A molecular marker and detection method for identifying wild Camellia oleifera Abel. in Wuzhishan

Through InDel labeling technology and the design of specific primer pairs, the problem of unclear classification of oil tea species in Hainan has been solved, accurate identification and resource protection of Wuzhishan oil tea has been achieved, and genetic diversity protection and breeding research has been promoted.

CN119639958BActive Publication Date: 2025-07-08HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510174335.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-18
Publication Date
2025-07-08
Estimated Expiration
2045-02-18

AI Technical Summary

Technical Problem

Traditional classification methods have limitations in the identification and distribution of oil tea species in Hainan, resulting in unclear classification of oil tea species, especially the difficulty in distinguishing between Wuzhishan oil tea and Hainan oil tea, which affects resource protection and utilization.

Method used

Using InDel labeling technology, specific primer pairs are designed for PCR amplification and sequencing. By detecting the deletion or insertion sequences of specific sites in the chloroplast genome, Wuzhishan oil tea and other oil tea species are distinguished.

Benefits of technology

The accurate identification and distinction of Wuzhishan oil tea has been achieved, and methods for scientific protection and utilization of Wuzhishan oil tea germplasm resources have been provided, and genetic diversity protection and breeding research has been promoted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639958B_ABST
    Figure CN119639958B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of molecular biological identification, and discloses a molecular marker for identifying wild Wuzhishan oil-tea camellia, its application and detection method. The present invention provides a new InDel molecular marker for Wuzhishan oil-tea camellia resources. Using this molecular marker, it is possible to distinguish and identify Wuzhishan oil-tea camellia, which has been confirmed as a new species. According to the found InDel molecular markers, specific primer pairs for detecting these InDel sites are designed, and a detection method is created, which can accurately distinguish Wuzhishan oil-tea camellia from other oil-tea camellia species, and the detection results are accurate and reliable. The present invention has important application significance for scientifically protecting the diversity of Wuzhishan oil-tea camellia germplasm resources, studying the genetic protection and genetic evolution of Wuzhishan oil-tea camellia resources, and the genetic breeding of Wuzhishan oil-tea camellia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological identification, and particularly relates to a molecular marker and detection method for identifying Wuzhishan wild oil-tea camellia. Background Art

[0002] The genus Camellia ( Camellia ), the most species-rich genus in the family Theaceae, has significant economic value. The species of this genus are mainly distributed in the tropical and subtropical regions of East Asia, with more than 80% of the species distributed in China. Some species in the genus Camellia are characterized by their seeds with high oil content, collectively known as oil-tea camellia, mainly including various species in the section Oleifera. Camellia oleifera Abel is the most widely cultivated variety, known as one of the world's four major woody oil crops, with great development potential and being the main cultivated species of woody edible oil. C. oleifera Abel) is the most widely cultivated variety, known as one of the world's four major woody oil crops, with great development potential and being the main cultivated species of woody edible oil.

[0003] Hainan Province has a long history of cultivating oil-tea camellia. However, despite the important economic value of oil-tea camellia, the taxonomic research on the species of the genus Camellia in Hainan still faces great challenges. Traditional classification methods have certain limitations in species identification and distribution surveys, resulting in the unclear specific classification of oil-tea camellia species in Hainan. Some studies classify the native oil-tea camellia in Hainan as Camellia oleifera Abel, Camellia vietnamensis Loureiro or its geographical subspecies. However, due to the significant differences in morphology, ecology and economic traits among these species, the accuracy of these classification results has been questioned. C. oleifera ), Camellia vietnamensis Loureiro C. drupifera Loureiro) or its geographical subspecies. However, due to the significant differences in morphology, ecology and economic traits among these species, the accuracy of these classification results has been questioned.

