A functional molecular marker for rapid identification of largemouth bass resistant to rhabdovirus and its application

Abstract

This invention relates to the field of molecular marker breeding technology, and more particularly to a functional molecular marker for rapid identification of largemouth bass resistant to rhabdovirus and its application. This invention develops a functional molecular marker that identifies significantly different molecular markers by resequencing the genomes of resistant and susceptible individuals. Specific primers were designed, and combined with PCR amplification and agarose gel electrophoresis, successfully distinguishing between resistant and susceptible individuals. In the experiment, largemouth bass fry were challenged with rhabdovirus through artificial infection to identify the susceptible group (SL) and the resistant group (RL). RNA extraction and qPCR were used to detect differences in viral load, and PCR amplification and gene sequencing analysis were performed on resistant and susceptible individuals to verify the accuracy of the functional marker. The amplification products of resistant and susceptible individuals were single bands of 1273 bp and 1134 bp, respectively, showing significant genetic differences and providing technical support for rapid screening of resistant individuals.

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to a functional molecular marker for rapid identification of largemouth bass resistant to rhabdovirus and its application. Background Technology

[0002] Largemouth bass ( Micropterus salmoides Largemouth bass, also known as California bass, has rapidly become an important freshwater aquaculture species due to its strong adaptability, rapid growth, short breeding cycle, delicious meat, and lack of intramuscular bones. However, with the continuous expansion of aquaculture scale, the genetic degradation and disease problems of largemouth bass have become increasingly serious, especially those caused by rhabdovirus (Rhinovirus). Micropterus salmoides Viral diseases caused by rhabdovirus (MSRV) have become one of the main factors restricting industrial development.

[0003] MSRV virus is a highly pathogenic agent, particularly deadly to fish fry (2-5 cm in total length). Infection can cause discoloration, lethargy, abnormal swimming, and abdominal swelling, ultimately leading to a mortality rate exceeding 90%. MSRV is highly contagious and particularly prevalent during periods of rapid water temperature change (such as April-May and October-November). Currently, there are no effective drugs or vaccines against this virus; control relies mainly on antibiotics and environmental management. However, antibiotic overuse can lead to increased bacterial resistance and negatively impact aquatic ecosystems. In aquaculture, disease-resistant breeding has become a crucial strategy for improving efficiency and reducing losses. Traditional phenotypic selection methods rely on long-term observation and breeding experiments, which are highly susceptible to environmental interference and have low efficiency. Marker-assisted selection (MAS) provides technical support for rapid and efficient disease-resistant breeding through precise screening of disease-related gene loci.

[0004] In recent years, domestic and international research has utilized SNP technology to screen for disease resistance markers in various fish species. For example, the applicant's Chinese invention patent application (CN118910289A, publication number: 2024-10-09) also discloses a molecular marker primer for rapidly identifying heat-resistant individuals of largemouth bass. This molecular marker consists of a forward primer and a reverse primer. The forward primer P1-F sequence is CTACACACCAGTAAAGAGGCAGG, and the reverse primer P1-R sequence is CTTCTGTATCCATTGGCTTCTGC. PCR amplification using molecular marker primers can accurately distinguish between heat-resistant and heat-intolerant largemouth bass individuals. This method is faster, more accurate, and lower in cost, enabling rapid identification and screening of heat-resistant largemouth bass individuals at an early stage, improving breeding efficiency, and accelerating the breeding process of heat-resistant largemouth bass.

[0005] Furthermore, Chinese invention patent applications (publication numbers: CN117965755A, CN118127178A, CN117947179A) have developed efficient and stable molecular markers around SNP (single nucleotide polymorphism) sites related to MSRV resistance, and established a method for rapidly screening disease-resistant individuals. Through PCR amplification and high-resolution melting curve (HRM) genotyping technology, the disease-resistant genotype of largemouth bass can be accurately identified, providing an important technical means for achieving disease-resistant breeding and improving the quality of largemouth bass varieties.

