Rapid visual detection method for African swine fever virus

Abstract

The invention discloses a rapid visual detection method for African swine fever virus, and belongs to the technical field of molecular biology diagnosis. According to the invention, a nucleic acid extraction-free technology, an isothermal amplification technology and a CRISPR / Cas system are combined, and a rapid, sensitive and on-site instant detection method suitable for ASFV is developed. According to the method, an isothermal amplification (RAA) technology is firstly utilized to amplify a target sequence, then a CRISPR-Cas13d system is combined to perform specific recognition and signal amplification, and the method has high sensitivity and high specificity. Besides, a rapid nucleic acid extraction method and a diversified result display technology are introduced, so that the detection process is simplified, the detection efficiency is improved, the problem of complicated steps of a current commercial nucleic acid extraction kit is solved, and the application potential of the kit in on-site instant detection is further promoted.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological diagnosis, and in particular relates to a rapid visual detection method for African swine fever virus. Background Art

[0002] The outbreak of African swine fever virus (ASFV) has posed a huge threat to the global pig industry and has seriously affected pig production and the economy of many countries. ASFV is highly contagious and there is currently no effective vaccine or specific drug. Therefore, rapid and sensitive clinical point-of-care testing is essential to control and prevent the spread of ASFV. Currently, real-time fluorescence quantitative PCR (qPCR) is the gold standard for detecting ASFV nucleic acid. However, qPCR testing requires specialized instruments and relatively professional personnel to operate, which makes it difficult to promote and apply in areas with limited resources, and the cycle from sampling to results is long. Although the speed of qPCR testing has been significantly improved and results can be obtained within 24 hours, it is still difficult to meet the high-frequency and large-scale on-site point-of-care testing (POCT) needs in large-scale production.

[0003] Colloidal gold immunochromatographic test strips can be used for on-site instant testing, but it is difficult to balance sensitivity and specificity. Therefore, isothermal amplification technology has become a method that has attracted much attention in POCT testing because it can achieve efficient amplification of target DNA at a constant temperature without the need for complex equipment. Commonly used isothermal amplification techniques include recombinase polymerase amplification (RPA), recombinase-assisted amplification (RAA) and loop-mediated isothermal amplification (LAMP). These methods have the advantages of high amplification efficiency and strong resistance to inhibitory components, and are particularly suitable for on-site testing in resource-constrained areas. However, the application of isothermal amplification technology faces the challenge of nonspecific amplification, which may lead to inaccurate results.

[0004] The CRISPR / Cas system, with its unique trans-cleavage activity, has shown great potential in molecular diagnosis and is hailed as the "next generation of molecular diagnostic technology." By utilizing the guide RNA of the CRISPR system to recognize specific sequences of amplicons and generate specific signal amplification, higher detection sensitivity and specificity can be achieved. There are four subtypes of Cas13 effector proteins: Cas13a, Cas13b, Cas13c, and Cas13d. Of particular note is Cas13d, which has the characteristics of two higher eukaryotic and prokaryotic nucleotide (HEPN) binding domains and does not require a protospacer flanking sequence (PFS), thus giving target sequence recognition superior flexibility. This makes Cas13d show great potential in gene knockdown, antiviral defense of cells and animals, and recently, virus detection. However, when using the CRISPR / Cas system alone for pathogen detection, due to its low sensitivity, it is usually necessary to combine a nucleic acid pre-amplification step to improve the detection effect. Summary of the invention

[0005] The present invention provides a crRNA for detecting African swine fever virus using CRISPR-Cas13d technology, and the sequence of the crRNA molecule is shown in SEQ ID NO.11.

[0006] The present invention also provides a product for detecting African swine fever virus using CRISPR-Cas13d technology, wherein the product contains the above-mentioned crRNA molecule.

[0007] Preferably, the product is a reagent or a kit.

[0008] More preferably, the reagent or kit also contains Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

[0009] More preferably, the sequences of the upstream primer and the downstream primer are shown as SEQ ID NO. 2 and 5, respectively.

[0010] The present invention also provides the use of the above-mentioned crRNA molecules in the preparation of products for detecting African swine fever virus.

[0011] Preferably, the product is a kit.

