Molecular marker Vs_Chr1_244133225 associated with crack resistance in arrowhead pea and its application

By developing the molecular marker Vs_Chr1_244133225 on chromosome 1 of pea tree and using PCR to detect InDel sequence variations, the problem of pod cracking in pea tree was solved, enabling rapid identification and improvement of crack resistance traits and increasing breeding efficiency.

CN119639941BActive Publication Date: 2025-10-28LANZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411891072.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-20
Publication Date
2025-10-28
Estimated Expiration
2044-12-20

AI Technical Summary

Technical Problem

The pod cracking phenomenon of pea is unfavorable for seed production and breeding. In addition, the molecular research foundation is weak and the mechanism of pod cracking has not been elucidated. Existing technology makes it difficult to effectively improve its crack resistance.

Method used

A molecular marker Vs_Chr1_244133225 located on chromosome 1 of V. vulgaris was developed. The InDel sequence variation was detected by PCR to quickly identify the crack resistance trait of V. vulgaris. The primer pair of CACTCCAACTCTCTCATCA and CGACAGCAATGGGTTATT was designed to amplify the characteristic band for identifying the crack resistance trait.

Benefits of technology

It enables rapid and accurate identification of crack resistance traits in arrowhead peas, improves breeding efficiency, and allows for high-throughput screening and improvement of crack-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639941B_ABST
    Figure CN119639941B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker Vs_Chr1_244133225 associated with the crack resistance trait of pea (Spiral pea) and its application, belonging to the field of biotechnology. The molecular marker Vs_Chr1_244133225 is located on chromosome 1 of the pea (Spiral pea) reference genome (download URL: http: / / dx.doi.org / 10.5524 / 100954). The nucleotide sequence of the inserted or deleted fragment is shown in SEQ ID NO.3. The nucleotide sequence of the primer pair for amplifying the InDel molecular marker is shown in SEQ ID NO.1-2. By selecting the marker, the trait can be selected, the breeding efficiency can be greatly improved, and the rapid screening of crack-resistant pea varieties can be achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers related to the crack resistance trait of arrowhead pea. Background Technology

[0002] Molecular markers, as genetic markers reflecting genetic diversity at the DNA level, have wide applications in species identification, breeding, and gene mapping. First-generation molecular marker technologies are based on molecular hybridization, primarily using restriction fragment length polymorphism (RFLP) markers, which generate polymorphism through the addition or deletion of restriction endonuclease sites. Second-generation molecular marker technologies are based on PCR reactions and are widely used due to their low cost, convenient detection, and accuracy, such as random amplified polymorphism (RAPD), simple sequence repeat (SSR), and amplified fragment length polymorphism (AFLP) markers. With the development of second- and third-generation sequencing technologies, high-throughput sequencing has become possible, allowing for the assembly and refinement of genomes for various species. Third-generation molecular markers have emerged in this context, becoming a new type of highly efficient, accurate, and stable molecular marker. They integrate the principles and technologies of molecular biology, genetics, and bioinformatics, enabling the rapid translation of sequencing results for molecular marker-assisted breeding and the rapid improvement of existing varieties.

[0003] Vicia sativa L., an annual or biennial cleistogamous plant belonging to the genus Vicia in the legume family, is an important forage and green manure crop in high-altitude areas of China. Due to its short domestication period, Vicia sativa commonly suffers from pod splitting, and most varieties exhibit a high pod splitting rate, which is detrimental to seed production and breeding. Furthermore, the molecular research foundation for Vicia sativa is weak, and its pod splitting mechanism remains unclear. However, combining genome-wide association studies (GWAS) with third-generation molecular marker technology to develop InDel molecular markers associated with splitting resistance can accelerate the breeding of split-resistant Vicia sativa, thereby significantly improving breeding efficiency. Summary of the Invention

[0004] One of the objectives of this invention is to provide a molecular marker associated with the crack resistance trait of arrowhead pea.

[0005] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the crack resistance trait of arrowhead pea.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention discloses a pair of molecular markers related to the crack resistance trait of arrowhead pea, located on chromosome 1 of arrowhead pea, and the molecular markers are named Vs_Chr1_244133225.

