Wheat haplotype molecular marker related to drought resistance, primer, kit and application thereof

Abstract

This invention discloses a haplotype molecular marker, primers, reagent kit, and their applications related to wheat drought resistance, aiming to address the current lack of markers capable of identifying haplotypes. TaXTH‑2B Technical issues related to molecular markers of superior haplotypes in gene promoters. This application confirms... TaXTH‑2B The gene promoter has two haplotypes, among which the Hap II haplotype is an excellent haplotype that confers high drought resistance index to wheat and has high promoter activity. At the same time, this application has developed molecular marker primers to distinguish between the two haplotypes, which have broad application prospects in identifying and screening bred wheat varieties or intermediate generation materials, and assisting in the selection of wheat materials with high drought resistance index.

Description

Technical Field

[0001] This invention application relates to the field of molecular breeding technology, specifically to a haplotype molecular marker, primer, reagent kit related to wheat drought resistance, and their applications. Background Technology

[0002] Wheat, one of the world's three major food crops, supplies food for nearly one-fifth of the global population, with an annual yield of 720 million tons. In China, wheat, as a major food crop, has an annual yield of approximately 130 million tons. High and stable wheat yields are crucial for ensuring national food security. However, with global warming and frequent extreme weather events such as droughts, wheat production faces severe challenges. Statistics show that more than half of the world's wheat-producing areas are affected by drought. In recent years, drought has led to a wheat yield reduction of up to 13.7%. Therefore, improving the drought resistance of wheat and cultivating highly drought-resistant wheat varieties are key to addressing the impact of drought on wheat yields.

[0003] Xyloglucan endotransglucosylase / hydrolase (XTH) is one of the important enzymes for plant cell wall remodeling. Belonging to the glycoside hydrolase 16 (GH16) family, it catalyzes the hydrolysis or transfer of xyloglucan molecules, participating in the construction, elongation, and remodeling of plant cell walls, as well as responses to abiotic stress. Many studies have shown that XTH genes play a crucial role in plant responses to and adaptation to abiotic stress. For example, when persimmon is introduced into Arabidopsis thaliana… DkXTH1 The gene can enhance its tolerance to salt, ABA, and drought stress; in rice, low temperature stress can significantly induce... OsXET9 Gene expression promotes leaf and ear development; in maize, it enhances... ZmXTH Gene expression can reduce the accumulation of aluminum in plant roots and cell walls, thereby enhancing the plant's resistance to aluminum.

[0004] The expression regulation of the XTH gene is influenced not only by its internal sequence but also by its upstream promoter region. The promoter is a key element in gene transcription initiation, determining when, where, and at what level a gene is expressed. Therefore, the promoter region of the XTH gene is crucial for regulating its expression pattern, thereby affecting plant responses to and adaptations to abiotic stress. However, despite increasing attention being paid to the role of the XTH gene and its promoter in plant stress resistance, no methods for identifying XTH gene expression have yet been established. TaXTH-2B There are few reports on molecular markers for superior haplotypes of gene promoters. Furthermore, very few molecular markers for drought resistance in wheat have been reported.

[0005] As a crop directly exposed to variable climate conditions, the genetic improvement of wheat's drought resistance is crucial for ensuring global food security. Currently, genetic improvement of wheat drought resistance mainly relies on traditional phenotypic selection and hybridization breeding. While effective, these methods are time-consuming and have limited efficiency. Therefore, developing methods to identify... TaXTH-2B Molecular markers of superior haplotypes in gene promoters are of great significance for accelerating the breeding of drought-resistant wheat varieties.

[0006] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0007] The purpose of this invention is to provide a haplotype molecular marker, primers, kit, and their applications related to wheat drought resistance, wherein the molecular marker is located at... TaXTH-2B The promoter region of a gene can distinguish different wheat varieties. TaXTH-2B Haplotypes of gene promoters are used for the identification and screening of wheat with high drought resistance index, thereby assisting in wheat breeding.

[0008] Specifically, this disclosure provides a haplotype molecular marker in wheat TaXTH-2B The gene promoter sequence contains differential sites as shown in the comparison between SEQ ID NO.1 and SEQ ID NO.2.