[0012] More preferably, the kit also contains Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

[0013] More preferably, the method for using the kit is as follows:

[0014] (1) Using the DNA of the sample to be tested as a template to amplify the product, and transcribe in vitro to obtain ssRNA;

[0015] (2) reacting the ssRNA, Cas13d protein, ssRNA fluorescent reporter probe, and crRNA molecule obtained in step (1) in a CRISPR-Cas13d reaction system;

[0016] (3) After the reaction in step (2) is completed, the reaction system is placed under blue light or ultraviolet light to observe the detection results.

[0017] More preferably, the amplification in step (1) adopts a recombinase polymerase nucleic acid amplification method.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention combines nucleic acid extraction-free technology, isothermal amplification technology and CRISPR / Cas system to develop a rapid, sensitive, on-site instant detection method suitable for ASFV. First, the target sequence is amplified using isothermal amplification (RAA) technology, and then combined with the CRISPR-Cas13d system for specific identification and signal amplification. This method has both high sensitivity and high specificity. In addition, the present invention introduces a rapid nucleic acid extraction method and a diversified result display technology to simplify the detection process and improve detection efficiency, overcome the problem of complex steps in the current commercial nucleic acid extraction kit, and further promote its application potential in on-site instant detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the expression diagram of Cas13d protein in Example 1, wherein A is the SDS-PAGE protein verification result; B is the Western Blot protein verification result.

[0021] Figure 2 This is the RAA primer screening result in Example 1.

[0022] Figure 3 This is the result of verifying the activity of Cas13d protein in Example 1.

[0023] Figure 4 It is the screening result of crRNA in Example 1.

[0024] Figure 5 These are the test results of different samples in Example 1.

[0025] Figure 6 The visualization results of the detection method in Example 1, wherein A is the visualization observation result under ultraviolet light; B is the visualization result of the lateral flow test strip, 1 is tissue sample 1, 2 is tissue sample 2, 3 is liquid sample 1, 4 is liquid sample 2, and 5 is a negative control.

[0026] Figure 7 The sensitivity verification results in Example 1, wherein A is the visualization sensitivity test result under ultraviolet light, and N is the negative control; B is the visualization sensitivity result of the lateral flow test strip, and N is the negative control.

[0027] Figure 8 The specific detection results in Example 1, wherein A is the specific detection result visualized under ultraviolet light; and B is the specific visualization detection result of the lateral flow test strip. DETAILED DESCRIPTION

[0028] Example 1

[0029] Table 1 Instrument information

[0030] name model factory Fluorescence quantitative PCR instrument A51693 Thermo Fisher metal bath H2O3-96 Kayoudi Biotechnology (Beijing) Co., Ltd. Micro Volume UV-Vis Spectrophotometer 840-317400 Thermo Fisher Scientific

[0031] Table 2 Reagent information

[0032]

[0033]

[0034] Trial Design and Results

[0035] 1. Expression of EsCas13d protein

[0036] The purchased EsCas13d plasmid (pET28a-MH6-EsCas13d) dry powder was diluted according to the instructions, and the diluted EsCas13d plasmid was transformed into B21 competent cells, coated on a solid culture medium plate containing kanamycin (Kana), cultured at 37 ° C, and positive clones were screened. Select positive clones, expand the culture, inoculate the verified bacterial solution into 300ml LB medium at a ratio of 1:100, and culture on a 37 ° C constant temperature shaker until the bacterial solution OD 600nm value reaches 0.4-0.6, add IPTG at a final concentration of 1mM to induce protein expression, adjust the temperature to 18 ° C, and continue to culture on a 180rpm shaker for 18 hours, then transfer the bacterial solution to a 50ml centrifuge tube, centrifuge at 10000rpm for 15 minutes at 4 ° C, and collect the precipitated cells. Resuspend the precipitated cells with an equal volume of PBS, wash by centrifugation, repeat 3 times, resuspend the concentrated bacteria with PBS to 30 ml, add lysozyme and protease inhibitor PMSF at a ratio of 1:100, mix well, use an ultrasonic probe (ф6), ultrasonically disrupt at 30% power, ultrasonic for 2 seconds, 4 seconds interval, total time of 40 minutes, use His tag protein purification kit to purify and concentrate the protein in the disrupted cell lysate, measure the concentration of the purified protein sample, and detect the size and expression of the protein by SDS-PAGE. At the same time, use Western Blot for protein verification, and use His tag antibody as the primary antibody for detection. The SDS-PAGE and Western Blot verification results are shown as follows: Figure 1 shown.

