of lysine. Based on this, the present invention provides a recombinant microorganism in which at least one of the three endogenous proteins is expressed attenuated, and its ability to produce lysine is significantly increased, and these three endogenous proteins are not related proteins of the lysine synthesis pathway, which is of great significance in the field of improving the efficiency of amino acid production. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Table 1 Primer sequences

[0026] Name Sequence 5'→3' △NCg10866-1f cggatccgcattgagaaaagtgggaaatgcc △NCg10866-1r ggatagggctccttcgtcatcat △NCg10866-2f atgatgacgaaggagccctatccagagccaccaaacctgggac △NCg10866-2r ggctagccagtcgtggtggtctgtcctgg △NCg10864-1f cggatccgccatccgcgtagccaaatcg △NCg10864-1r gctcgtcaagtttttgagacagc △NCg10864-2f gctgtctcaaaaacttgacgagcagagccgctttagacatccctc △NCg10864-2r ggctagccatctacaagctgccggagtcc △Cgl1893-1f cggatccgacctcgcgttttatgaaggcac △Cgl1893-1r attggcaaagttccgtattgctg △Cgl1893-2f cagcaatacggaactttgccaatcgatatttcagcaaaccgatgcta △Cgl1893-2r ggctagccttcctacgacgaagtatttgttgt

[0027] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0028] Example 1 Inactivation of NCg10866 in CGMCC No.13407

[0029] In this example, the genome of Corynebacterium glutamicum ATCC 13032 was used as a template, and PCR amplification was performed with the primer pair △NCg 10866-1f / △NCg10866-1r to obtain the upstream homology arm fragment △NCg10866-up; the genome of Corynebacterium glutamicum ATCC 13032 was used as a template, and PCR amplification was performed with the primer pair △NCg10866-2f / △NCg10866-2r to obtain the downstream homology arm fragment △NCg10866-dn. The mixture of △NCg10866-up and △NCg10866-dn was used as template, and the primer pair of △NCg10866-1f / △NCg10866-2r was used for PCR amplification to obtain the fragment △NCg10866-up-dn. △NCg10866-up-dn was double-digested with BamHI and NheI, and the vector pK18mobsacB (GenBank: FJ437239.1) was double-digested with the same enzymes. The two digestion products were connected with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-△NCg10866.

[0030] Prepare competent cells of ATCC 13032 according to the C. glutamicum Handbook (Charpter 23). The competent cells were transformed with the recombinant plasmid pK18mobsacB-△NCg10866 by electroporation, and the transformants were screened on BHI selective medium containing 15 mg / L kanamycin. The screened transformants were cultured overnight in ordinary BHI liquid medium at 33°C and shaken at 220 rpm on a rotary shaker. During this culture process, the transformants underwent a second recombination, and the vector sequence was removed from the genome by gene exchange. The culture was diluted in a continuous gradient (10 -2 Serial dilution up to 10 -4 ), the dilution was spread on a common BHI solid medium containing 10% sucrose and cultured at 33°C for 48 hours. The grown strain does not carry the inserted vector sequence in its genome. By PCR amplification of the target sequence and nucleotide sequencing analysis, a strain with inactivated NCg10866 (the NCg10866 gene was completely knocked out, its nucleotide sequence is shown in SEQ ID NO.4, and the amino acid sequence shown in SEQ ID NO.1 is encoded) was obtained and named 13407-△NCg10866.

[0031] Example 2 Inactivation of NCg10864 in CGMCC No.13407

[0032] In this example, the genome of Corynebacterium glutamicum ATCC 13032 was used as a template, and PCR amplification was performed with the primer pair △NCg 10864-1f / △NCg10864-1r to obtain the upstream homology arm fragment △NCg10864-up; the genome of Corynebacterium glutamicum ATCC 13032 was used as a template, and PCR amplification was performed with the primer pair △NCg10864-2f / △NCg10864-2r to obtain the downstream homology arm fragment △NCg10864-dn. The mixture of △NCg10864-up and △NCg10864-dn fragments was used as template, and the primer pair of △NCg10864-1f / △NCg10864-2r was used for PCR amplification to obtain the fragment △NCg10864-up-dn. △NCg10864-up-dn was double-digested with BamHI and NheI, and the vector pK18mobsacB (GenBank: FJ437239.1) was double-digested with the same enzymes. The two digestion products were connected with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-△NCg10864.