[0008] Primer pairs were used to amplify molecular markers associated with crack resistance in *Vallis fulva*. The primer pair sequence corresponding to the molecular marker Vs_Chr1_244133225 is as follows:

[0009] Vs_Chr1_244133225-F: CACTCCAACTCTCTCATCA (as shown in SEQ ID NO.1);

[0010] Vs_Chr1_244133225-R: CGACAGCAATGGGTTATT (shown as SEQ ID NO.2).

[0011] The InDel sequence of Vs_Chr1_244133225 is: TCACTTATTTAAATAACCAA (shown in SEQ ID NO.3).

[0012] This invention also discloses the application of the above-mentioned molecular marker primer pairs in marker-assisted breeding of pod-cracking resistance in *Vitis salvia*. In other words, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage and detecting the presence of the molecular markers of this invention, the pod-cracking trait of *Vitis salvia* can be identified. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0013] This invention also discloses the application of the above-mentioned molecular markers in identifying the crack-resistant trait of *Vitis pulcherrima*, especially in screening and identifying crack-resistant *Vitis pulcherrima*. Specifically, the specific steps for identifying whether *Vitis pulcherrima* has the crack-resistant trait are as follows:

[0014] (1) Using the DNA of the tested germplasm as the template for PCR amplification, and the primer pair corresponding to the label Vs_Chr1_244133225 as the primers, the PCR amplification reaction system is shown in Table 1:

[0015] Table 1. PCR amplification reaction system

[0016]

[0017] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 5 min; store at 4℃.

[0018] (2) Agarose gel electrophoresis detection of PCR products, and judgment of the crack resistance of arrowhead peas based on the results:

[0019] If the PCR amplification product is a characteristic band of 100 bp as shown in SEQ ID NO.4, then *Vaccaria salsa* is a cleavage-prone type; if the PCR amplification product is a characteristic band of 80 bp as shown in SEQ ID NO.5, then *Vaccaria salsa* is a cleavage-resistant type.

[0020] Alternatively, reagent kits containing the aforementioned molecular marker primer pairs can be prepared to identify the crack resistance trait of *Vicia sativa* materials. Furthermore, these kits can be used to identify or assist in the identification of *Vicia sativa* genotypes. All of these applications can be performed using conventional methods.

[0021] The present invention has the following advantages:

[0022] (1) The molecular markers in this invention are closely related to the crack resistance trait of arrow-shaped peas and can be applied to molecular marker-assisted breeding of crack resistance trait of arrow-shaped peas, to the screening of germplasm resources of crack-resistant arrow-shaped peas, and to the genetic improvement of arrow-shaped peas.

[0023] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied rapidly and in high throughput to the breeding practice of arrowhead pea. Attached Figure Description

[0024] Figure 1 The results of the genome-wide association analysis of the crack resistance trait in arrowhead pea are based on the Manhattan diagram obtained by EMMAX software. The red sites shown are the InDel positions associated in this invention.

[0025] Figure 2 Box plots of PSRI (Potamogeton Species Resilience Index) corresponding to different genotypes at locus Vs_Chr1_244133225 in a genome-wide association analysis. 0 / 0 indicates a genotype at locus Vs_Chr1_244133225 that is prone to cracking, while 1 / 1 indicates a genotype at locus Vs_Chr1_244133225 that is resistant to cracking. The dots represent extreme values, and the values ​​above them are the p-values ​​for testing differences.

[0026] Figure 3 The sequence differences between the 0 / 0 genotype and the 1 / 1 genotype within the molecular marker Vs_Chr1_244133225 region are shown. Figure 4 This is an electrophoresis image of molecular markers amplified from some *Vaccinium bracteatum* germplasm resources. The agarose gel concentration is 2%. In the image, M represents the DNA marker. Detailed Implementation

[0027] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0028] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0030] Example 1: Development of molecular markers related to crack resistance in arrowhead pea.

