SgRNA, CRISPR / Cas9 vector, construction method thereof and application of sgRNA and CRISPR / Cas9 vector in poplar gene editing

Abstract

The invention provides sgRNA and CRISPR / Cas9 vectors, a construction method of the sgRNA and CRISPR / Cas9 vectors and application of the sgRNA and CRISPR / Cas9 vectors in poplar gene editing, and relates to the technical field of plant genetic engineering. The specific sgRNA is obtained by optimizing the length and the repetition number of the sgRNA, the CRISPR / Cas9 system is constructed on the basis of the sgRNA, and the CRISPR / Cas9 system can remarkably improve the editing efficiency of the poplar endogenous genes PagRbcS and PagHEMA, and particularly improve the editing efficiency of the monoalleles and dialleles of the poplar endogenous genes.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a group of sgRNA, CRISPR / Cas9 vectors and construction methods thereof, and applications thereof in poplar gene editing. Background Art

[0002] The CRISPR / Cas system developed based on clustered regularly interspaced short palindromic repeats (CRISPRs) sequences has become the mainstream gene editing technology in biological research. Among them, SpCas9 derived from Streptococcus pyogenes is the most widely used CRISPR / Cas system at this stage. The system mainly consists of two important components: sgRNA with guiding function and Cas9 nuclease with DNA double-strand cutting function. sgRNA targets Cas9 nuclease through the principle of complementary base pairing, and then Cas9 nuclease makes double strand breaks (DSBs) upstream of the protospacer adjacent motif (PAM) of 3 nucleotides (NGG). After repair by cell-autonomous nonhomologous end joining (NHEJ) or homologous recombination (HR), the target gene is knocked out, inserted and mutated. With the widespread application of CRISPR / Cas9 system, its shortcomings have become more and more prominent, such as the limitation of PAM recognition sequence, off-target phenomenon, low gene editing efficiency, etc. Due to the genetic characteristics of forest trees such as high genetic heterozygosity and complex genome ploidy, such problems are more obvious. Therefore, it is imperative to develop CRISPR / Cas9 gene editing tools with high gene editing efficiency and suitable for forest trees. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide a group of sgRNA, CRISPR / Cas9 vectors and their construction methods and applications in poplar gene editing. The present invention obtains a CRISPR / Cas9 gene editing system that significantly improves the editing efficiency of poplar by optimizing the length and number of repeats of sgRNA.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a group of sgRNAs, wherein the sgRNAs include one of sgRNA1-20, sgRNA2-1, sgRNA2-2 and sgRNA2-3;

[0006] The nucleotide sequence of the sgRNA1-20 is shown as SEQ ID NO.12; the nucleotide sequence of the sgRNA2-1 is shown as SEQ ID NO.16; the nucleotide sequence of the sgRNA2-2 is shown as SEQ ID NO.17; and the nucleotide sequence of the sgRNA2-3 is shown as SEQ ID NO.18.

[0007] The present invention provides a group of CRISPR / Cas9 vectors, wherein the CRISPR / Cas9 vector is connected to a double-stranded DNA vector corresponding to the sgRNA; the sgRNA includes one or more of sgRNA1-20, sgRNA2-1, sgRNA2-2 and sgRNA2-3; the nucleotide sequence of the sgRNA1-20 is shown in SEQ ID NO.12; the nucleotide sequence of the sgRNA2-1 is shown in SEQ ID NO.16; the nucleotide sequence of the sgRNA2-2 is shown in SEQ ID NO.17; the nucleotide sequence of the sgRNA2-3 is shown in SEQ ID NO.18.

[0008] Preferably, the CRISPR / Cas9 vector is a pRGEB32 plasmid vector.

[0009] The present invention also provides a method for constructing the CRISPR / Cas9 vector, comprising the following steps:

[0010] (1) Amplification of sgRNA1-20: Using the plasmid containing the tRNA sequence as a template, the forward primer sgRNA1-F and the reverse primer sgRNA1-20R were used to amplify a 20 nt long sgRNA1 fragment with a Bsa I restriction site and a tRNA sequence;

[0011] (2) Amplification of sgRNA2-1, sgRNA2-2, and sgRNA2-3:

[0012] sgRNA2 with a repeat number of 1: Using the plasmid containing the tRNA sequence as a template, sgRNA2-F and sgRNA2-R were used to amplify a fragment containing one sgRNA2 with a Bsa I restriction site and a tRNA sequence;

[0013] sgRNA2 with 2 repeats: Using the plasmid containing the tRNA sequence as a template, three sets of primers L5AD5-F and sgDNA1-P1-R, sgDNA1-P1-F and sgDNA1-P2-R, sgDNA1-P2-F and L3AD5-R were used to amplify three small fragments containing the Bsa I restriction site, and the three small fragments were mixed in equal amounts, and Bsa I enzyme and T7 DNA ligase were added for GoldenGate ligation to form a long fragment containing 2 sgRNA2 repeats and with FokI restriction site and tRNA sequence;