[0004] In recent years, with the development of molecular biology technology, the germplasm resources of native oil-tea camellia in Hainan have been gradually clarified. Research shows that the mainly cultivated oil-tea camellia in Hainan should be classified as a new species - Camellia hainanensis YL Zhao et ZG Xu, sp. nov.). In the further analysis of the native oil-tea camellia population in Hainan, it was found that the wild decaploid population in Wuzhishan area has significant morphological differences from Camellia hainanensis YL Zhao et ZG Xu, sp. nov.). Through comprehensive identification by morphological and molecular technical means, Camellia wuzhishanensis H.G.Lai, H.Y.Hu & C.Z.Xie, sp. nov.) was confirmed as another new species. Camellia wuzhishanensis was first discovered in the core area of Maorui Branch of Wuzhishan Tropical Rainforest National Park, Changhao Township, Wuzhishan City, Hainan Province, representing the original ecological wild resources of Hainan tropical oil-tea camellia (wild shanyou), marking the first discovery of a wild population of oil-tea camellia in Hainan tropical rainforest. C. hainanica YL Zhao et ZG Xu, sp. nov.). In the further analysis of the native oil-tea camellia population in Hainan, it was found that the wild decaploid population in Wuzhishan area has significant morphological differences from Camellia hainanensis YL Zhao et ZG Xu, sp. nov.). Through comprehensive identification by morphological and molecular technical means, Camellia wuzhishanensis H.G.Lai, H.Y.Hu & C.Z.Xie, sp. nov.) was confirmed as another new species. Camellia wuzhishanensis was first discovered in the core area of Maorui Branch of Wuzhishan Tropical Rainforest National Park, Changhao Township, Wuzhishan City, Hainan Province, representing the original ecological wild resources of Hainan tropical oil-tea camellia (wild shanyou), marking the first discovery of a wild population of oil-tea camellia in Hainan tropical rainforest. C. hainanica YL Zhao et ZG Xu, sp. nov.). C. wuzhishanensis H.G.Lai, H.Y.Hu & C.Z.Xie, sp. nov.) was confirmed as another new species. Camellia wuzhishanensis was first discovered in the core area of Maorui Branch of Wuzhishan Tropical Rainforest National Park, Changhao Township, Wuzhishan City, Hainan Province, representing the original ecological wild resources of Hainan tropical oil-tea camellia (wild shanyou), marking the first discovery of a wild population of oil-tea camellia in Hainan tropical rainforest.

[0005] The discovery of the Wuzhishan oil-tea camellia germplasm has important scientific research value, especially providing new clues for the research on the origin and evolution of oil-tea camellia resources. In addition, this population has potential significance for the restoration and protection of tropical rainforest ecosystems. In order to better protect and utilize the genetic resources of Wuzhishan oil-tea camellia, it is urgent to establish a set of efficient and accurate identification techniques and evaluation systems. This will not only help to scientifically preserve its germplasm resources, but also promote the applied research of this species in genetic diversity protection, ecological restoration and breeding. Summary of the Invention

[0006] The object of the present invention is to provide a molecular marker for identifying wild Wuzhishan oil-tea camellia, its application and detection method in view of the above problems.

[0007] In order to achieve its object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a molecular marker for identifying Wuzhishan oil-tea camellia, the molecular marker is an InDel marker, and the InDel marker includes any one or a combination of more than one of InDel marker 1, InDel marker 2 and InDel marker 3:

[0009] The InDel marker 1 is located on the sequence between the trnS-GCU and trnG-GCC gene regions of the chloroplast genome. For Wuzhishan oil-tea camellia, it has the characteristic sequence shown in SEQ ID NO.10, that is, the base sequence "GAAAAC" is deleted after the 40th base of SEQ ID NO.11;

[0010] The InDel marker 2 is located on the rpoC2 gene sequence of the chloroplast genome. For Wuzhishan oil-tea camellia, it has the characteristic sequence shown in SEQ ID NO.12, that is, the base sequence "ATACCT" is deleted after the 91st base of SEQ ID NO.13;

[0011] The InDel marker 3 is located on the ycf1 gene sequence of the chloroplast genome. For Wuzhishan oil-tea camellia, it has the characteristic sequence shown in SEQID NO.14, that is, the base sequence "AAAAAA" is present after the 165th base.