[0037] 2. Design and synthesis of RAA primers and crRNA

[0038] According to the highly conserved region of the ASFV virus P72 gene, 3 upstream and 3 downstream primers were designed. The upstream primers and downstream primers were arranged and combined to amplify 9 primer pairs. These 9 pairs of primers were used for RAA amplification with the same template to test their amplification efficiency, and the best primer pair was selected for subsequent experiments. The primer sequences are shown in Table 3. Three crRNAs were designed in the conserved region amplified by the best primer pair, and 3 gDNAs were designed according to the crRNA sequence for in vitro transcription into crRNA.

[0039] The three gDNA sequences are:

[0040] gDNA1 (SEQ ID NO. 8): TTAATCCAGAGCGCAAGAGGGGCTGATGTT TTAGACCCCTGCAATTTTGCACGGGTGCCCTATAGTGAGTCGTATTA;

[0041] gDNA2 (SEQ ID NO. 9): CTGATAGTATTTAGGGGTTTGAGGTCCAGTTT TAGACCCCTGCAATTTTGCACGGGTGCCCTATAGTGAGTCGTATTA;

[0042] gDNA3 (SEQ ID NO. 10): CCATTACAGCTGTAATGAACATTACGTCGTT TTAGACCCCTGCAATTTTGCACGGGTGCCCTATAGTGAGTCGTATTA.

[0043] The corresponding three crRNAs are:

[0044] crRNA1 (SEQ ID NO. 11): CACCCGUGCAAAAUUGCAGGGGUCUAAAACATCAGCCCCCTCTTGCGCTCTGGATTAA;

[0045] crRNA2 (SEQ ID NO. 12): CACCCGUGCAAAAUUGCAGGGGUCUAAAACTGGACCTCAAACCCCTAAATACTATCAG;

[0046] crRNA3 (SEQ ID NO. 13): CACCCGUGCAAAAUUGCAGGGGUCUAAAACGACGTAATGTTCATTACAGCTGTAATGG.

[0047] Table 3 Primers and gDNA sequences

[0048]

[0049] 3. RAA primer screening and construction of standard positive plasmid

[0050] Use the RAA nucleic acid amplification kit, take the positive DNA as the template, select the primers in Table 3 for RAA amplification, select the most suitable pair of primers according to the amplification results, the reaction program is 37℃, 30min, after the reaction is completed, take 5μL for agarose gel electrophoresis, the results are as follows Figure 2 The results showed that the RAA primer combination RAA-2F / 2R had the highest amplification efficiency and the least non-specific products, so this RAA primer combination was selected for subsequent experiments.

[0051] According to the instructions, 2×Rapid Taq Master Mix was used to perform PCR amplification with positive DNA, and the upstream and downstream primers were RAA-2F / 2R. Then, according to the instructions, the amplified DNA was purified using a universal DNA purification and recovery kit. According to the instructions, the purified product was connected to pMD TM 19 (Simple), according to the DH5α manual, the ligation product was transformed into DH5α competent cells, and finally the single clone was selected and placed in LB containing ampicillin resistance. The bacterial solution was verified by PCR, and the positive bacterial solution was extracted with a plasmid extraction kit. The plasmid was extracted and the concentration was measured with a micro-UV-Vis spectrophotometer as a standard positive plasmid (pMD-19T-ASFV) and frozen for later use.

[0052] 4. Protein activity verification and crRNA screening

[0053] 4.1 Target RNA preparation

[0054] The RAA amplification product was purified using a universal DNA purification and recovery kit, and the purified product was transcribed into target ssRNA. According to the instructions, a high-yield T7 RNA in vitro transcription kit was used for in vitro transcription at 37°C for 4 hours, and RNase-free DNase I was used to degrade the excess DNA template, and then a column RNA purification kit was used for purification. After purification and concentration determination, the product was aliquoted and stored at -80°C.