[0033] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△NCg10864 was transferred into CGMCC No.13407 to obtain a recombinant strain with inactivated NCg10864 (the NCg10864 gene was completely knocked out, its nucleotide sequence is shown in SEQ ID NO.5, and the amino acid sequence shown in SEQ ID NO.2 is encoded), and the strain was named 13407-△NCg10864.

[0034] Example 3 Inactivation of Cgl1893 in CGMCC No.13407

[0035] In this example, the genome of Corynebacterium glutamicum ATCC 13032 was used as a template, and PCR amplification was performed with the primer pair △Cgl1893-1f / △Cgl1893-1r to obtain the upstream homology arm fragment △Cgl1893-up; the genome of Corynebacterium glutamicum ATCC13032 was used as a template, and PCR amplification was performed with the primer pair △Cgl1893-2f / △Cgl1893-2r to obtain the downstream homology arm fragment △Cgl1893-dn. The mixture of △Cgl1893-up and △Cgl1893-dn fragments was used as template, and the primer pair of △Cgl1893-1f / △Cgl1893-2r was used for PCR amplification to obtain the fragment △Cgl1893-up-dn. △Cgl1893-up-dn was double-digested with BamHI and NheI, and the vector pK18mobsac B (GenBank: FJ437239.1) was double-digested with the same enzymes. The two digestion products were connected with T4 DNA Ligase and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-△Cgl1893.

[0036] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△Cgl1893 was transferred into CGMCC No.13407 to obtain a recombinant strain with inactivated Cgl1893 (the Cgl1893 gene was completely knocked out, its nucleotide sequence is shown in SEQ ID NO.6, and the amino acid sequence encoded is shown in SEQ ID NO.3), and the strain was named 13407-△Cgl1893.

[0037] Example 4 Inactivation of NCg10866 / NCg10864 / Cgl1893 in CGMCC No.13407

[0038] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△NCg10864 was transferred into 13407-△NCg10866 to obtain a recombinant strain with inactivated NCg10866 and NCg10864, ​​and the strain was named 13407-△NCg10866△NCg10864. Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△Cgl1893 was transferred into 13407-△NCg10866△NCg10864 to obtain a recombinant strain with inactivated NCg10866, NCg10864 and Cgl1893, and the strain was named 13407-△NCg10866△NCg10864△Cgl1893.

[0039] Example 5 Inactivation of NCg10866 in CGMCC No.11942

[0040] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△NCg10866 was transferred into CGMCC No.11942 to obtain a recombinant strain with inactivated NCg10866, which was named 11942-△NCg10866.

[0041] Example 6 Inactivation of NCg10864 in CGMCC No.11942

[0042] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△NCg10864 was transferred into CGMCC No.11942 to obtain a recombinant strain with inactivated NCg10864, ​​and the strain was named 11942-△NCg10864.

[0043] Example 7 Inactivation of Cgl1893 in CGMCC No.11942

[0044] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△Cgl1893 was transferred into CGMCC No.11942 to obtain a recombinant strain with inactivated Cgl1893, which was named 11942-△Cgl1893.

[0045] Example 8 Loss of NCg10866 / NCg10864 / Cgl1893 in CGMCC No.11942

[0046] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△NCg10864 was transferred into 11942-△NCg10866 to obtain a recombinant strain with inactivated NCg10866 and NCg10864, ​​and the strain was named 11942-△NCg10866△NCg10864. Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-△Cgl1893 was transferred into 11942-△NCg10866△NCg10864 to obtain a recombinant strain with inactivated NCg10866, NCg10864 and Cg l1893, and the strain was named 11942-△NCg10866△NCg10864△Cgl1893.

[0047] Example 9 Shake flask test of fermentation performance of recombinant strains

[0048] The culture medium used in the lysine fermentation experiment is as follows:

[0049] Seed activation medium: BHI 37g / L, 18g / L agar powder.

[0050] Seed culture medium: sucrose 20 g / L, yeast powder 5 g / L, peptone 10 g / L, urea 5 g / L, magnesium sulfate heptahydrate 0.4 g / L, adjust pH to 7.0.

[0051] Fermentation medium: glucose 60g / L, ammonium sulfate 25g / L, potassium dihydrogen phosphate 2.0g / L, magnesium sulfate heptahydrate 1.0g / L, soybean meal hydrolyzate 10g / L, calcium carbonate 30g / L, adjust pH to 7.0.

[0052] The lysine fermentation method is as follows:

[0053] 1. Seed activation: Take the strain to be verified from the cryopreserved tube, streak it on the seed activation medium, and culture it at 33℃ for 24h;

[0054] 2. Seed culture: Pick the activated seeds 1 from the plate and transfer them to a 500mL Erlenmeyer flask containing 30mL of seed culture medium. Culture at 33℃ and 220r / min with shaking for 6h.