[0012] The second aspect of the present invention provides a specific primer pair for detecting the above-mentioned molecular marker:

[0013] The primer pair for detecting the InDel marker 1 includes the upstream and downstream primers shown in the following nucleotide sequences:

[0014] trnS-trnG-01 upstream primer: 5’-CGAGCCGTATCTATCAAAATTCC-3’;

[0015] trnS-trnG-01 downstream primer: 5’-GAACAGGGAATTGGGCGTAA-3’;

[0016] The primer pair for detecting the InDel marker 2 includes the upstream and downstream primers shown in the following nucleotide sequences:

[0017] rpoC2-01 upstream primer: 5’-TCCCGACCTCTTTCTTCTGT-3’;

[0018] rpoC2-01 downstream primer: 5’-CGAATCGTATGCACTGGTCA-3’;

[0019] The primer pair for detecting the InDel marker 3 includes the upstream and downstream primers shown in the following nucleotide sequences:

[0020] ycf1-02 upstream primer: 5’-TGCTACTTCTATCCGCGCTT-3’;

[0021] ycf1-02 downstream primer: 5’-TCAATGCGAGCCCAAAGATG-3’.

[0022] The third aspect of the present invention provides a kit for detecting the above molecular markers, comprising the above specific primer pairs.

[0023] Preferably, the kit further comprises reagents for extracting Camellia oleifera genome DNA and reagents for PCR amplification reaction.

[0024] The fourth aspect of the present invention provides the application of the above molecular markers or the above specific primer pairs or the above kit in identifying and differentiating Camellia vietnamensis.

[0025] The above application technical solution is used to identify and differentiate Camellia vietnamensis from other Camellia species, and the other Camellia species include Camellia hainanensis, Camellia vietnamensis, Camellia oleifera, and Camellia latifolia.

[0026] The fifth aspect of the present invention provides a detection method for identifying Camellia vietnamensis, comprising the following steps:

[0027] (1) Extract the genomic DNA of the Camellia oleifera sample to be tested;

[0028] (2) Using the genomic DNA as a template, perform PCR amplification with the above specific primer pairs;

[0029] (3) Sequence the PCR amplification product, and judge whether the Camellia oleifera sample to be tested is Camellia vietnamensis according to the sequencing result.

[0030] In the above detection method, if the PCR amplification product has the characteristic sequence shown by SEQ ID NO.10 or SEQ ID NO.12 or SEQ ID NO.14, the oil-tea camellia sample to be tested is judged to be Wuzhishan oil-tea camellia; otherwise, it is judged to be not Wuzhishan oil-tea camellia.

[0031] Preferably, the above detection method is used to identify and distinguish Wuzhishan oil-tea camellia and Hainan oil-tea camellia. If the PCR amplification product has the characteristic sequence shown in SEQ ID NO.11 or SEQ ID NO.13 or SEQ ID NO.15, the oil-tea camellia sample to be tested is judged to be Hainan oil-tea camellia.

[0032] Preferably, in the above detection method, the PCR reaction system for PCR amplification is: 30 μL of the system contains 20 ng of template DNA, 0.20 mmol / L of dNTPs, 0.13 umo1 / L of upstream / downstream primers, 2.00 U of Taq DNA polymerase, and ddH2O to a total volume of 30 μL;

[0033] Amplification reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 2 min, for 40 cycles; extension at 72°C for 10 min.