[0031] This invention uses the percentage of intact pods after simulated natural pod drop in *Viola yezoensis* as the PSRI (Periplaneta spp.) crack resistance index to evaluate the cracking trait of *Viola yezoensis*. A higher PSRI indicates greater crack resistance, while a lower value indicates greater susceptibility to cracking. After measuring the PSRI in a *Viola yezoensis* population, GWAS analysis located an InDel site in the *Viola yezoensis* population. Figure 1 The red locus, named Vs_Chr1_244133225, is located at position 244133225 on chromosome 1 of the *Vaccinium bracteatum* reference genome (downloadable at http: / / dx.doi.org / 10.5524 / 100954). The first allele with InDel insertion has a genotype of 0 / 0, while the second allele with InDel deletion has a genotype of 1 / 1. Box plot of PSRI distribution for different genotypes at the Vs_Chr1_244133225 locus in the *Vaccinium bracteatum* population (…). Figure 2 This indicates that the crack resistance of *Vicia sativa* genotype 1 / 1 is significantly higher than that of genotype 0 / 0. The insertion / deletion fragment at locus 244133225 on chromosome 1 of *Vicia sativa* is TCACTTATTTAAATAACCAA (shown in SEQ ID NO. 3). Figure 3 The 0 / 0 type has an inserted fragment of SEQ ID NO.3, while the 1 / 1 type has a missing fragment of SEQ ID NO.3.

[0032] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0033] Vs_Chr1_244133225-F: CACTCCAACTCTCTCATCA (as shown in SEQ ID NO.1);

[0034] Vs_Chr1_244133225-R: CGACAGCAATGGGTTATT (shown as SEQ ID NO.2).

[0035] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the easily cracked arrowhead pea sample had a characteristic band of 100 bp, while the PCR product of the anti-cracking arrowhead pea sample only had a characteristic band of 80 bp.

[0036] Example 2: Accuracy verification of the molecular markers described in this invention

[0037] A total of 222 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:

[0038] Table 2. Pod splitting status of 2222 arrowhead pea germplasm materials and genotypes corresponding to the Vs_Chr1_244133225 locus.

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] Note: In the table, genotype. / . represents genotype deletion.

[0047] 1) Using the genomic DNA of the arrowhead pea to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0048] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 15 μL of 2×Taq PCR Master Mix, and deionized water to a final volume of 30 μL. The preferred PCR amplification reaction program is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. Separation is performed by electrophoresis on a 2% agarose gel. After loading, electrophoresis is performed at 5 V / cm DC for 2 h, and the PCR banding patterns of each sample are then read.

[0049] 2) Determine the genotype of *Vaccaria buergeriana* based on the size of the PCR product: If the PCR product of the *Vaccaria buergeriana* to be identified contains the fragment shown in SEQ ID NO.3, then the *Vaccaria buergeriana* to be identified is type 0 / 0; if the PCR product of the *Vaccaria buergeriana* to be identified lacks the fragment shown in SEQ ID NO.3, then the *Vaccaria buergeriana* to be identified is type 1 / 1.

[0050] Specifically, when the PCR product of the *Vaccaria serrata* to be identified contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 100bp (SEQ ID NO.4), then the *Vaccaria serrata* to be identified is of type O / O.

[0051] The sequence of SEQ ID NO.4 is as follows:

[0052]

[0053]

[0054] When the PCR product of the *Vaccaria serrata* to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 80 bp (SEQ ID NO.5), then the *Vaccaria serrata* to be identified is type 1 / 1.

[0055] The sequence of SEQ ID NO.5 is as follows:

[0056]

[0057] Analysis of the 222 *Viburnum cuspidatum* accessions in Table 2 revealed that, excluding 4 accessions with missing genotypes, 194 accessions had a genotype of 0 / 0 at the Vs_Chr1_244133225 locus, with a mean PSRI of 0.4734, classifying them as easily cracked *Viburnum cuspidatum*. Conversely, 24 accessions had a genotype of 1 / 1 at the Vs_Chr1_244133225 locus, with a mean PSRI of 0.7826, classifying them as crack-resistant *Viburnum cuspidatum*. Analysis of variance showed a highly significant difference in PSRI between the easily cracked and crack-resistant *Viburnum cuspidatum* accessions (P < 0.001).

