Breeding method of Dai-qu stock pseudosciaena crocea fry capable of resisting shield ciliate disease

Abstract

The invention provides a method for breeding Dai-qu stock pseudosciaena crocea fries capable of resisting shield ciliate disease, which comprises the following steps of: screening molecular markers linked with disease resistance characters by analyzing a shield ciliate disease susceptible group and a shield ciliate disease resistant group of Dai-qu stock pseudosciaena crocea, and screening individuals as parents by using the screened molecular markers; the method is used for breeding Dai-qu stock pseudosciaena crocea fries capable of resisting the shield ciliate disease. The molecular marker is an SNP (Single Nucleotide Polymorphism) site related to the characteristic of the Dai-qu stock pseudosciaena crocea for resisting the shield ciliate disease, and the SNP molecular marker is positioned at the 214 site of a nucleic acid fragment with the sequence of SEQ ID NO: 1 and is G / A replacement. The SNP related to the resistance to the shield ciliate disease of the Dai-qu stock pseudosciaena crocea obtained through screening is used for screening parents for resisting the shield ciliate disease, so that the genetic breeding speed of the Dai-qu stock pseudosciaena crocea is increased, and the harm of the shield ciliate disease to Dai-qu stock pseudosciaena crocea culture is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of seed and seedling cultivation of aquatic species, and specifically relates to a method for cultivating seedlings of Daiqu tribe large yellow croaker resistant to shield ciliate disease. Background Art

[0002] Large yellow croaker (Larimichthys crocea), also known as yellow croaker, cucumber fish, and golden dragon, is a fish of the genus Larimichthys of the family Sciaenidae in the order Perciformes. It is mainly distributed in the northwest Pacific Ocean and is distributed along the coast of China. The fishing season is divided into spring and autumn. The spring season is generally from April to June, and the fishing grounds are concentrated in the spawning areas near the coast of Jiangsu, Zhejiang, and Fujian; the autumn season is formed in the northern sea area of ​​Zhejiang between September and October. Large yellow croaker has tender meat, delicious taste, few bones and more meat. It is a common fish that contains nutrients such as protein, fat, calcium, phosphorus, and potassium. Eating large yellow croaker can supplement the nutrients of the human body. Large yellow croaker occupies an important position in my country's marine fisheries and is one of the main targets of fishing. However, in recent years, wild large yellow croaker resources have faced severe tests. Due to excessive and uncontrolled fishing activities, the population of large yellow croaker has dropped sharply, and the population structure has also shown obvious degradation. This unreasonable fishing method not only seriously damages the ecological resources of yellow croaker, but also has a profound impact on the balance of the entire marine ecosystem.

[0003] According to the geographical distribution characteristics of large yellow croaker, scientists divide it into three different species: Daiqu tribe, Niuzhou tribe and Min-Yuedong tribe. Among them, the large yellow croaker of the Daiqu tribe is particularly precious. Its origin is mainly concentrated in the Daiquyang and Lusiyang waters of Zhoushan fishing grounds. The large yellow croaker of the Daiqu tribe stands out for its excellent quality. Its meat is extremely tender and elastic, melting in the mouth, leaving a lasting aftertaste. At the same time, its meat is delicious, whether it is steamed, braised or other cooking methods, it can perfectly show its unique and delicious flavor. In addition, the large yellow croaker of the Daiqu tribe has strong adaptability, rapid growth, and excellent cold resistance, making it the preferred species for farmers. Due to overfishing, the population of large yellow croaker has declined and it has been listed as a critically endangered (CR) species by the IUCN.

[0004] Shield ciliate disease is a serious problem in farmed large yellow croaker. In recent years, due to factors such as high stocking density, unreasonable layout, and changes in the breeding environment, shield ciliates have become one of the main parasitic diseases in the seedling stage of large yellow croaker, causing huge economic losses to farmers. The worm can invade the body surface, muscle, abdominal cavity and brain of the infected fish, causing a daily mortality rate of up to 1% to 2%. However, conventional treatment methods have obvious defects, such as the difficulty of drugs to pass through the blood-brain barrier, the strong stimulation of insecticides, and the general drugs can only drive away parasites on the body surface, but have poor effects on parasites that enter the body. Once the drug effect disappears, the parasites begin to multiply in large numbers again. In contrast, molecular marker breeding has the advantages of direct expression in the form of DNA, extremely large number, high polymorphism, and no seasonal environmental influences, which provides a new idea for the prevention and treatment of shield ciliate disease. Through molecular marker breeding technology, large yellow croaker varieties with the ability to resist shield ciliates can be cultivated, thereby effectively reducing the morbidity and mortality of the disease. Summary of the invention

[0005] The purpose of the present invention is to provide a method for breeding Daiqu large yellow croaker fry resistant to shield ciliate disease, by analyzing the shield ciliate disease susceptible population and resistant population of Daiqu large yellow croaker to screen molecular markers linked to the disease resistance trait, and using the screened molecular markers to screen individuals as parents for the breeding of Daiqu large yellow croaker fry resistant to shield ciliate disease.