[0034] The beneficial effects of the present invention are:

[0035] The present invention provides a new InDel molecular marker of Wuzhishan oil-tea resources. With the molecular marker, the Wuzhishan oil-tea that has been confirmed as a new species can be distinguished and identified. According to the found InDel molecular marker, a specific primer pair for detecting these InDel sites is designed, and a detection method is created, which can accurately distinguish Wuzhishan oil-tea from other oil-tea species, and the detection result is accurate and reliable. The present invention has important application significance for scientifically protecting the diversity of Wuzhishan oil-tea germplasm resources, studying the genetic protection and genetic evolution of Wuzhishan oil-tea resources, and the genetic breeding of Wuzhishan oil-tea. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the locations of InDel sites 1, 2, and 3 in the chloroplast genome.

[0037] Figure 2 This is the result of polymorphic sequence comparison of the products amplified by primer pair trnS-trnG-01 in the wild Wuzhishan Camellia oleifera population and the Hainan Camellia oleifera population.

[0038] Figure 3 This is the result of polymorphic sequence comparison of the products amplified by primer pair rpoC2-01 in the wild Wuzhishan Camellia oleifera population and the Hainan Camellia oleifera population.

[0039] Figure 4 This is the result of the polymorphic sequence alignment of the amplification product of primer pair ycf1-02 between the wild Camellia wuzhishanensis population and the Camellia hainanica population.

[0040] Figures 2 - 4 in

[0041] Camellia wuzhishanensis is the reference sequence of the chloroplast genome of Camellia wuzhishanensis;

[0042] Camellia hainanica is the reference sequence of the chloroplast genome of Camellia hainanica;

[0043] W_primer1 is the amplified product sequence of the trnS-trnG-01 primer pair of Camellia wuzhishanensis;

[0044] H_primer1 is the amplified product sequence of the trnS-trnG-01 primer pair of Camellia hainanica;

[0045] W_primer2 is the amplified product sequence of the rpoC2-01 primer pair of Camellia wuzhishanensis;

[0046] H_primer2 is the amplified product sequence of the rpoC2-01 primer pair of Camellia hainanica;

[0047] W_primer3 is the amplified product sequence of the ycf1-02 primer pair of Camellia wuzhishanensis;

[0048] H_primer3 is the amplified product sequence of the ycf1-02 primer pair of Camellia hainanica. Detailed implementation manners

[0049] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0050] The methods involved in the following embodiments are all conventional methods unless otherwise specified.

[0051] Example 1. Development of chloroplast InDel molecular markers for Camellia wuzhishanensis in Hainan

[0052] 1. Test materials

[0053] The chloroplast insertion / deletion (InDel) molecular markers of Camellia vietnamensis var. wuzhishanensis in Hainan were developed based on 231 sample materials: 14 wild C. vietnamensis var. wuzhishanensis samples were collected from Hainan Province, 125 C. oleifera samples from Hainan; 23 C. vietnamensis samples from Guangdong, 13 C. oleifera samples from Hainan; 23 C. vietnamensis samples from Guangxi, 11 C. oleifera samples; 12 C. vietnamensis samples from Vietnam, and 10 samples of C. latifolia, a closely related species of the same genus as the reference outgroup. All samples were collected from trees over 30 years old, and the collection points of C. oleifera in Hainan were evenly distributed in 17 regions across the island. A total of 231 germplasm samples were identified using morphological methods and subjected to whole chloroplast genome resequencing, assembly annotation, and genomic comparative analysis to obtain specific InDel polymorphic loci in C. oleifera germplasm resources from different regions. Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd.