[0014] sgRNA2 with 3 repeats: Using the plasmid containing the tRNA sequence as a template, four sets of primers L5AD5-F and sgDNA1-P3-R, sgDNA1-P3-F and sgDNA1-P4-R, sgDNA1-P4-F and sgDNA1-P5-R, sgDNA1-P5-F and L3AD5-R were used to amplify four small fragments containing the Bsa I restriction site. The four amplified small fragments were connected into a long fragment containing 3 sgRNA2 repeats and with the FokI restriction site and tRNA sequence by Golden Gate cloning method;

[0015] (3) The sgRNA1-20, sgRNA2 with a repeat number of 1, sgRNA2 with a repeat number of 2, and sgRNA2 with a repeat number of 3 obtained in step (1) and step (2) were respectively digested and connected to the linearized vector pRGEB32 to obtain a CRISPR / Cas9 vector.

[0016] Preferably, the plasmid containing the tRNA sequence is pGTR.

[0017] The present invention also provides an application of the sgRNA or the CRISPR / Cas9 vector, or the construction method in improving the efficiency of gene editing in poplar.

[0018] Preferably, the poplar genes include poplar endogenous genes PagRbcS and PagHEMA.

[0019] The present invention also provides a method for improving the efficiency of gene editing in poplar, the method comprising selecting an sgRNA with a length of 20 nt and a repeat number of 3; the nucleotide sequence of the sgRNA is shown in SEQ ID NO.18.

[0020] The present invention also provides an application of the sgRNA or the CRISPR / Cas9 vector, or the construction method in preparing transgenic poplar.

[0021] More preferably, the variety of the poplar is 84K poplar.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention obtains a specific sgRNA by optimizing the sgRNA length and the number of sgRNA repeats, and constructs a CRISPR / Cas9 system based on the sgRNA. The CRISPR / Cas9 system can significantly improve the editing efficiency of poplar endogenous genes PagRbcS and PagHEMA, especially improve the editing efficiency of monoallelic and biallelic genes of poplar endogenous genes. Analysis of Sanger sequencing results shows that a gene editing efficiency of 31.03% (PagHEMA-20nt) is achieved for the target sequence of the poplar PagHEMA endogenous gene.

[0024] The gene editing efficiencies of 58.62% (PagRbcS-sgRNA2-1), 72.73% (PagRbcS-sgRNA2-2) and 87.50% (PagRbcS-sgRNA2-3) were achieved for the four multi-copy genes of poplar PagRbcS. Among them, with the increase in the number of sgRNA2 repeats, the CRISPR / Cas9 gene editing efficiency also increased. When the length of sgRNA2 was 20nt and the number of repeats was 3, the editing efficiency of the poplar CRISPR / Cas9 vector was the highest. The monoallelic editing efficiencies of the three vectors were 34.48% (PagRbcS-sgRNA2-1), 42.42% (PagRbcS-sgRNA2-2) and 62.50% (PagRbcS-sgRNA2-3), respectively. The biallelic editing efficiencies of the three vectors were 41.38% (PagRbcS-sgRNA2-1), 60.61% (PagRbcS-sgRNA2-2), and 65.63% (PagRbcS-sgRNA2-3), respectively. These data indicate that as the number of sgRNA2 repeats increases, both monoallelic and biallelic editing efficiencies increase. At the same time, increasing the number of sgRNAs has a significant effect on increasing the random probability of editing 4 multi-copy genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is a mass spectrum of the pRGEB32 plasmid vector of the present invention;

[0026] Figure 2 Schematic diagram of the structure of the recombinant plasmid vector of sgRNA1 of different lengths of the present invention;

[0027] Figure 3 Schematic diagram of the structure of the recombinant plasmid vector of sgRNA2 with different repeat numbers of the present invention;

[0028] Figure 4 The results of gene editing efficiency of vectors with different lengths of sgRNA1;

[0029] Figure 5 The results of gene editing efficiency of vectors with different numbers of sgRNA2 repeats;

[0030] Figure 6 Statistical results of the number of multi-copy genes edited by vectors with different numbers of sgRNA2 repeats;

[0031] Figure 7 The statistical results of the number of genes with multiple copies edited simultaneously by vectors with different numbers of sgRNA2 repeats. DETAILED DESCRIPTION

[0032] The present invention provides a group of sgRNAs, wherein the sgRNAs include one of sgRNA1-20, sgRNA2-1, sgRNA2-2 and sgRNA2-3; the nucleotide sequence of the sgRNA1-20 is AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAAGAGTCTTGCTGAATCATAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO.12);

[0033] The nucleotide sequence of the sgRNA2-1 is

[0034] AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAG

[0035] ACCCGGGTTCGATTCCCGGCTGGTGCAATGTGGAAGCTACCCATGTTGTTT

[0036] TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 16);