[0006] Despite significant progress in marker-assisted breeding for disease resistance in largemouth bass, SNP markers suffer from low polymorphism, complex detection methods, high costs, and limited applicability. InDel (insertion / deletion) markers, on the other hand, typically exhibit significant length variations due to base insertions or deletions, making them suitable for MAS breeding. They offer advantages in terms of ease of operation, cost, and polymorphism, especially under standard laboratory conditions for rapid detection. This invention addresses the lack of InDel molecular markers in largemouth bass and the need for disease resistance breeding by developing a comprehensive molecular marker identification and screening system, providing a scientific basis and practical tool for achieving green and healthy largemouth bass aquaculture. Summary of the Invention

[0007] To address the aforementioned technical challenges, this invention develops a functional molecular marker for rapid screening of disease-resistant individuals. Furthermore, through genome resequencing of disease-resistant and susceptible individuals, significantly different molecular markers were identified. Specific primers were designed, and combined with PCR amplification and agarose gel electrophoresis, successfully distinguishing between disease-resistant and susceptible individuals. During the experiment, rhabdovirus challenge experiments were conducted on largemouth bass fry using artificial infection methods to identify the susceptible group (SL) and the disease-resistant group (RL). RNA extraction and qPCR were used to detect differences in viral load, and PCR amplification and gene sequencing analysis were performed on disease-resistant and susceptible individuals to verify the accuracy of the functional marker. The amplification products for disease-resistant and susceptible individuals were single bands of 1273 bp and 1134 bp, respectively, showing significant genetic differences and providing technical support for rapid screening of disease-resistant individuals.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A functional molecular marker for rapid identification of largemouth bass resistant to rhabdovirus is provided. The functional molecular marker includes a susceptible type and a resistant type. The nucleotide sequence of the susceptible molecular marker is shown in SEQ ID NO:1, and the nucleotide sequence of the resistant molecular marker is shown in SEQ ID NO:2.

[0010] Furthermore, the present invention also provides primers for identifying the aforementioned functional molecular markers.

[0011] Preferably, the primer consists of a forward primer and a reverse primer, with the forward primer D1-F sequence being GCAGATCCTCAACATGCTGCTG and the reverse primer D1-R sequence being CAGGACAGTCAAGGACAGTGAG.

[0012] Furthermore, the present invention also provides a kit comprising the aforementioned primers.

[0013] Furthermore, the present invention also provides the application of the aforementioned functional molecular markers, primers, or kits in the rapid identification of largemouth bass resistant to rhabdovirus.

[0014] Furthermore, the present invention also provides the application of the aforementioned functional molecular markers, primers, or kits in the breeding of largemouth bass resistant to rhabdovirus.

[0015] Furthermore, the present invention also provides a method for rapidly identifying largemouth bass resistant to rhabdovirus, the method comprising the following steps:

[0016] 1) Extract DNA from largemouth bass;

[0017] 2) The molecular marker primers described above were used to amplify the DNA of largemouth bass by PCR. After the PCR amplification was completed, agarose gel electrophoresis was used for detection. Individuals with the nucleotide sequence shown in SEQ ID NO:1 in the amplification product were susceptible individuals, and individuals with the nucleotide sequence shown in SEQ ID NO:2 in the amplification product were disease-resistant individuals.

[0018] As a preferred option, the PCR reaction system is as follows: 10 μL of 2×Taq PCR mix; 8 μL of Depc H2O; 1 μL of DNA template; and 0.5 μL each of forward and reverse primers.

[0019] As a preferred method, the PCR reaction program is as follows: 95℃ - 5 min; 94℃ - 30 s; 72℃ - 90 s; 35 cycles; extension at 72℃ for 8 min, followed by storage at 4℃.

[0020] Furthermore, the present invention also provides the application of the method in the breeding of largemouth bass resistant to rhabdomyovirus.

[0021] By employing the above-mentioned technical solution, this invention provides a functional molecular marker for largemouth bass resistant to rhabdovirus and its application method, overcoming the limitations of traditional disease-resistant breeding methods, such as long breeding cycles, low efficiency, and susceptibility to environmental factors, and significantly improving the efficiency and accuracy of disease-resistant population selection.

[0022] The technical effects of this invention are reflected in the following aspects:

[0023] 1. Rapid and accurate screening of disease-resistant individuals

[0024] By developing functional molecular markers (D1-F / D1-R primers), combined with PCR amplification and agarose gel electrophoresis, it is possible to efficiently distinguish between disease-resistant (1273bp) and susceptible (1134bp) individuals of largemouth bass. Compared with traditional phenotypic selection, this invention can significantly reduce breeding time, avoid screening errors caused by environmental factors, and ensure the accuracy of screening.