[0054] Table 1. Experimental materials for the development of InDel molecular markers of C. vietnamensis var. wuzhishanensis

[0055]

[0056] 2. Development process of InDel molecular markers

[0057] Take 0.02 g of dry leaves of the sample to be tested, add liquid nitrogen and grind thoroughly, and extract the whole genome DNA of the sample using the modified CTAB method. Use the second-generation sequencing platform to obtain the whole chloroplast genome resequencing data of C. oleifera, C. vietnamensis var. wuzhishanensis, C. vietnamensis, C. oleifera, and C. latifolia. Before assembly, use the fastp software to filter the original data, removing the fragments with adapters and the low-sequencing-quality data with a quality score less than 20. Use the GetOrganelle software to assemble the chloroplast genome, and CPGAVAS2 for annotation. Use the mafft software to perform multiple sequence alignment on the assembled chloroplast genome, and import the alignment results into the DnaSP software. Find the position of the highly variable region in the Excel table, open it in GENEdoc, correspond to the specific InDel position in the sequence itself, and locate it in the annotated GB file. A total of 3 InDel polymorphic loci unique to C. vietnamensis var. wuzhishanensis located in the single-copy region were found.

[0058] (1) InDel locus 1

[0059] InDel locus 1: This InDel locus is a deletion of the base sequence "GAAAAC", located in the intergenic sequence between the trnS-GCU and trnG-GCC genes of the Camellia oleifera chloroplast genome. In Camellia oleifera Abel, the base sequence "GAAAAC" is deleted after the 206th nucleotide of the chloroplast genome sequence shown in SEQ ID NO.1, while the other 4 species in Table 1 have "GAAAAC" in this sequence (SEQ ID NO.1 shows the gene sequences of these 4 species).

[0060] (2)InDel locus 2

[0061] InDel locus 2: This InDel locus is a deletion of the base sequence "ATACCT", located in the rpoC2 gene sequence of the Camellia oleifera chloroplast genome. In Camellia oleifera Abel, the base sequence "ATACCT" is deleted after the 200th nucleotide of the rpoC2 gene sequence shown in SEQ ID NO.2, while the other 4 species in Table 1 have "ATACCT" in this sequence (SEQ ID NO.2 shows the gene sequences of these 4 species).

[0062] (3)InDel locus 3

[0063] InDel locus 3: This InDel locus is an insertion of the base sequence "AAAAAA", located in the ycf1 gene sequence of the Camellia oleifera chloroplast genome. In Camellia oleifera Abel, the nucleotide sequence at positions 199-204 of the ycf1 gene sequence shown in SEQ ID NO.3 is "AAAAAA" (SEQ ID NO.3 shows the gene sequence of Camellia oleifera Abel), while the other 4 species in Table 1 have a deletion of the "AAAAAA" sequence at this locus.

[0064] The positions of InDel loci 1, 2, and 3 in the chloroplast genome are as Figure 1 shown. The sequencing results of the InDel loci of 231 Camellia oleifera samples are shown in Table 2.

[0065] Table 2 Sequencing results of InDel loci of Camellia oleifera samples

[0066]

[0067] 3. Design specific primer pairs for identifying InDel loci

[0068] According to the positions of the above 3 specific InDels, use the extractseq command in Linux to extract the target region. Use the web version of primer3 (https: / / bioinfo.ut.ee / primer3 / ) to design specific primer pairs for identifying the above InDel loci. The most preferred primer pairs are as follows:

[0069] (1) Specific primer pair trnS-trnG-01 for identifying InDel locus 1

[0070] trnS-trnG-01 upstream primer (SEQ ID NO.4):

[0071] 5’-CGAGCCGTATCTATCAAAATTCC-3’;

[0072] trnS-trnG-01 downstream primer (SEQ ID NO.5):

[0073] 5’-GAACAGGGAATTGGGCGTAA-3’.

[0074] (2) Specific primer pair rpoC2-01 for identifying InDel locus 2

[0075] rpoC2-01 upstream primer (SEQ ID NO.6):

[0076] 5’-TCCCGACCTCTTTCTTCTGT-3’;

[0077] rpoC2-01 downstream primer (SEQ ID NO.7):

[0078] 5’-CGAATCGTATGCACTGGTCA-3’.