[0037] The nucleotide sequence of the sgRNA2-2 is

[0038] AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAG

[0039] ACCCGGGTTCGATTCCCGGCTGGTGCAATGTGGAAGCTACCCATGTTGTTT

[0040] TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA

[0041] AAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAA

[0042] TAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAATG

[0043] TGGAAGCTACCCATGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC(SEQ ID NO.17);

[0044] The nucleotide sequence of the said sgRNA2-3 is

[0045] AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAG

[0046] ACCCGGGTTCGATTCCCGGCTGGTGCAATGTGGAAGCTACCCATGTTGTTT

[0047] TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA

[0048] AAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAA

[0049] TAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAATG

[0050] TGGAAGCTACCCATGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG

[0051] CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGC

[0052] ACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTT

[0053] CGATTCCCGGCTGGTGCAATGTGGAAGCTACCCATGTTGTTTTAGAGCTAG

[0054] AAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 18).

[0055] The present invention provides a group of CRISPR / Cas9 vectors, wherein the CRISPR / Cas9 vector is connected to a double-stranded DNA vector corresponding to the sgRNA; the sgRNA includes one of sgRNA1-20, sgRNA2-1, sgRNA2-2 and sgRNA2-3; the nucleotide sequence of the sgRNA1-20 is shown in SEQ ID NO.12; the nucleotide sequence of the sgRNA2-1 is shown in SEQ ID NO.16; the nucleotide sequence of the sgRNA2-2 is shown in SEQ ID NO.17; the nucleotide sequence of the sgRNA2-3 is shown in SEQ ID NO.18.

[0056] In the present invention, the CRISPR / Cas9 vector is a pRGEB32 plasmid vector. The pRGEB32 vector plasmid sequence and purchase used in the present invention can be obtained on Addgene: https: / / www.addgene.org / browse / article / 9997 / .

[0057] The present invention also provides a method for constructing the CRISPR / Cas9 vector, preferably comprising the following steps:

[0058] (1) Amplification of sgRNA1-20: Using a plasmid containing a tRNA sequence as a template, a forward primer sgRNA1-F and a reverse primer sgRNA1-20R were used to amplify a 20 nt sgRNA1 fragment with a Bsa I restriction site and a tRNA sequence; the Bsa I restriction site can be used for common restriction ligation, so that the sgRNA1 fragment after restriction ligation can be ligated to the linearized pRGEB32 vector;

[0059] (2) Amplification of sgRNA2-1, sgRNA2-2, and sgRNA2-3:

[0060] sgRNA2 with a repeat number of 1: Using a plasmid containing a tRNA sequence as a template, sgRNA2-F and sgRNA2-R were used to amplify a fragment containing one sgRNA2 and carrying a Bsa I restriction site and a tRNA sequence; the Bsa I restriction site can be used for common restriction ligation, so that the sgRNA2 fragment after restriction ligation can be ligated to the linearized pRGEB32 vector;

[0061] sgRNA2 with a repeat number of 2: Using the plasmid containing the tRNA sequence as a template, three sets of primers L5AD5-F and sgDNA1-P1-R, sgDNA1-P1-F and sgDNA1-P2-R, sgDNA1-P2-F and L3AD5-R were used to amplify three small fragments containing the Bsa I restriction site, and the three small fragments were mixed with equal mass, and Bsa I enzyme and T7 DNA ligase were added for Golden Gate connection to connect them into a long fragment containing 2 sgRNA2 repeats and with Fok I restriction site and tRNA sequence; the Bsa I restriction site is for subsequent Golden Gate connection; the FokI restriction site is used for ordinary restriction connection, so that the sgRNA2-2 fragment after restriction digestion is connected to the linearized pRGEB32 vector;

[0062] sgRNA2 with 3 repeats: using the plasmid containing the tRNA sequence as a template, four sets of primers L5AD5-F and sgDNA1-P3-R, sgDNA1-P3-F and sgDNA1-P4-R, sgDNA1-P4-F and sgDNA1-P5-R, sgDNA1-P5-F and L3AD5-R were used to amplify four small fragments containing the Bsa I restriction site, and the four amplified small fragments were connected into a long fragment containing 3 sgRNA2 repeats and with the Fok I restriction site and tRNA sequence by Golden Gate cloning; the Bsa I restriction site is for subsequent Golden Gate connection; the FokI restriction site is used for ordinary restriction connection, so that the sgRNA2-3 fragment after restriction digestion is connected to the linearized pRGEB32 vector;

[0063] (3) The sgRNA1-20, sgRNA2 with a repeat number of 1, sgRNA2 with a repeat number of 2, and sgRNA2 with a repeat number of 3 obtained in step (1) and step (2) were respectively digested and connected to the linearized vector pRGEB32.

[0064] In the present invention, the ligation products obtained after connecting sgRNA to the linearized vector pRGEB32 were transformed into Escherichia coli DH5α competent cells for sequencing to obtain recombinant plasmids with successful sequencing, and then the above recombinant plasmids were transformed into Agrobacterium GV3101 competent cells to obtain CRISPR / Cas9 vectors.