[0009] According to a second aspect of this disclosure, an identification method is provided. TaXTH-2B The promoter haplotype primers were designed based on the differential sites shown in the comparison of SEQ ID NO.1 and SEQ ID NO.2.

[0010] In some embodiments of this disclosure, the primer pair sequences are as follows:

[0011] Forward primer sequence: CGTTTGTTGAACGTTTGCGG

[0012] The reverse primer sequence is GTGCATGTCGACTGACGAGT.

[0013] According to a third aspect of this disclosure, a kit containing the above-described primers is provided.

[0014] According to a fourth aspect of this disclosure, the haplotype molecular marker, the primer, or the kit is used to screen / identify drought resistance traits in wheat varieties.

[0015] In some embodiments of this disclosure, the application is to amplify the wheat variety to be tested using the above primers. TaXTH-2B The gene promoter yielded a PCR band of 1827 bp, which is the low drought resistance haplotype TaxTH-2B Hap I, and a PCR band of 1389 bp, which is the superior wheat haplotype TaxTH-2B Hap II with a high drought resistance index.

[0016] According to the fifth aspect of this disclosure, the haplotype molecular marker, the primer, or the kit is applied to screen / identify wheat. TaXTH-2B In gene promoter activity.

[0017] According to the sixth aspect of this disclosure, the haplotype molecular marker, the primer, or the kit is applied in the breeding of wheat varieties with high drought resistance.

[0018] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:

[0019] 1. Confirmed TaXTH-2B The gene promoter has two haplotypes, among which the Hap II haplotype is an excellent haplotype that confers high drought resistance index to wheat. This haplotype has higher promoter activity than the Hap I haplotype.

[0020] 2. A method for distinguishing different TaXTH-2B The molecular marker primers for the haplotype of the gene promoter produced a PCR band of 1827 bp when identifying wheat varieties containing the Hap I type promoter and a PCR band of 1389 bp when identifying wheat varieties containing the Hap II type promoter.

[0021] 3. The developed molecular markers and their primers have broad application prospects in identifying and screening bred wheat varieties or intermediate generation materials, and in assisting the selection of wheat materials with high drought resistance index. Attached Figure Description

[0022] Figure 1 As shown in one embodiment of this application TaXTH-2B Differential sites for two haplotypes in the gene promoter (2000 bp upstream of the start codon); where ATG is the start codon, and the numbers indicate the location of the differential sites.

[0023] Figure 2 As shown in one embodiment of this application TaXTH-2B Drought resistance index of two haplotypes of gene promoter in population materials; where 08 / 09 HS represents Hengshui in 2008-2009; 09 / 10 HS represents Hengshui in 2009-2010; 09 / 10 JY represents Jiyuan in 2009-2010.

[0024] Figure 3 This application describes an embodiment using a tobacco transient expression system. TaXTH-2B Comparison of promoter activities between two haplotypes; where LUC / REN is the ratio of fluorescence intensity of firefly luciferase to that of Renilla luciferase.

[0025] Figure 4 As shown in one embodiment of this application TaXTH-2B PCR amplification banding of gene promoter molecular markers. Detailed Implementation

[0026] The specific implementation of this application will be described below with reference to the embodiments. However, the following embodiments are only used to illustrate this application in detail and do not limit the scope of this application in any way.

[0027] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the detection methods involved are all conventional methods unless otherwise specified.

[0028] Example 1 TaXTH-2B Gene promoter haplotype acquisition and analysis

[0029] Genomic DNA was extracted from 91 wheat samples using the CTAB method, and PCR amplification was performed using CGATCGGATCGACATGCAC as the forward primer and TTGTCGTAGAAGCCACCAGC as the reverse primer. TaXTH-2B Gene promoter sequences were obtained, and PCR products were sequenced to obtain 91 materials (Table 3). TaXTH-2B Gene promoter sequence; multiple sequence alignment was performed on the sequenced data, and the results are as follows: Figure 1 As shown, TaXTH-2B The gene promoter (2000 bp upstream of the start codon) has two haplotypes with 45 differentially expressed sites, including 35 SNPs and 10 InDels. These differences include: Hap I is GGCTCGA 14 bp upstream of the start codon ATG, while Hap II is C at the same site; Hap I is A 25 bp upstream of the start codon, while Hap II is T at the same site, etc. The sequences of the two haplotypes are shown in SEQ ID NO.1 and SEQ ID NO.2, where SEQ ID NO.1 represents the Hap I type. TaXTH-2B The promoter sequence of the gene, SEQ ID NO.2, is of type Hap II. TaXTH-2B The promoter sequence of a gene.