[0025] 2. Improve the efficiency of disease-resistant breeding populations.

[0026] This invention uses molecular marker-assisted breeding (MAS) as its core technology, providing an efficient and stable screening tool for the complex traits of rhabdovirus infection. This significantly accelerates the construction of disease-resistant largemouth bass populations, shortens the breeding cycle, and meets the market's urgent demand for high-quality seedlings.

[0027] 3. Optimize the utilization of breeding resources

[0028] The disease-resistant individuals screened using this invention can be used as parents for disease-resistant breeding of largemouth bass, avoiding the germplasm degradation problem caused by inbreeding. This further improves the utilization rate of breeding resources and lays the foundation for establishing genetically stable populations with strong disease resistance.

[0029] 4. Improve the economic benefits of aquaculture.

[0030] The application of this invention can effectively reduce mortality and breeding losses caused by rhabdovirus infection, reduce the use of antibiotics from the source, reduce breeding costs, and provide technical support for green and healthy breeding, with significant economic and ecological benefits.

[0031] In summary, this invention, with molecular markers as its core, achieves the rapid construction of disease-resistant populations through precise and efficient screening of disease-resistant individuals. It provides reliable technical support for the genetic improvement and industrial upgrading of largemouth bass, and has significant application value and promising prospects for promotion. Attached Figure Description

[0032] Figure 1 To screen molecular markers for largemouth bass resistant to rhabdovirus (resistant type - 1273bp, susceptible type - 1134bp).

[0033] Figure 2 Comparative analysis of gene sequencing for disease-resistant and susceptible largemouth bass. Detailed Implementation

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the protection scope of the present invention.

[0035] I. Experimental Methods

[0036] 1. Largemouth bass challenge experiment with rhabdovirus

[0037] In mid-April, 600 largemouth bass fry (2-4 cm in total length) were collected and temporarily raised in the laboratory for one week before undergoing a rhabdovirus challenge experiment. 300 fish were randomly selected as the experimental group, and the remaining 300 as the control group. Feeding was stopped two days before the experiment. Artificial infection of the largemouth bass was achieved through virus immersion. Before the experiment, the 300 experimental fish were placed in 100L plastic tanks and irradiated with 1×10⁻⁶ virus. 5 A challenge experiment was conducted using MSRV (Multiple MSRV) at a concentration of 25°C and dissolved oxygen >5 mg / L for 4 hours. After challenge, the experimental fish were placed in new, recirculating tanks for normal rearing, and fed small amounts of feed every two days. The control group was also reared using the same method.

[0038] Fish were cultured for 1-3 days in the experimental group. Those exhibiting obvious spinning, darkening of body color, and bleeding from the gills and tail were collected as the susceptible group (SL). Individuals surviving 7 days after infection were designated as the resistant group (RL). During the infection period, liver tissue from SL individuals was rapidly collected and preserved in liquid nitrogen, then stored at -80°C for RNA extraction. Tail fins were collected and preserved in 95% ethanol at -20°C for DNA extraction. Liver tissue from RL individuals was collected after the experiment and preserved using the same method.

[0039] 2. Detection of viral load in largemouth bass challenged with rhabdovirus

[0040] RNA was extracted from liver tissues of SL and RL cells using Trizol, and RNA quality was assessed using spectrophotometry and agarose gel electrophoresis. After the extracted RNA passed the quality assessment, it was reversed using a cDNA reverse assay kit, and viral load was then detected using qPCR.

[0041] 3. Individual weight sequencing of largemouth bass anti-lavian virus

[0042] Ten tail fins of largemouth bass with high viral loads (susceptible SL and resistant AL types) were sent to Shanghai Meiji Biotechnology Co., Ltd. for genome resequencing analysis. Based on the analysis of susceptible and resistant types, a specific primer, D1, was developed. This primer can accurately distinguish between resistant and susceptible largemouth bass, which will be beneficial for screening individuals resistant to rhabdovirus and for constructing a largemouth bass population.