[0065] In the present invention, the Golden Gate connection process is a connection method well known to those skilled in the art, and the Golden Gate connection experiment can be performed according to conventional steps known in the art. In a specific embodiment of the present invention, the Golden Gate connection process is connected according to the experimental method disclosed in the reference (Xie K, Minkenberg B, Yang Y. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci USA. 2015 Mar 17; 112 (11): 3570-5).

[0066] In the present invention, the plasmid containing the tRNA sequence is preferably pGTR, and the plasmid sequence and purchase can be obtained on Addgene: https: / / www.addgene.org / browse / article / 9997 / .

[0067] The present invention also provides an application of the sgRNA or the CRISPR / Cas9 vector, or the construction method in improving the efficiency of gene editing in poplar.

[0068] In the present invention, the poplar gene includes the poplar endogenous genes PagRbcS and PagHEMA. The present invention uses the HEMA gene when optimizing the length of sgRNA and uses the RbcS gene when optimizing the number of sgRNA repeats because the HEMA gene is one allele in diploid poplars and the RbcS gene is two alleles in diploid poplars. In this way, the PagHEMA-20nt vector and the PagRbcS-sgRNA2-1 vector can compare the editing efficiency of single-copy genes and multi-copy genes when the length and number of repeats are the same. The experimental results show that the editing efficiency of monoallelic and biallelic genes of poplars can be improved by optimizing the length and number of repeats of sgRNA.

[0069] The present invention also provides a method for improving the efficiency of gene editing in poplar, the method comprising selecting an sgRNA with a length of 20 nt and a repeat number of 3; the nucleotide sequence of the sgRNA is shown in SEQ ID NO.18.

[0070] The present invention also provides an application of the sgRNA or the CRISPR / Cas9 vector or the construction method in preparing transgenic poplars. In the present invention, the variety of the poplar is preferably 84K poplar.

[0071] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0072] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0073] Example 1 Selection and optimization of sgRNA

[0074] 1. According to the 84K poplar genome sequence, the target genes PagHEMA and PagRbcS were found respectively. The CDS sequence of the PagHEMA gene was cloned using PagHEMA-F and PagHEMA-R primers. The partial CDS sequence of the PagRbcS gene was cloned using PagRbcS-F and PagRbcS-R. The obtained CDS sequences were input into the CRISPR / Cas9 target site online analysis platform "CCtop" (https: / / cctop.cos.uni-heidelberg.de:8043). According to the location of the required target site and the prediction score of the website, sgRNA1 was selected as the target site of the PagHEMA gene, and sgRNA2 was selected as the target site of the PagRbcS gene. Based on sgRNA1, the length of 18-22nt was optimized; based on sgRNA2, the number of repeats was optimized to 1-3. The primer sequences for amplifying the PagHEMA and PagRbcS genes are shown in Table 1 , the sgRNA1 sequences of different lengths are shown in Table 2 , and the sgRNA2 sequences are shown in Table 3 .

[0075] Table 1 Primer sequence information

[0076]

[0077] Table 2 Sequence information of sgRNA1 of different lengths

[0078]

[0079]

[0080] Table 3 sgRNA2 sequence information

[0081]

[0082] 2. Amplify sgRNA1 of different lengths from 18 to 22 nt:

[0083] According to the PCR reaction system shown in Table 4, the pGTR plasmid containing the tRNA sequence was used as a template, and the same forward primer sgRNA1-F and different reverse primers were used.

[0084] sgRNA1-18R to sgRNA1-22R were amplified to obtain sgRNA1 fragments of different lengths of 18-22 nt with Bsa I restriction site and tRNA sequence. The primer sequences used are shown in Table 5, and the specific amplification program is shown in Table 6.

[0085] Table 4 PCR reaction system for amplifying sgRNAs of different lengths and repeat numbers

[0086]

[0087]

[0088] Table 5 Primer sequence information for amplifying sgRNA1 of different lengths

[0089]

[0090] Table 6 PCR reaction procedures for amplifying sgRNA1 of different lengths

[0091]

[0092] 3. Amplify sgRNA2 with different repeat numbers of 1 to 3:

[0093] 1 sgRNA2 repeat number: According to the PCR reaction system shown in Table 4, the pGTR plasmid containing the tRNA sequence was used as a template, and sgRNA2-F and sgRNA2-R were used to amplify a fragment containing 1 sgRNA2 with a Bsa I restriction site and a tRNA sequence. The primer sequences used are shown in Table 7, and the specific amplification program is shown in Table 8.