[0058] Twenty-four accessions from 222 *Viburnum fasciatus* accessions (germplasm numbers 109, 143, 164, 172, 202, 208, 235, 409, 429, 436, 447, 461, 470, 17, 62, 79, 113, 200, 270, 302, 303, 382, ​​430, and 458) were selected for validation. Figure 4 As can be seen, 13 *Viburnum cuspidatum* materials amplified a 100bp characteristic band, indicating the 0 / 0 type. Statistical analysis showed that the average PSRI of these 13 *Viburnum cuspidatum* materials was 0.3527. Eleven *Viburnum cuspidatum* materials amplified an 80bp characteristic band, indicating the 1 / 1 type. Statistical analysis showed that the average PSRI of these 11 1 / 1 type *Viburnum cuspidatum* materials was 0.8345, which was higher than the average PSRI of the 13 0 / 0 type *Viburnum cuspidatum* materials. Analysis of variance showed a significant difference in PSRI between the 0 / 0 and 1 / 1 types (P<0.01). The 1 / 1 type *Viburnum cuspidatum* materials, genotyped by PCR detection, were expected to be crack-resistant, and the actual results were consistent with expectations. Therefore, the InDel molecular marker of this invention can effectively identify the crack-resistant trait of *Viburnum cuspidatum* and can be used for the prediction and screening of crack-resistant *Viburnum cuspidatum* varieties.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The InDel molecular marker Vs_Chr1_244133225, located on chromosome 1 and associated with the crack resistance trait in arrowhead pea, is characterized by... The nucleotide sequence of the InDel molecular marker Vs_Chr1_244133225 is shown in SEQ ID NO.4 or SEQ ID NO.5, and the nucleotide sequence of its inserted / deleted fragment is shown in SEQ ID NO.

3.

2. The application of the primer pair for amplifying the InDel molecular marker Vs_Chr1_244133225 as described in claim 1 in marker-assisted breeding of arrowhead pea, characterized in that, It is used to identify or assist in the identification of the crack-resistant trait of *Vaccaria buergeriana*. Specifically, PCR amplification is performed using primers Vs_Chr1_244133225-F and Vs_Chr1_244133225-R. If the PCR amplification product is a characteristic band of 100 bp as shown in SEQ ID NO.4, then *Vaccaria buergeriana* is of the easily cracked type; if the PCR amplification product is a characteristic band of 80 bp as shown in SEQ ID NO.5, then *Vaccaria buergeriana* is of the crack-resistant type. The primer pair sequence is as follows: Vs_Chr1_244133225-F: CACTCCAACTCTCTCATCA; Vs_Chr1_244133225-R:CGACAGCAATGGGTTATT.

3. A method for identifying the crack resistance trait of arrowhead pea, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Vs_Chr1_244133225-F and Vs_Chr1_244133225-R. If the PCR amplification product is a characteristic band of 100 bp as shown in SEQ ID NO.4, then *Vaccaria salsa* is a cleavable type; if the PCR amplification product is a characteristic band of 80 bp as shown in SEQ ID NO.5, then *Vaccaria salsa* is a cleavable type.

4. The use of a kit containing the primer pair of claim 2 in identifying the crack-resistant genotype of arrowhead pea.

5. The application according to claim 4, characterized in that, The method for identifying the crack-resistant genotype of arrowhead pea using the aforementioned kit is as follows: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 2, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product is a characteristic band of 100 bp as shown in SEQ ID NO.4, then the arrowhead pea is a genotype that is prone to cracking; if the PCR amplification product is a characteristic band of 80 bp as shown in SEQ ID NO.5, then the arrowhead pea is a genotype that is resistant to cracking.

Citation Information

Patent Citations

  • Molecular marker located in chromosome 1 and related to crack resistance character of vicia sativa and application of molecular marker

    CN118308525A

  • Molecular marker located on chromosome 1 and related to common vetch cold resistance and application of molecular marker

    CN118792447A