[0079] (3) Specific primer pair ycf1-02 for identifying InDel locus 3

[0080] ycf1-02 upstream primer (SEQ ID NO.8):

[0081] 5’-TGCTACTTCTATCCGCGCTT-3’;

[0082] ycf1-02 downstream primer (SEQ ID NO.9):

[0083] 5’-TCAATGCGAGCCCAAAGATG-3’.

[0084] Example 2. Molecular Identification of Germplasm Resources of Camellia vietnamensis in Wuzhishan, Hainan

[0085] 1. Selection of experimental materials

[0086] The test materials were wild Camellia vietnamensis populations in Wuzhishan, Hainan ( C. wuzhishanensis ), and Camellia oleifera in Hainan planted in the nursery of the Hainan Southern Crop Research Institute in Sanya ( C. hainanica)Seedling population, 10 samples of Camellia vietnamensis and 10 samples of Camellia oleifera Abel.

[0087] 2. Indel marker detection

[0088] 2.1 DNA extraction:

[0089] The total DNA of the above-mentioned Camellia vietnamensis and Camellia oleifera Abel. leaf samples was extracted respectively by the modified CTAB method.

[0090] 2.2 PCR amplification:

[0091] Using the DNA of the test sample extracted in step 2.1 as the amplification template, and using the specific marker primers trnS-trnG-01, rpoC2-01 and ycf1-02 in Example 1 as amplification primers respectively, PCR amplification was carried out.

[0092] PCR reaction system (30 μL): containing 20 ng of template DNA, 0.20 mmol / L of dNTPs, 0.13 μmol / L of upstream / downstream primers, 2.00 U of Taq DNA polymerase, and supplemented with ddH2O to a total volume of 30 μL; the PCR amplification reagent was 2×Phanta Max Master Mix of Nanjing Novoprotein Scientific Co., Ltd.

[0093] PCR amplification reaction procedure: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 2 min, for 40 cycles; extension at 72 °C for 10 min.

[0094] 2.5 Sequencing of PCR amplification products:

[0095] Sanger sequencing was performed on the PCR products.

[0096] (1) Detection results of primer pair trnS-trnG-01

[0097] The detection results are as Figure 2 shown. After sequencing and identification analysis, the PCR amplification product sequences of all Camellia vietnamensis samples were as shown in SEQ ID NO.10, and the "GAAAAC" base sequence (i.e., InDel site 1) was deleted after the 40th base in the sequence shown in SEQ ID NO.10. The PCR amplification product sequences of all Camellia oleifera Abel. samples were as shown in SEQ ID NO.11, and the "GAAAAC" base sequence was present after the 40th base.

[0098] InDel site 1 and its flanking sequences are as follows:

[0099] Camellia vietnamensis (SEQ ID NO.10):

[0100] CGAGCCGTATCTATCAAAATTCCTCCAGTAAAAGAAAAGA------TTCTTTTTTAGTTATTTAAATGAATCCTCTTTTCCGAATCTAATTAAACCCCCACGAAAAAAGTTAACACTCTAATTTTCATGATTTTTTTATGATCCTATCTTGATTACGCCCAATTCCCTGTTC。

[0101] Hainan Camellia oleifera (SEQ ID NO.11, the underlined part is the base sequence missing in Wuzhishan Camellia oleifera):

[0102] CGAGCCGTATCTATCAAAATTCCTCCAGTAAAAGAAAAGA GAAAAC TTCTTTTTTAGTTATTTAAATGAATCCTCTTTTCCGAATCTAATTAAACCCCCACGAAAAAAGTTAACACTCTAATTTTCATGATTTTTTTATGATCCTATCTTGATTACGCCCAATTCCCTGTTC。

[0103] (2)Detection results of primer pair rpoC2-01

[0104] The detection results are as Figure 3 shown. After sequencing and identification analysis, the sequences of the PCR amplification products of all Wuzhishan Camellia oleifera samples are shown in SEQ ID NO.12, and the "ATACCT" base sequence (i.e., InDel site 2) is missing after the 91st base of the sequence shown in SEQ ID NO.12. The sequences of the PCR amplification products of all Hainan Camellia oleifera samples are shown in SEQ ID NO.13, and the "ATACCT" base sequence is present at the corresponding position.