[0055] 4.2crRNA Preparation

[0056] The three gDNAs were mixed with T7 promoter in equal volumes to a final concentration of 10 μM. The mixture was placed in a metal bath at 95°C for 10 minutes and then placed at room temperature for 30 minutes. The product was transcribed into crRNA in vitro and purified using a column RNA purification kit. After purification and concentration determination, it was aliquoted and stored at -80°C.

[0057] 4.3 Protein activity verification and crRNA screening

[0058] The composition of 2×Cas13d buffer is as follows: 80 mM HEPES pH 7.1, 200 mM KCl, 20 mM MgCl2 and 10% glycerol. A 20 μL reaction system is prepared, and the system composition is shown in Table 4.

[0059] Table 4 Cas13d protein activity verification system

[0060]

[0061]

[0062] In addition, three controls were set up, which lacked Cas13d protein, crRNA and ssRNA templates, and then replaced with RNase free water. The reaction with all components was named Reaction 1, and the other reactions were named Reaction 2, Reaction 3, and Reaction 4. The fluorescence values ​​were read using a fluorescence quantitative PCR instrument. The experimental results showed that only Reaction 1 had a fluorescence value while the others did not ( Figure 3 ).

[0063] To verify which of the three crRNAs has the best effect, three reactions were run under the same conditions for each of the three crRNAs as three replicates, and then the fluorescence values ​​were read. Figure 4 As shown, crRNA1 has the highest amplification efficiency. Therefore, crRNA1 is selected as the subsequent crRNA.

[0064] 5. Establishment of African swine fever virus detection method based on rapid nucleic acid release, RAA and CRISPR / Cas13d technology

[0065] 5.1 Establishment of detection method

[0066] According to the instructions of the rapid nucleic acid releaser (DNA type)-II, nucleic acids were extracted from four positive samples and two negative samples: 16μLD-1 and 4μLD-2 were added to 100μL of liquid samples (serum, blood, saliva, ascites, swab extract, etc.), and tissue samples such as brain and muscle were added to PBS and ground, centrifuged at 12000rpm and 4℃ for 10min, then 100μL of the supernatant was taken, 16μLD-1 and 4μLD-2 were added, and lysed on a metal bath at 37℃ for 5min, 5μL of the supernatant of the lysate was taken as a template and directly used for RAA amplification reaction. The RAA amplification system was reacted according to the instructions. After the reaction, 5μL of the reaction product was taken for in vitro transcription. The in vitro transcription product was purified and concentrated using a column-type RNA rapid concentration and purification kit, and then reacted according to the reaction system in Table 4. The samples were placed on a qPCR instrument and tested at 37℃ for 30min. Two tissue samples and two liquid samples were tested. The test results are as follows Figure 5 .

[0067] 5.2 Portability and visualization of detection methods

[0068] According to the steps in 5.1, after the reaction system is added, place the system in the metal bath for 30 minutes, then observe under blue light / ultraviolet light to detect whether it is luminescent. At the same time, add RNase free water to the reaction solution to 50μL and then drop it onto the lateral flow test strip. The results show that after the system reacts on the metal bath for 30 minutes, it can be observed under blue light / ultraviolet light that the fluorescence visible to the right eye can be observed. At the same time, the lateral flow test strip has obvious bands on the test line, while the negative has neither fluorescence nor bands at the test line. Figure 6 .

[0069] 5.3 Sensitivity of the detection method

[0070] The positive plasmid pMD-19T-ASFV was quantified and diluted 10-fold to prepare a template concentration of 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 The copy number was 10. 0 The number of copies / μL can still be visualized. For specific results, see Figure 7 .

[0071] 5.4 Specificity of the detection method

[0072] Rapid nucleic acid releaser (DNA type)-II or rapid nucleic acid releaser (RNA type)-II was used to validate the specificity of the reaction system for ASFV, porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV), classical swine fever virus (CSFV), Japanese encephalitis virus (JEV), porcine parvovirus (PPV) and porcine transmissible gastroenteritis (TGEV) positive sample genomes (provided by the Biotechnology Center of Sichuan Agricultural University), in combination with negative controls (without nucleic acid template). The specific results are shown in Figure 8 The results showed that only ASFV was positive while the others were negative, indicating that this method has good specificity.