[0094] 2 sgRNA2 repeats: According to the PCR reaction system and procedures shown in Tables 5 and 8, three sets of primers L5AD5-F and sgDNA1-P1-R; sgDNA1-P1-F and sgDNA1-P2-R; sgDNA1-P2-F and L3AD5-R were used to amplify three small fragments containing Bsa I restriction sites, and then the three small fragments were mixed with equal mass according to the Golden Gate ligation system shown in Table 9, and Bsa I enzyme and T7 DNA ligase were added for Golden Gate ligation. The ligation conditions were 37°C, 5 min, 20°C, 10 min, and 30 to 50 cycles; and then stored at 20°C for 1 hour. The obtained Golden Gate ligation product was diluted 10 times with ddH2O, 1 μL was taken as a template, and then S5AD5-F and S5AD5-R primers were added to clone according to the reaction system and program of Table 4 and Table 8 to obtain a complete long fragment containing 2 sgRNA2 repeats and with FokI restriction site and tRNA sequence. The primer sequences used are shown in Table 7.

[0095] 3 sgRNA2 repeats: The synthesis process is the same as the long fragment containing 2 sgRNA2 repeats. The four sets of primers used are L5AD5-F and sgDNA1-P3-R; sgDNA1-P3-F and sgDNA1-P4-R; sgDNA1-P4-F and sgDNA1-P5-R; sgDNA1-P5-F and L3AD5-R. The four amplified small fragments were connected into a long fragment containing 3 sgRNA2 repeats and with FokI restriction site and tRNA sequence by Golden Gate cloning method. The primer sequences used are shown in Table 7.

[0096] Table 7 Primer sequence information for amplifying sgRNA2 with different repeat numbers

[0097]

[0098]

[0099] Table 8 PCR reaction procedures for amplifying sgRNA2 with different repeat numbers

[0100]

[0101] Table 9 Golden Gate connection system

[0102] Components volume sgRNA2 small fragments with different repeat numbers 25~50ng (equal mass added to each small fragment) 2×T7 DNA Ligase Buffer 2μL Bovine Serum Albumin (1mg / mL) 2μL BnS 1μL T7DNALigase 1μL <![CDATA[ddH2O]]> Make up to 20 μL

[0103] Example 2 Construction of CRISPR / Cas9 gene editing vector

[0104] The sgRNA1 with different lengths of 18-22 nt and sgRNA2 with different repeat numbers of 1 to 3 and the vector obtained by enzyme digestion in Example 1 are as follows:

[0105] 1. Use Bsa I to digest the CRISPR / Cas9 vector pRGEB32, sgRNA1 of different lengths of 18-22 nt, and long fragments containing one sgRNA2. The digestion system is shown in Table 10. The digestion conditions are 37°C for 3 hours.

[0106] 2. At 37°C, according to the enzyme digestion system shown in Table 11, FokI was added to digest the long fragments of sgRNA2 containing 2 and 3 repeats for 3 hours. The CRISPR / Cas9 vector is a pRGEB32 plasmid vector. The mass spectrum of pRGEB32 is shown in Figure 1 ;

[0107] 3. Ligation to the final vector: Use T4 DNA ligase to connect the linearized vector pRGEB32 to the sequences containing various sgRNAs. The connection system is shown in Table 12. The connection conditions are 16°C for 12-14 hours.

[0108] 4. Transformation competent state: Transform the various ligation products obtained above into E. coli DH5α competent state respectively: Take 10 μL of ligation product into DH5α competent cells, place on ice for 30 minutes; heat at 42℃ for 45 seconds, place on ice for 2 minutes; then add 700 μL of LB liquid medium without antibiotics and mix well, resuscitate at 37℃, 200rpm for 1 hour; centrifuge at 4000rpm for 1 minute to collect the bacteria, take about 100 μL of supernatant, gently blow and resuspend the bacteria block and spread it on LB solid medium containing kanamycin, and culture at 37℃ for 12-15 hours. The next day, pick 5 single colonies respectively, add liquid LB medium containing kanamycin in a 1.5mL centrifuge tube, and culture at 37℃, 200rmp for 12 hours. After the bacteria are shaken, perform PCR detection and sequencing. According to the above operation, we obtained recombinant plasmids with different lengths of sgRNA1: PagHEMA-18nt, PagHEMA-19nt, PagHEMA-20nt, PagHEMA-21nt and PagHEMA-22nt and recombinant plasmids with different numbers of sgRNA2 repeats: PagRbcS-sgRNA2-1, PagRbcS-sgRNA2-2 and PagRbcS-3sgRNA2-3. Schematic diagram of each recombinant plasmid is shown in Figure 2 and Figure 3 .