[0105] InDel site 2 and its flanking sequences are as follows:

[0106] Wuzhishan Camellia oleifera (SEQ ID NO.12):

[0107] TCCCGACCTCTTTCTTCTGTATCGAGGATCATCGAAATAAGCAAGAATACTCTTTCTACGGAAAATACCATTTATGGGTATTTCAATCGAA------GAAGGGGGCATTAGTTCTTTCTCTCGTTCTTGAATCGAATGGAGTGGAATGATGAATCTATTTCTTCGCCTCTTTGCCAATAAATCCGAATTATCGTGGAGAATGGAAGGATAGATAAGATTATAATGACCAGTGCATACGATTCG。

[0108] Camellia oleifera Abel. var. hainensis (SEQ ID NO.13, the underlined part is the base sequence deleted in Camellia oleifera Abel. var. wuzhishanensis):

[0109] TCCCGACCTCTTTCTTCTGTATCGAGGATCATCGAAATAAGCAAGAATACTCTTTCTACGGAAAATACCATTTATGGGTATTTCAATCGAA ATACCT GAAGGGGGCATTAGTTCTTTCTCTCGTTCTTGAATCGAATGGAGTGGAATGATGAATCTATTTCTTCGCCTCTTTGCCAATAAATCCGAATTATCGTGGAGAATGGAAGGATAGATAAGATTATAATGACCAGTGCATACGATTCG。

[0110] (3)Detection results of primer pair ycf1-02

[0111] The detection results are as Figure 4 shown. After sequencing and identification analysis, the sequences of the PCR amplification products of all Camellia oleifera Abel. var. wuzhishanensis samples are as shown in SEQ ID NO.14, and have the base sequence "AAAAAA" (i.e., InDel locus 3) after the 165th base of the sequence shown in SEQ ID NO.14. The sequences of the PCR amplification products of all Camellia oleifera Abel. var. hainensis samples are as shown in SEQ ID NO.15, and have a deletion of the base sequence "AAAAAA" at the corresponding position.

[0112] InDel locus 3 and its flanking sequences are as follows:

[0113] Camellia oleifera Abel. var. wuzhishanensis (SEQ ID NO.14, the underlined part is the base sequence inserted in Camellia oleifera Abel. var. wuzhishanensis):

[0114] TGCTACTTCTATCCGCGCTTTCTCTTTTCTTTTGTTCTCTTCTTTTTTGTCCTTTTCCTTTTTTTCCCTTTCTTTTATTTCTTCTTCTGTATAATCTGAAATTTTGAATTCTGCTCCCTTTCCTATACAATTTCTAAAAATGAGTTTTATCAGTTTGGAGATATC AAAAAA AAAAAAAAAAGGGTGTGATTTGTCTATTCTGTCCAAAAAAAGCGGAGAATGTGCATTTGCTTGAAAAAGTTCCCAAATAACTGTTTTACATCTTTGGGCTCGCATTGA。

[0115] Camellia hainanensis (SEQ ID NO.15):

[0116] TGCTACTTCTATCCGCGCTTTCTCTTTTCTTTTGTTCTCTTCTTTTTTGTCCTTTTCCTTTTTTTCCCTTTCTTTTATTTCTTCTTCTGTATAATCTGAAATTTTGAATTCTGCTCCCTTTCCTATACAATTTCTAAAAATGAGTTTTATCAGTTTGGAGATATC------AAAAAAAAAAGGGTGTGATTTGTCTATTCTGTCCAAAAAAAGCGGAGAATGTGCATTTGCTTGAAAAAGTTCCCAAATAACTGTTTTACATCTTTGGGCTCGCATTGA。