[0073] 5.5 Clinical sample testing

[0074] In addition to the positive samples used in 5.2, 18 clinical samples were tested for ASFV, using the qPCR method in the national standard as a control. The test results showed that the positive rate detected was consistent with the national standard qPCR test results.

[0075] 6. Summary

[0076] There are many methods for detecting RAA and CRISPR-Cas13a at present. Most methods and nucleic acid extraction are based on commercial extraction kits, which affects the clinical instant detection of the entire method at the step of nucleic acid extraction. Cas13a prefers poly U / AU (LwCas13a) when cleaving non-target RNA, which limits its application. Compared with CRISPR-Cas13a, CRISPR-Cas13d, as a newly discovered protein in the Cas13 series, has many advantages: the protein is smaller and easier to purify and concentrate, and it has no preference for poly U / AU when cleaving non-target RNA. At present, diagnosis based on CRISPR-Cas13d is still in its infancy. This patent is the first to use rapid nucleic acid extraction, isothermal amplification and CRISPR-Cas13d for the detection of African swine fever. The primer pair of RAA is screened based on the highly conserved region of African swine fever, and the primer amplification efficiency is high. At the same time, the crRNA with high recognition efficiency is screened. This technology innovatively combines nucleic acid-free extraction technology, RAA isothermal amplification technology and CRISPR / Cas13d recognition and cutting technology to develop a portable and visual nucleic acid detection platform. The nucleic acid-free extraction technology can quickly release nucleic acids from samples without relying on complex test kits; the RAA isothermal amplification technology performs isothermal amplification on the released nucleic acids, which improves the detection sensitivity and speed; finally, the CRISPR / Cas13d system amplifies the recognition signal while identifying the target gene, further improving the accuracy and specificity of the detection. The design of the platform enables it to achieve instant detection on site, greatly improving the detection efficiency, overcoming the dependence of traditional detection on laboratories, and by quickly and accurately identifying pathogens, farmers can take prevention and control measures in time to reduce the incidence and economic losses of major epidemics, and provide strong support for the sustainable development of the pig farming industry and food safety. The primers and crRNA of the present invention have strong specificity and good sensitivity, and the invented test kit is simple to operate, fast to detect, and visualized results, so that the method for detecting ASFV based on RAA and CRISPR-Cas13d technology established by the present invention can be used for on-site visualization detection of ASFV, thereby providing technical means for improving the level of ASFV detection in the pig farming industry and reducing the biosafety risks of farms.

[0077] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for detecting crRNA of African swine fever virus using CRISPR-Cas13d technology, characterized in that: The sequence of the crRNA molecule is shown in SEQ ID NO.

11.

2. A product for detecting African swine fever virus using CRISPR-Cas13d technology, characterized in that: The product contains the crRNA molecule described in claim 1.

3. The product according to claim 2, characterized in that The product is a reagent or a kit.

4. The product according to claim 3, characterized in that The reagent or kit also contains Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

5. The product according to claim 4, characterized in that The sequences of the upstream primer and the downstream primer are shown as SEQ ID NO. 2 and 5 respectively.

6. Use of the crRNA molecule described in claim 1 in the preparation of a product for detecting African swine fever virus.

7. The use according to claim 6, characterized in that: The product is a test kit.

8. The use according to claim 7, characterized in that: The kit also contains Cas13d protein, ssRNA fluorescent reporter probe, and upstream primers and downstream primers for recombinase polymerase nucleic acid amplification.

9. The use according to claim 8, characterized in that: The method of using the kit is as follows: (1) Using the DNA of the sample to be tested as a template to amplify the product, and transcribe in vitro to obtain ssRNA; (2) reacting the ssRNA, Cas13d protein, ssRNA fluorescent reporter probe, and crRNA molecule obtained in step (1) in a CRISPR-Cas13d reaction system; (3) After the reaction in step (2) is completed, the reaction system is placed under blue light or ultraviolet light to observe the detection results.

10. The use according to claim 9, characterized in that: The amplification in step (1) adopts a recombinase polymerase nucleic acid amplification method.

Images