[0055] 3. Fermentation culture: inoculate 2 mL of seed liquid into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, culture at 33°C and 220 rpm for 14-15 h, and make three replicates for each strain.

[0056] 4. OD562 determination: Take 100 μl of fermentation liquid and dilute it to an appropriate multiple. Use a spectrophotometer to detect OD at a wavelength of 562. Make three parallels for each strain and calculate the average value. The detected OD562 is shown in Table 2.

[0057] 5. Determination of lysine concentration: 2 mL of fermentation broth was centrifuged (12000 rpm, 2 min), and the supernatant was collected. The L-lysine content in the fermentation broth of the recombinant bacteria and the control bacteria was detected by HPLC. Three parallels were made for each strain, and the average value was calculated. The detected lysine concentrations are shown in Table 2.

[0058] Table 2 Lysine production and growth detection of recombinant strains

[0059] Strain L-Lysine (g / L) Sugar-acid conversion rate % OD562 CGMCC No.13407 15.2 25.33 49.1 13407-△NCg10866 15.9 26.50 48.6 13407-△NCg10864 15.7 26.17 48.7 13407-△Cgl1893 15.8 26.33 49 13407-△NCg10866△NCg10864△Cgl1893 17.9 29.83 48.4 CGMCC No.11942 18.1 30.17 39.4 11942-△NCg10866 18.8 31.33 39.8 11942-△NCg10864 18.9 31.50 39.4 11942-△Cgl1893 18.7 31.17 38.9 11942-△NCg10866△NCg10864△Cgl1893 20.7 34.50 39.0

[0060] The fermentation results showed that the lysine concentration in the culture medium of the same batch of lysine-producing bacteria CGMCC No.13407, CGMCC No.11942, the recombinant bacteria with individual inactivation of NCg10866, NCg10864, ​​Cgl1893 and the recombinant bacteria with simultaneous inactivation of NCg10866, NCg10864, ​​Cgl1893, and the Corynebacterium glutamicum with individual inactivation of NCg10866, NCg10864, ​​Cgl1893 were all higher than that of the control strains. However, the recombinant strain with simultaneous inactivation of NCg10866, NCg10864, ​​Cgl1893 had the highest lysine concentration, which was higher than the improvement effect of individual inactivation of NCg10866, NCg10864, ​​and Cgl1893.

[0061] The above results show that the inactivated strain provided by the present invention has a significant promoting effect on the lysine production and sugar-acid conversion rate of Corynebacterium.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant microorganism, characterized in that In the recombinant microorganism, the expression level of the endogenous protein is reduced; The endogenous protein includes any one or more amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.

3.

2. The recombinant microorganism according to claim 1, characterized in that The endogenous protein is encoded by any one or more nucleotide sequences shown in SEQ ID NO.4-SEQ ID NO.

6.

3. The recombinant microorganism according to claim 1 or 2, characterized in that The decreased expression level includes: The expression level of the endogenous protein is decreased by at least 30%, and / or the activity of the endogenous protein is decreased by at least 30%.

4. The recombinant microorganism according to any one of claims 1 to 3, characterized in that The coding gene of the endogenous protein is edited by one or more methods including RNA interference, gene knockout, gene mutation, replacement of promoter or inhibition of transcription or translation activity to reduce the expression level of the endogenous protein in the recombinant microorganism.

5. The recombinant microorganism according to any one of claims 1 to 4, characterized in that The endogenous protein includes any one or more amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.

3.

6. The recombinant microorganism according to any one of claims 1 to 5, characterized in that The starting strain of the recombinant microorganism is a microorganism capable of producing amino acids.

7. The recombinant microorganism according to claim 6, characterized in that The starting strain of the recombinant microorganism is Corynebacterium glutamicum, Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

8. Use of the recombinant microorganism according to any one of claims 1 to 7 in the production of aspartic acid family amino acids or derivatives thereof.

9. A method for improving the amino acid production capacity or sugar-acid conversion rate of microorganisms, characterized in that: include: The expression level of endogenous protein in the microorganism to be edited is reduced; the endogenous protein includes any one or more amino acid sequences shown in SEQ ID NO.1-SEQ ID NO.

3.

10. The method according to claim 9, characterized in that The amino acid is an aspartic acid family amino acid, and the microorganism to be edited is a strain capable of producing aspartic acid family amino acids or their derivatives.