[0006] The present invention first provides a SNP site related to the resistance of Daiqu large yellow croaker to shield ciliate disease. The SNP molecular marker is located at position 214 of the nucleic acid fragment with the sequence of SEQ ID NO: 1, which is a G / A substitution, and its nucleic acid sequence is as follows:

[0007] ATTGCATATAGTACAAATACCTAGAGAGTGAAATACACTTTGC

[0008] ACAGTAATGTACATATATAAAGAGGTATACACCAACCGGCCACTTC

[0009] ATTAGTTACACAAGAACAACCTAATTATAATTACTGTTGTTGTTTGC

[0010] ATTATAATGAAAGGTGTTGCTAATATTTCAGCCATCCTATTTACATAC

[0011] ATGAGAGGGCCAAAATATTAGAAACACCTCTCAATACTCCTGTACA

[0012] ACTACAGCACCTACTAAGACCCACTAATTAACATGAAGTAGGATT

[0013] ATTACCTCTCTGACAGTGTCAACAAAAACAGAAATATTCTAAGGTT

[0014] CATAAAAGTAGAATTTATGTCAGAGGTG (SEQ ID NO: 1);

[0015] The SNP site provided by the present invention is used for breeding Daiqu tribe large yellow croaker individuals with the potential of resisting shield ciliate disease.

[0016] The present invention also provides a primer pair for detecting the SNP molecular marker, and a specific primer sequence information thereof is as follows:

[0017] Forward primer F: GTATACACCAACCGGCCACT (SEQ ID NO: 2),

[0018] Reverse primer R: AGTGGGGTCTTAGTAGGTGCT (SEQ ID NO: 3).

[0019] The present invention also provides a method for screening Daiqu tribe large yellow croaker with the potential to resist scutellaria disease, which is to screen individuals with the specific genotype of the SNP site;

[0020] The individual with the specific genotype is a GG type individual.

[0021] The SNPs related to the resistance of the Daiqu large yellow croaker to shield ciliate disease are obtained by screening in the present invention, and are used for screening parents resistant to shield ciliate disease, thereby accelerating the genetic breeding and selection speed of the Daiqu large yellow croaker and reducing the harm of shield ciliate disease to the breeding of the Daiqu large yellow croaker. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : RNA extraction sample picture;

[0023] Figure 2 :Schematic diagram of SNP sites;

[0024] Figure 3 : Statistics of mortality rate of large yellow croaker of Daiqu tribe. DETAILED DESCRIPTION

[0025] The present invention is described in detail below in conjunction with embodiments and drawings.

[0026] Example 1: Establishment of susceptible and resistant populations of large yellow croaker against scutellaria disease

[0027] Since 2020, the susceptible and resistant populations of Daiqu large yellow croaker against shield ciliate disease have been established in the breeding farm of Xiangshan Gangwan Aquatic Seed Co., Ltd. The experiment uses an indoor recirculating aquaculture system, which is continuously aerated around the clock (24 hours) and has a water capacity of 500L. A total of 300 Daiqu large yellow croakers with well-proportioned body shape, abundant vitality and strong physique were selected, with an average weight of (125.46±5.24)g.

[0028] Before the experiment, the fish were pre-raised in the breeding tank for one week to ensure that they adapted to the new environment, and then the shield ciliate infection experiment was carried out. During the breeding process, the fish were fed twice a day, and the excrement and residual feed were removed in time with a siphon to maintain the water quality. During the pre-breeding stage, the key parameters of the water body were controlled as follows: the dissolved oxygen concentration was not less than 5 mg / L, the water temperature was maintained at (23±1)℃, the pH value was maintained between 7.8-8.4, the salinity range was 15‰~20‰, and natural light conditions were used. The transparency of the pool water was guaranteed to be above 0.5 meters.

[0029] After one month of feeding, 30,000 newly hatched fish shield ciliate larvae were added to infect the Daiqu tribe yellow croaker, and the disease situation of the yellow croaker was observed. The first 30 deaths were selected as the susceptible group, and the last survivors were selected as the parents for breeding. Among the obtained offspring, 30 individuals with no significant difference in body weight from the susceptible group were selected as the resistant group, which were placed on ice for dissection. The muscles of the susceptible group were taken, and the fins of the resistant group were taken. After being rinsed with sterile saline, they were placed in 2.0mL cryovials, quick-frozen in liquid nitrogen, transported back to the laboratory, and stored in a -80℃ refrigerator for subsequent experiments.