[0030] The method for extracting genomic DNA from wheat leaves using the CTAB method is as follows:

[0031] (1) Place the cut wheat leaf sample into a 2 mL centrifuge tube with two 5 mm steel balls pre-placed. After freezing with liquid nitrogen, quickly crush the sample completely with a sample crusher.

[0032] (2) Add 0.7 mL of CTAB extract, shake vigorously up and down, and place in a 65℃ oven for 60 min, shaking up and down once every 15 min to mix.

[0033] (3) Add 0.7 mL of chloroform:isoamyl alcohol (24:1), mix well, and centrifuge at 10,000 rpm for 10 min at room temperature.

[0034] (4) Prepare a 1.5 mL centrifuge tube in advance, write a label, add 0.5 mL of pre-cooled isopropanol, aspirate the supernatant after centrifugation into the 1.5 mL centrifuge tube, invert and mix well, and place in a -20℃ refrigerator for 30 min.

[0035] (5) Centrifuge at 10,000 rpm for 10 min.

[0036] (6) After centrifugation, carefully discard the supernatant, add 0.8 mL of 75% alcohol, and centrifuge at 7500 rpm for 5 min.

[0037] (7) Repeat (6) operation.

[0038] (8) Let it stand in a clean bench at room temperature for about 10 minutes to evaporate the alcohol, then air dry it. Finally, add 0.2 ml of sterile water and store at -20℃.

[0039] The gene fragments were amplified using KOD FX, and the PCR reaction system is shown in Table 1.

[0040] Table 1 PCR reaction system

[0041] .

[0042] The PCR reaction procedure is shown in Table 2.

[0043] Table 2 PCR reaction procedure

[0044] .

[0045] Example 2 TaXTH-2B Correlation analysis between gene promoter haplotype and drought resistance index

[0046] To explore the genetic effects of haplotype differences, a natural population of 91 wheat varieties was used to conduct a correlation analysis between haplotypes and drought resistance index.

[0047] Using yield traits obtained from plant surveys in Hengshui in 2008-2009, 2009-2010, and Jiyuan in 2009-2010, the drought resistance index of the 91 wheat materials was calculated. The drought resistance index = (dryland yield of a variety / dryland yield of a control variety) × (drought resistance coefficient of a variety / drought resistance coefficient of a control variety). The drought resistance coefficient refers to the ratio of dryland yield (drought stress) to irrigated yield (non-stress) of the same variety. The results are shown in Table 3 and... Figure 2 As shown, the drought resistance index of Hap II type wheat varieties was significantly higher than that of Hap I type wheat varieties in the three-site trials over two years, indicating that Hap II type wheat varieties have stronger drought resistance.

[0048] Table 3 91 varieties TaXTH-2B Gene promoter haplotype and drought resistance index

[0049]

[0050] Example 3 TaXTH-2B Activity analysis of two haplotype promoters of gene promoters

[0051] because TaXTH-2B There are up to 45 site differences between the two haplotypes of the gene promoter, including insertions and deletions of relatively long segments. The inventors hypothesized that the promoter activities of the two haplotypes might differ. To verify this hypothesis, a dual-luciferase assay was performed using a tobacco transient expression system. TaXTH-2B The promoter sequences of two haplotypes of the gene were constructed into the pGreenII0800-Dual LUC vector. The constructed vector was transformed into Agrobacterium, and the Agrobacterium was used to infect tobacco leaves. After infection, the tobacco leaves were cultured in the dark for 24 h and then in the light for 48 h. Samples were then taken, and the reverse side of the samples was uniformly coated with LUC luminescent substrate. After standing in the dark for 5 min, the fluorescence signal was observed using a live imaging system. The fluorescent signal was sampled using a punch and quickly placed into 2 ml centrifuge tubes. After being frozen in liquid nitrogen, the samples were stored at -80°C for subsequent measurement of LUC / REN values.