[0043] 4. Screening of individual molecular markers against bluemouth bass resisting reflex virus

[0044] 4.1 PCR amplification and gel electrophoresis detection

[0045] D1-F: GCAGATCCTCAACATGCTGCTG

[0046] D1-R: CAGGACAGTCAAGGACAGTGAG

[0047] Using the functional markers developed in this invention, PCR amplification was performed on DNA samples from resistant and susceptible largemouth bass, respectively. The PCR reaction system was as follows: 10 μL of 2× Taq PCR mix; 8 μL of Depc H2O; 1 μL of DNA template; MF / -R: 0.5 μL / 0.5 μL. The reaction program was: 95℃ - 5 min; 94℃ - 30 s; 72℃ - 90 s; 35 cycles; extension at 72℃ for 8 min, followed by storage at 4℃. After PCR amplification, the results were detected by 2% agarose gel electrophoresis at V-120V, A-400mA, T-100min.

[0048] II. Results Analysis

[0049] PCR amplification and agarose gel electrophoresis were performed on 18 largemouth bass samples of resistant and susceptible types, respectively. The results showed that the resistant and susceptible individuals were single bands, with sizes of 1273 bp (nucleotide sequence as shown in SEQ ID NO:2) and 1134 bp (nucleotide sequence as shown in SEQ ID NO:1), respectively.

[0050] III. Sequencing Analysis

[0051] The SanPrep column DNA gel extraction kit (Sangon Biotech, Shanghai) was used to extract DNA from the gel. Figure 1 The obtained resistant (1273bp) and susceptible (1134bp) bands were gel-cut and recovered. After confirming the concentration was within acceptable limits, they were ligated into the pESI-T vector, transformed into DH5α competent cells, and positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results are as follows: Figure 2As shown, RL represents the 1273bp band, and SL represents the 1134bp band of the male.

[0052] IV. Experimental Examples

[0053] 1. Experimental Objective

[0054] To verify the practical application effect of the functional molecular markers of the present invention, and to demonstrate their high efficiency, accuracy and actual breeding effect in the rapid screening of largemouth bass resistant to rhabdovirus.

[0055] 2. Experimental Design

[0056] 2.1 Experimental Groups

[0057] Experimental group (method of this invention): Using the functional molecular markers developed in this invention, combined with PCR amplification and agarose gel electrophoresis, individuals with disease resistance (1273bp) and susceptibility (1134bp) were screened;

[0058] Control group 1 (traditional phenotypic selection): Disease-resistant individuals were screened by observing the survival phenotype through artificial challenge experiments;

[0059] Control group 2 (randomly selected): The same number of individuals were randomly selected as the disease-resistant group.

[0060] 2.2 Experimental Materials

[0061] Experimental fish fry: 900 healthy, uniformly sized (2-4 cm) largemouth bass fry. MSRV (Multiple Molecular Rhabdovirus): Concentration 1×10⁻⁶ 5 copies / mL.

[0062] Testing materials and instruments:

[0063] PCR kits, Trizol reagent, agarose gel electrophoresis reagent, etc. Experimental equipment: qPCR instrument, gel electrophoresis system, etc.

[0064] 2.3 Experimental Methods

[0065] Screening of functional molecular markers (experimental group)

[0066] DNA was extracted from the tail fin of largemouth bass; PCR amplification was performed using D1-F / D1-R primers; the amplification products were detected by agarose gel electrophoresis to distinguish between the resistant type (1273bp) and the susceptible type (1134bp).

[0067] Traditional phenotypic selection (control group 1)

[0068] Seedlings were artificially challenged with the virus (25℃, 4 hours of virus exposure), observed for 7 days, and surviving individuals were identified as disease-resistant.

[0069] Random selection (control group 2)

[0070] There are no specific screening criteria; individuals are randomly selected as the disease-resistant group.

[0071] Subsequent experimental verification

[0072] Disease resistance test: The selected disease-resistant individuals were artificially challenged again, and the survival rate was calculated.

[0073] Growth performance test: Disease-resistant individuals selected from each group were raised for 60 days, and the average body length and weight gain were measured.

[0074] Genetic stability analysis: The offspring of the selected disease-resistant individuals were tested for disease resistance using the same screening method.

[0075] 3. Data Recording and Analysis

[0076] 3.1 Screening efficiency

[0077] Record the time and cost required to screen 100 disease-resistant individuals in each group.

[0078] Experimental group: PCR amplification and electrophoresis detection time was relatively short.

[0079] Control group 1: Phenotypic observation requires 7 days, and the challenge experiment affects environmental costs.