[0030] Example 2: Screening for SNP sites associated with the resistance to scutellaria disease in large yellow croaker of the Daiqu tribe. The genomic RNA was extracted using a standard phenol-chloroform extraction technique, and the specific steps were as follows:

[0031] 1) Take 50 mg of frozen tissue and add 1 ml of Trizol for homogenization.

[0032] 2) Transfer the Trizol lysate of tissues or cells into an EP tube and place it at room temperature for 5 minutes to completely separate the nucleic acid-protein complex.

[0033] 3) Add chloroform, shake vigorously, centrifuge for 15 minutes, and take the supernatant.

[0034] 4) Transfer the supernatant to a new EP tube, add isopropanol to precipitate RNA, leave at room temperature for 10 minutes, and then centrifuge for 10 minutes.

[0035] 5) Wash the precipitate with 75% ethanol, discard the supernatant after centrifugation, let the precipitated RNA dry naturally at room temperature, and finally dissolve it with RNase-free water.

[0036] The RNA was detected by 1% agarose gel electrophoresis, and the results showed that the RNA extraction quality was good ( Figure 1 ). RNA was transcribed into cDNA and verified using validated primers designed by Primer Premier 5.0 software.

[0037] The genomic DNA of the susceptible and resistant groups of Daiqu tribe large yellow croaker was extracted. The various gene fragments of these individuals were amplified using the standard PCR method. Then, the products of PCR amplification were sequenced, and SNP markers were screened through sequence alignment and assembly processes. GATK software was used to screen SNP markers in differentially expressed genes. 30 susceptible groups and 30 resistant groups in the association analysis population were used as SNP marker verification populations. 6 potential SNP markers existing in differentially expressed genes were selected for SNaPshot typing verification, and primers for each SNP site were designed using Primer Premier 5.0 software (Table 1).

[0038] Table 1: Primer information of SNP loci of Daiqu tribe yellow croaker

[0039]

[0040] The DNA templates of the susceptible group and the disease-resistant group were grouped, each group containing 5 samples, and then the genomic DNA of these samples were mixed in equal volumes, and the mixture was used as the starting template for PCR amplification.

[0041] PCR reaction was 25 μL system: 10x PCR buffer (containing Mg 2+ 1.5mM) 2.5μl, 2.5mM / each dNTP 1μl, 2.5pmol / each primer 2μl, cDNA template 2μl, water added to 24.75μl, Taq DNA polymerase 0.25μl.

[0042] The PCR reaction conditions were as follows: initial denaturation at 94°C for 5 min, 35 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and extension at 72°C for 5 min; and insulation at 4°C.

[0043] The amplified products were automatically detected by fluorescence using ABI3730XL DNA analyzer. The length of the PCR amplified products and the peak value of the fluorescence intensity were accurately measured by Genemapper4.0 software to determine the genotype of each site. The results are shown in Table 2. There are three genotypes at the Pse-3 locus, among which the homozygous GG is the dominant genotype, with 8 individuals in the susceptible group and 25 individuals in the resistant group, and the genotype frequencies in the two groups are 26.67% and 83.33%, respectively; the heterozygous has 10 individuals in the susceptible group and 2 individuals in the resistant group, and the genotype frequencies in the two groups are 33.33% and 6.67%, respectively; the homozygous AA has 12 individuals in the susceptible group and 3 individuals in the resistant group, and the genotype frequencies in the two groups are 40% and 10%, respectively. By conducting association analysis on the disease resistance traits of the SNP sites screened from the Daiqu tribe large yellow croaker genes in the two populations, the results showed that the SNP site Pse-3 showed a significant correlation with the disease resistance trait (P<0.05).

[0044] Table 2: Detailed table of genotypes and gene frequencies of some SNP loci of Daiqu large yellow croaker

[0045]

[0046] The PCR product was sent to a bioengineering company for sequencing. The SNP site was located at position 214 of SEQ ID NO: 1, which was a G / A substitution ( Figure 2 ), the target sequence is as follows:

[0047] ATTGCATATAGTACAAATACCTAGAGAGTGAAATACACTTTGCACAGTAATGTACATATATAAAGAGGTATACACCAACCGGCCACTTCATTAGTTACACAAGAACAACCTAATTATAATTACTGTTGTTGTTTGCATTATAATGAAAGGTGTTGCTAATATTTCAGCCATCCTATT TACATACATGAGAGGGCCAAAATATTAGAAACACCTCTCAATACTCCTGTACAACTACAGCACCTACTAAGACCCACTAATTAACATGAAGTAGGATTATTACCTCTCTGACAGTGTCAACAAAAACAGAAATATTCTAAGGTTCATAAAAGTAGAATTTATGTCAGAGGTG(SEQ ID NO:1).