[0109] 5. Transform the recombinant plasmids that have been sequenced successfully into Agrobacterium GV3101 competent cells. The steps are as follows: take 5μL of recombinant plasmids to 50μL GV3101 competent cells, mix them by blowing, and place them on ice for 10min; place them in liquid nitrogen for 5min; place them in a 37℃ water bath for 5min, and then place them on ice for 5min; then add 700μL of antibiotic-free YEB liquid medium, and resuscitate them at 28℃ for 2-3h; centrifuge at 4000rpm for 1min to collect the bacteria, and take about 100μL of supernatant to gently blow and resuspend the bacteria blocks and spread them on YEB solid medium containing kanamycin and rifampicin, and culture them at 28℃ for 36-48h. Pick a single colony, add it to YEB liquid medium containing kanamycin and rifampicin, and culture it at 28℃ for 36-48h. After shaking and culturing at 28℃ for 36-48h, perform PCR detection. The Agrobacterium bacterial solution containing the target band of the recombinant plasmid is the CRISPR / Cas9 vector bacterial solution used for the final poplar transformation.

[0110] Table 10 Bsa I restriction enzyme system

[0111] Components volume sgRNA fragments of different lengths or with 1 repeat number / pRGEB32 plasmid 44μL 10×rCutSmartBuffer 5μL BnS 1μL

[0112] Table 11Fok I restriction enzyme system

[0113] Components volume sgRNA2 fragment with 2 or 3 repeats 44μL 10×rCutSmartBuffer 5μL FokI 1μL

[0114] Table 12 Final vector connection system

[0115] Components volume Linearized vector pRGEB32 About 50ng sgRNA fragments of different lengths or repeat numbers with sticky ends About 37.5ng 10×T4 DNA Ligase Buffer 2μL T4DNALigase 1μL <![CDATA[ddH2O]]> Make up to 20 μL

[0116] Example 3 Application of CRISPR / Cas9 gene editing vector in poplar gene editing

[0117] 1. Genetic transformation of poplar (leaf disc method):

[0118] (1) Preparation of infection solution: Agrobacterium bacterial suspensions of the PagHEMA-18nt, PagHEMA-19nt, PagHEMA-20nt, PagHEMA-21nt, PagHEMA-22nt, PagRbcS-sgRNA2-1, PagRbcS-sgRNA2-2 and PagRbcS-sgRNA2-3 vectors successfully transformed in Example 2 were activated at 28° C. and expanded and shaken to OD 600 =0.4-0.6, then centrifuged at 4000 rpm for 15 min, and then resuspended in WPM liquid medium (WPM + 100 μM acetosyringone + 30 g / L sucrose, pH = 5.8) to OD 600 =0.4~0.6, and obtain the infection solution for transformation.

[0119] (2) Co-cultivation: Under sterile conditions, take 84K poplar tissue culture seedlings with a growth period of about 30 days, cut the 2nd to 4th leaves from the top into 1 cm 2 The leaves were arranged in different sizes and shapes, and placed in the infection solution for 10-15 minutes, then the excess infection solution was absorbed with filter paper, and finally the leaves were spread on the co-cultivation medium CM1 (WPM + 100 μM acetosyringone + 2 mg / L zeatin + 1 mg / L naphthaleneacetic acid + 30 g / L sucrose + 6 g / L agar powder, pH = 5.8) and cultured in the dark for 3 days.

[0120] (3) Callus induction culture: Under sterile conditions, the leaves cultured on CM1 plates for 3 days were transferred to callus induction medium CM2 (WPM + 2 mg / L zeatin + 1 mg / L naphthaleneacetic acid + 30 g / L sucrose + 400 mg / L carbenicillin sodium (Car) + 2 mg / L hygromycin B (Hyg) + 6 g / L agar powder, pH = 5.8) and cultured in the dark for 15 to 30 days.

[0121] (4) Resistance bud screening and culture: Under sterile conditions, the leaves with callus growth were transferred to budding medium CM3 (WPM + 2 mg / L zeatin + 0.1 mg / L naphthaleneacetic acid + 30 g / L sucrose + 400 mg / L carbenicillin sodium + 2 mg / L hygromycin B + 6 g / L agar powder, pH = 5.8) and grown under light conditions for 2 to 4 months.

[0122] (5) Rooting screening culture: Under sterile conditions, the buds grown in CM3 were individually divided into rooting medium CM4 (WPM + 0.1 mg / L naphthaleneacetic acid + 15 g / L sucrose + 400 mg / L carbenicillin sodium + 2 mg / L hygromycin B + 6 g / L agar powder, pH = 5.8) and grown under light conditions for about 1 month.

[0123] 2. Mutation detection and statistics of poplar CRISPR / Cas9 transgenic plants

[0124] (1) The genomic DNA of the transgenic poplar that successfully rooted was extracted and used as a template. The primers SpCas9-F and SpCas9-R were used for PCR detection. The corresponding recombinant plasmid was used as a template as a positive control, and ddH2O and wild-type 84K genomic DNA were used as templates as negative controls. The SpCas9 band was amplified for the positive transgenic poplar. The PCR reaction system was 20 μL. After mixing the various components, the PCR reaction was performed. The PCR reaction procedure was as follows: after 94°C pre-denaturation for 3 minutes, 30 cycles were performed, each cycle was 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute, and finally, 72°C extension for 5 minutes. The genomic DNA of the positive transgenic poplar was used as a template for PCR amplification and Sanger sequencing analysis. The PCR reaction system and reaction procedure were shown in Tables 4 and 8. Among them, primers PagHEMA-jdF and PagHEMA-jdR were used to clone the partial sequence containing sgRNA1, and primers PagRbcS-jdF and PagRbcS-jdR were used to clone the partial sequence containing sgRNA2. The primer sequences used are shown in Table 13.