[0080] Control group 2: No scientific basis for selection, shortest time but high randomness.

[0081] 3.2 Screening Accuracy

[0082] The disease-resistant individuals selected from each group were challenged again, and their survival rates were compared.

[0083] 3.3 Disease resistance

[0084] The disease resistance (survival rate) and viral load (detected by qPCR) of the disease-resistant population were compared after screening.

[0085] 3.4 Growth performance

[0086] After 60 days of rearing, the average body length and weight gain of each disease-resistant individual were recorded to assess the growth potential of the disease-resistant individuals.

[0087] 3.5 Genetic stability

[0088] The disease resistance and genotype distribution of offspring from screened disease-resistant individuals were determined to assess genetic stability.

[0089] 4. Experimental Data

[0090] 4.1 Screening efficiency

[0091] Group Filtering methods Time required to screen 100 disease-resistant individuals experimental group Molecular marker screening in this invention 2 hours Control group 1 Phenotypic selection (challenge and observation) 7 days Control group 2 Random selection 0.5 hours

[0092] Results analysis:

[0093] The experimental group had a significantly shorter screening time (approximately 1 / 84th that of control group 1) and lower costs than traditional phenotypic selection. While control group 2 had a shorter screening time, it lacked scientific basis for selection, making it difficult to guarantee effectiveness.

[0094] 4.2 Screening Accuracy

[0095] Group Survival rate of resistant strains after reinfection (%) experimental group 92 Control group 1 73 Control group 2 45

[0096] Results analysis:

[0097] The disease-resistant individuals selected in the experimental group showed significantly higher survival rates. Control group 1 was affected by phenotypic observation errors, resulting in lower accuracy compared to the experimental group. Control group 2's performance was nearly randomized and could not meet practical needs.

[0098] 4.3 Disease resistance

[0099] 4.3.1 Viral load (qPCR detection)

[0100] Group Viral load (copes / μL, average) experimental group <![CDATA[1.2 × 10 3 ]]> Control group 1 <![CDATA[3.4 × 10 3 ]]> Control group 2 <![CDATA[8.9 × 10 3 ]]>

[0101] Results analysis:

[0102] The experimental group had the lowest viral load, indicating the strongest disease resistance.

[0103] 4.3.2 Survival rate

[0104] Group Survival rate (%) after a second viral challenge experimental group 90 Control group 1 68 Control group 2 42

[0105] 4.4 Growth performance

[0106] Group Average body length increase (cm) Average weight gain (g) experimental group 12.5 49.7 Control group 1 11.6 48.2 Control group 2 11.2 47.6

[0107] Results analysis:

[0108] The experimental group of disease-resistant individuals showed significantly better growth rates than the control group, demonstrating higher breeding potential.

[0109] 4.5 Genetic stability

[0110] Proportion of disease-resistant offspring

[0111] Group Proportion of disease-resistant offspring (%) experimental group 89 Control group 1 74 Control group 2 40

[0112] 5. Experimental Conclusions

[0113] The molecular marker screening method of this invention exhibits higher screening efficiency (80% reduction in time) and lower cost (30% reduction). The selected disease-resistant individuals show significantly better performance than the control group in terms of disease resistance (viral load, survival rate) and growth performance (body length, weight gain). The high proportion of disease-resistant offspring and good genetic stability provide a scientific basis for constructing disease-resistant populations. Comprehensive verification demonstrates that this invention possesses significant technical advantages in disease-resistant breeding and has widespread application value.

[0114] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.

Claims

1. Primers for rapid identification of largemouth bass Micropterus salmoides Anti-bulbar virus Micropterus salmoides rhabdovirus In the application of individual products, the primers consist of a forward primer and a reverse primer, with the forward primer D1-F sequence being GCAGATCCTCAACATGCTGCTG and the reverse primer D1-R sequence being CAGGACAGTCAAGGACAGTGAG.

2. A kit containing the primers described in claim 1 for the rapid identification of largemouth bass. Micropterus salmoides Anti-bulbar virus Micropterus salmoides rhabdovirus Applications in individual products.

3. The primers of claim 1 or the kit of claim 2 in the preparation of largemouth bass Micropterus salmoides Anti-bulbar virus Micropterus salmoides rhabdovirus Applications in breeding products.

Images