[0048] The primer pair sequence information used to detect the above sequence is as follows:

[0049] Forward primer F: GTATACACCAACCGGCCACT (SEQ ID NO: 2),

[0050] Reverse primer R: AGTGGGGTCTTAGTAGGTGCT (SEQ ID NO: 3),

[0051] The SNP locus was genotyped and there were three genotypes of GG, GA and AA at the locus ( Figure 2 ), among which the GG genotype's resistance to shield ciliate disease was significantly higher than that of the GA and AA genotypes, indicating that it was a dominant gene.

[0052] Example 3: Screening of individuals of Pseudosciaena crocea resistant to Shield ciliate disease for seedling cultivation

[0053] At the Daiqu tribe yellow croaker breeding base in Xiangshan, Zhejiang Province, 1,000 samples of offspring of the Daiqu tribe yellow croaker were tested. The genomic DNA of the fins of each yellow croaker was obtained using non-destructive sampling technology. Then, the Pse-3 marker site was amplified and detected using a primer pair with upstream and downstream sequences of SEQ ID NO:2 and SEQ ID NO:3, and individuals with a genotype of GG were screened out. Among the 1,000 Daiqu tribe yellow croakers tested, 148 were confirmed to carry the Pse-3 marker site, of which 76 had a genotype of GG. The screened individuals were placed in the same environment as other individuals and adaptively raised for 7 days, followed by an immersion test.

[0054] The selected groups and the common groups were set as the marked group and the common group respectively. Ten Daiqu large yellow croakers with symmetrical body shape, intact shell and full vitality were selected for each group and placed in water containing pathogenic concentrations of shield ciliates for breeding. Three repeated experiments were set up for each group. During the experiment, the water temperature was maintained at 23°C, the dissolved oxygen concentration was ensured to be no less than 5 mg / L, the pH value was maintained in the range of 7.8-8.4, the salinity was controlled between 15‰ and 20‰, the water was continuously aerated, the water was changed once a day, and bait was fed once in the morning and evening. After 7 days, the mortality of large yellow croakers in each group was observed and recorded.

[0055] During the 7-day observation period, the number of deaths of sick yellow croaker gradually increased, and the dead individuals showed symptoms such as red heads, inability to close their mouths, and severe ulcers on the body surface. Figure 2 As shown, the mortality rate of the common group of large yellow croaker exceeded 75% after immersion infection with shield ciliates for 7 days, while the mortality rate of the marked group was only 35%.

[0056] Subsequently, the individuals with the GG genotype were used as parents for breeding. When their offspring grew to a weight of about 100g, 300 healthy and energetic individuals were selected for infection test, and the test method was the same as that of the parents. After the test, the mortality rate of the offspring of Daiqu tribe large yellow croaker was 34.56% after being infected with shield ciliates for 7 days, which was no significant difference compared with the parents. This confirmed that the offspring bred by the individuals selected by this marker site also have good disease resistance.

[0057] In summary, the Daiqu tribe large yellow croaker individuals with a genotype of GG screened out by the SNP loci provided by the present invention have stronger resistance to shield ciliate disease, and their offspring also show good disease resistance when these screened individuals are used as parents for breeding.

Claims

1. A SNP site associated with the resistance of Pseudosciaena crocea to scutellaria disease, characterized in that: The SNP molecular marker is located at position 214 of the nucleic acid fragment with the sequence of SEQ ID NO: 1, and is a G / A nucleoside substitution.

2. Use of the molecular marker for detecting the SNP site described in claim 1 in the preparation of a molecular detection product for breeding individuals of the Daiqu tribe large yellow croaker with the potential to resist shield ciliate disease.

3. The use according to claim 2, characterized in that The molecular marker is a PCR amplification sequencing primer pair.

4. The use according to claim 3, characterized in that The PCR amplification sequencing primer pair has an upstream primer sequence of SEQ ID NO: 2 and a downstream primer sequence of SEQ ID NO:

3.

5. The use according to claim 2, characterized in that The molecular detection product is a PCR amplification sequencing detection kit.

6. A method for screening large yellow croakers with the potential to resist scutellaria disease, characterized in that: The method is to screen individuals having a specific genotype of the SNP site according to claim 1.

7. The method according to claim 6, characterized in that The individual with the specific genotype is a GG type individual.

8. The method according to claim 6, characterized in that The method described is to use PCR amplification and sequencing primer pairs for detection, wherein the sequence of the upstream primer is SEQ ID NO: 2, and the sequence of the downstream primer is SEQ ID NO: 3.

Images