[0052] Before measurement, the sample was first crushed using a sampler, and then lysed with an appropriate amount of diluted 1X Passive Lysis Buffer. The mixture was reacted on ice for 30 min, centrifuged at 12000 rpm for 15 min at 4°C, and 100 µl of the supernatant was transferred to a 1.5 ml centrifuge tube placed on ice. 10 µl of the sample was taken, and 50 µl of LARII was added. The mixture was pipetted and mixed thoroughly, and the result was measured. Then, 50 µl of Stop&Glo was added, the mixture was pipetted and mixed thoroughly, and the result was measured. The LUC / REN value was recorded. The specific experimental method followed the Promega Dual-Luciferase® ReporterAssay System kit. Results are as follows: Figure 3 As shown, tobacco injected with a Hap II type promoter has a higher LUC / REN value than tobacco injected with a Hap I type promoter, indicating that the Hap II haplotype promoter has higher activity than the Hap I haplotype promoter.

[0053] Example 4 TaXTH-2B Development of molecular markers for gene promoters

[0054] For use in marker-assisted selection breeding, this example is in TaXTH-2B Primers designed for conserved regions of gene promoters to distinguish TaXTH-2B Two haplotypes of gene promoters, as well as identification and screening of wheat varieties or intermediate generation materials in the breeding process.

[0055] The forward primer sequence for the molecular marker designed in this example is CGTTTGTTGAACGTTTGCGG, and the reverse primer is GTGCATGTCGACTGACGAGT. Using this primer pair to amplify wheat material with a Hap I promoter, a PCR band of 1827 bp was obtained; using the same primer pair to amplify wheat material with a Hap II promoter, a PCR band of 1389 bp was obtained. Figure 4 ).

[0056] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this application.

[0057] Obviously, those skilled in the art can make various modifications and variations to this application without departing from the spirit and scope of its inventive concept. Therefore, if such modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include such modifications and variations.

Claims

1. TaXTH-2B The application of promoter haplotypes in screening / identifying drought resistance traits in wheat varieties is characterized by, The sequences of the two haplotypes are shown in SEQ ID NO.1 and SEQ ID NO.2, where SEQ ID NO.1 is of type Hap I. TaXTH- 2B The promoter sequence of the gene, SEQ ID NO.2, is of type Hap II. TaXTH-2B The promoter sequence of the gene; among them, the Taxh-2B Hap II type wheat variety has strong drought resistance.

2. The application according to claim 1, characterized in that, The following primers were used to amplify the wheat varieties to be tested. TaXTH- 2B Gene promoters: Forward primer sequence: CGTTTGTTGAACGTTTGCGG Reverse primer sequence: GTGCATGTCGACTGACGAGT; The PCR band with a size of 1827 bp represents haplotype Taxh-2B Hap I, which has a low drought resistance index, while the PCR band with a size of 1389 bp represents haplotype Taxh-2B Hap II, which has a high drought resistance index in wheat.

3. TaXTH-2B Promoter haplotype in wheat screening / identification TaXTH-2B Its application in gene promoter activity is characterized by, The sequences of the two haplotypes are shown in SEQ ID NO.1 and SEQ ID NO.2, where SEQ ID NO.1 is of type Hap I. TaXTH-2B The promoter sequence of the gene, SEQ ID NO.2, is of type Hap II. TaXTH-2B The promoter sequence of the gene was determined, and the promoter of the Taxh-2B Hap II haplotype had higher activity than the promoter of the Taxh-2B Hap I haplotype.

4. TaXTH-2B The application of promoter haplotypes in breeding wheat varieties with high drought resistance is characterized by, The sequences of the two haplotypes are shown in SEQ ID NO.1 and SEQ ID NO.2, where SEQ ID NO.1 is of type Hap I. TaXTH-2B The promoter sequence of the gene, SEQ ID NO.2, is of type Hap II. TaXTH-2B The promoter sequence of the gene was determined, and wheat materials with promoter sequences such as Taxh-2BHap II were selected for breeding.

Images