[0125] Table 13 PCR amplification primer sequences

[0126]

[0127] 3. Sanger sequencing results of poplar CRISPR / Cas9 transgenic plants

[0128] Analysis of Sanger sequencing results showed that the gene editing efficiencies of 25.00% (PagHEMA-18nt), 28.00% (PagHEMA-19nt), 31.03% (PagHEMA-20nt), 24.14% (PagHEMA-21nt) and 17.24% (PagHEMA-22nt) were achieved for the endogenous gene target sequences of poplar PagHEMA. Among them, when the sgRNA length was 20nt, the editing efficiency of the poplar CRISPR / Cas9 vector was the highest, and the lowest editing efficiency was the vector with 22nt sgRNA. For monoallelic editing, the highest editing efficiency was the PagHEMA-22nt vector (80.00%), the lowest editing efficiency was the PagHEMA-21nt vector (42.86%), and the monoallelic editing efficiency of the PagHEMA-20nt vector was 66.67%, which was at a medium level. In biallelic editing, the highest editing efficiency was achieved with the PagHEMA-21nt vector (57.14%), the biallelic editing efficiency of the PagHEMA-20nt vector was 33.33%, and the biallelic editing efficiency of the PagHEMA-22nt vector was the lowest, at only 20.00%. The specific statistical results are shown in Tables 14 and Figure 4 .

[0129] Analysis of Sanger sequencing results showed that the gene editing efficiencies of 58.62% (PagRbcS-sgRNA2-1), 72.73% (PagRbcS-sgRNA2-2) and 87.50% (PagRbcS-sgRNA2-3) were achieved for the four multi-copy genes of poplar PagRbcS. Among them, as the number of sgRNA2 repeats increased, the CRISPR / Cas9 gene editing efficiency also increased. When the number of sgRNA2 repeats was 3, the poplar CRISPR / Cas9 vector had the highest editing efficiency. The monoallelic editing efficiencies of the three vectors were 34.48% (PagRbcS-sgRNA2-1), 42.42% (PagRbcS-sgRNA2-2) and 62.50% (PagRbcS-sgRNA2-3), respectively. The biallelic editing efficiencies of the three vectors were 41.38% (PagRbcS-sgRNA2-1), 60.61% (PagRbcS-sgRNA2-2), and 65.63% (PagRbcS-sgRNA2-3), respectively. These data indicate that as the number of sgRNA2 repeats increases, both monoallelic and biallelic editing efficiencies increase. Specific statistical results are shown in Tables 14 and Figure 5 .

[0130] When counting the number of multi-copy genes edited by the three sgRNA2 vectors, the proportion of plants with all four PagRbcS multi-copy genes edited was 17.24% (PagRbcS-sgRNA2-1), 21.21% (PagRbcS-sgRNA2-2), and 12.50% (PagRbcS-sgRNA2-3), respectively, indicating that only one sgRNA can be used to simultaneously target and knock out four homologous genes. In the event of simultaneous editing of three PagRbcS multi-copy genes in transgenic poplars, the PagRbcS-sgRNA2-1 vector accounted for 24.13%, PagRbcS-sgRNA2-2 accounted for 27.27%, and PagRbcS-sgRNA2-3 accounted for 28.13%. Among the transgenic poplars in which two PagRbcS multi-copy genes were edited, the PagRbcS-sgRNA2-1 vector accounted for 3.45%, PagRbcS-sgRNA2-2 accounted for 21.21%, and PagRbcS-sgRNA2-3 accounted for 43.75%. Among the transgenic poplars obtained with the three vectors, the case in which only one PagRbcS multi-copy gene was edited was relatively rare, with the proportions being 13.79% (PagRbcS-sgRNA2-1), 3.03% (PagRbcS-sgRNA2-2), and 3.13 (PagRbcS-sgRNA2-3). The above results show that increasing the number of sgRNAs cannot improve the efficiency of simultaneous knockout of four PagRbcS multi-copy genes, but the random probability of editing four multi-copy genes is significantly increased. For specific statistical results, see the attached. Figure 6 and attached Figure 7 .

[0131] Table 14 Statistical results of gene editing efficiency of poplar CRISPR / Cas9 transgenic plants

[0132]

[0133]

[0134] From the above analysis results, it can be seen that in the poplar CRISPR / Cas9 gene editing vector, the sgRNA length was optimized for the first time, and it was found that the vector with a 20nt sgRNA length had the highest gene editing efficiency, with an editing efficiency of 31.03%. In the poplar CRISPR / Cas9 gene editing vector, the number of sgRNA repeats was optimized for the first time, and it was found that when the sgRNA length was 20nt, the gene editing efficiency increased significantly with the increase in the number of sgRNA repeats. When the number of sgRNA repeats was 3, the gene editing efficiency was as high as 87.50%. In short, in the poplar CRISPR / Cas9 gene editing system, when the sgRNA length was 20nt and the number of sgRNA repeats was increased to 3 using the tRNA-sgRNA structure, the transgenic poplar had a higher gene editing efficiency.

[0135] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A set of sgRNAs, characterized in that: The sgRNA includes one of sgRNA1-20, sgRNA2-1, sgRNA2-2 and sgRNA2-3: The nucleotide sequence of the sgRNA1-20 is shown in SEQ ID NO.12; The nucleotide sequence of the sgRNA2-1 is shown in SEQ ID NO.16; The nucleotide sequence of the sgRNA2-2 is shown in SEQ ID NO.17; The nucleotide sequence of the sgRNA2-3 is shown in SEQ ID NO.

18.

2. A set of CRISPR / Cas9 vectors, characterized in that: The CRISPR / Cas9 vector is connected to a double-stranded DNA vector corresponding to the sgRNA according to claim 1; the sgRNA includes one of sgRNA1-20, sgRNA2-1, sgRNA2-2 and sgRNA2-3; the nucleotide sequence of sgRNA1-20 is shown in SEQ ID NO.12; the nucleotide sequence of sgRNA2-1 is shown in SEQ ID NO.16; the nucleotide sequence of sgRNA2-2 is shown in SEQ ID NO.17; the nucleotide sequence of sgRNA2-3 is shown in SEQ ID NO.

18.

3. The CRISPR / Cas9 vector according to claim 2, characterized in that The CRISPR / Cas9 vector is a pRGEB32 plasmid vector.

4. The method for constructing the CRISPR / Cas9 vector according to claim 2 or 3, characterized in that: The steps include: (1) Amplification of sgRNA1-20: Using the plasmid containing the tRNA sequence as a template, the forward primer sgRNA1-F and the reverse primer sgRNA1-20R were used to amplify a 20 nt long sgRNA1 fragment with a Bsa I restriction site and a tRNA sequence; (2) Amplification of sgRNA2-1, sgRNA2-2, and sgRNA2-3: sgRNA2 with a repeat number of 1: Using the plasmid containing the tRNA sequence as a template, sgRNA2-F and sgRNA2-R were used to amplify a fragment containing one sgRNA2 with a Bsa I restriction site and a tRNA sequence; sgRNA2 with 2 repeats: Using the plasmid containing the tRNA sequence as a template, three sets of primers L5AD5-F and sgDNA1-P1-R, sgDNA1-P1-F and sgDNA1-P2-R, sgDNA1-P2-F and L3AD5-R were used to amplify three small fragments containing the Bsa I restriction site. The three small fragments were mixed with equal mass, and Bsa I enzyme and T7 DNA ligase were added for GoldenGate ligation to form a long fragment containing 2 sgRNA2 repeats and with FokI restriction site and tRNA sequence; sgRNA2 with 3 repeats: Using the plasmid containing the tRNA sequence as a template, four sets of primers L5AD5-F and sgDNA1-P3-R, sgDNA1-P3-F and sgDNA1-P4-R, sgDNA1-P4-F and sgDNA1-P5-R, sgDNA1-P5-F and L3AD5-R were used to amplify four small fragments containing the Bsa I restriction site. The four amplified small fragments were connected into a long fragment containing 3 sgRNA2 repeats and with the FokI restriction site and tRNA sequence using the GoldenGate cloning method; (3) The sgRNA1-20, sgRNA2 with a repeat number of 1, sgRNA2 with a repeat number of 2, and sgRNA2 with a repeat number of 3 obtained in step (1) and step (2) were respectively digested and connected to the linearized vector pRGEB32 to obtain a CRISPR / Cas9 vector.

5. The construction method according to claim 4, characterized in that: The plasmid containing the tRNA sequence is pGTR.

6. Use of the sgRNA of claim 1, the CRISPR / Cas9 vector of any one of claims 2 to 3, or the construction method of any one of claims 4 to 5 in improving the efficiency of gene editing in poplar.

7. The use according to claim 6, characterized in that: The poplar genes include poplar endogenous genes PagRbcS and PagHEMA.

8. A method for improving the efficiency of gene editing in poplar, characterized in that: The method includes selecting an sgRNA with a length of 20 nt and a repeat number of 3; the nucleotide sequence of the sgRNA is shown in SEQ ID NO.

18.

9. Use of the sgRNA according to claim 1, the CRISPR / Cas9 vector according to any one of claims 2 to 3, or the construction method according to any one of claims 4 to 5 in preparing transgenic poplar.

10. The use according to claim 6 or 9, characterized in that: The variety of the poplar is 84K poplar.

Images