Claims

1. A molecular marker for identifying Camellia vietnamensis, characterized in that: The molecular marker is an InDel marker, and the InDel marker includes any one or more combinations of InDel marker 1, InDel marker 2 and InDel marker 3: The InDel marker 1 is located in the chloroplast genome trnS-GCU and trnG-GCC gene interval sequence. For Wuzhishan Camellia oleifera, its characteristic sequence is the sequence shown in SEQ ID NO.10, that is, the "GAAAAC" base sequence is missing after the 40th base of SEQ ID NO.11; The InDel marker 2 is located on the rpoC2 gene sequence of the chloroplast genome. For Wuzhishan oil-tea camellia, its characteristic sequence is the sequence shown in SEQ ID NO.12, that is, the "ATACCT" base sequence is missing after the 91st base of SEQ ID NO.13; The InDel marker 3 is located on the ycf1 gene sequence of the chloroplast genome. For Wuzhishan Camellia oleifera, its characteristic sequence is the sequence shown in SEQ ID NO.14, that is, it has a "AAAAAA" base sequence after the 165th base.

2. Use of a reagent for detecting the molecular marker according to claim 1 in identifying and differentiating Camellia vietnamensis, characterized in that: If the tested tea oil sample has the characteristic sequence shown by SEQ ID NO.10 or SEQ ID NO.12 or SEQ ID NO.14, the tested tea oil sample is judged to be Wuzhishan tea oil; otherwise, it is judged to be not Wuzhishan tea oil.

3. The application according to claim 2, characterized in that: Identify and distinguish Wuzhishan oil tea from other oil tea species, including Hainan oil tea, Vietnam oil tea, common oil tea, and large-leaf tea.

4. The application according to claim 2, characterized in that: The reagent for detecting the molecular marker according to claim 1 is a specific primer pair, The primer pair used to detect the InDel marker 1 includes the upstream and downstream primers shown in the following nucleotide sequence: trnS-trnG-01 upstream primer: 5′-CGAGCCGTATCTATCAAAATTCC-3′; trnS-trnG-01 downstream primer: 5′-GAACAGGGAATTGGGCGTAA-3′; The primer pair used to detect the InDel marker 2 includes the upstream and downstream primers shown in the following nucleotide sequence: rpoC2-01 upstream primer: 5′-TCCCGACCTCTTTCTTCTGT-3′; rpoC2-01 downstream primer: 5′-CGAATCGTATGCACTGGTCA-3′; The primer pair used to detect the InDel marker 3 includes the upstream and downstream primers shown in the following nucleotide sequence: ycf1-02 upstream primer: 5′-TGCTACTTCTATCCGCGCTT-3′; ycf1-02 downstream primer: 5'-TCAATGCGAGCCCAAAGATG-3'.

5. A detection method for identifying Wuzhishan oil-tea camellia, characterized in that, The steps include: (1) extracting genomic DNA of the tea oil sample to be tested; (2) using the genomic DNA as a template and performing PCR amplification using the specific primer pair described in claim 4; (3) sequencing the PCR amplification product, and determining whether the oil-tea camellia sample to be tested is Wuzhishan oil-tea camellia according to the sequencing result; If the PCR amplification product has the characteristic sequence shown in SEQ ID NO.10 or SEQ ID NO.12 or SEQ ID NO.14, it is determined that the tested Camellia oleifera sample is Camellia oleifera Abel; otherwise, it is determined that it is not Camellia oleifera Abel.

6. The detection method according to claim 5, wherein: The detection method is used to distinguish Camellia oleifera Abel from Camellia oleifera var. hainensis. If the PCR amplification product has the characteristic sequence shown in SEQ ID NO.11 or SEQ ID NO.13 or SEQ ID NO.15, it is determined that the tested Camellia oleifera sample is Camellia oleifera var. hainensis.

7. The detection method according to claim 5, wherein: The PCR reaction system for the PCR amplification is as follows: in a 30 μL system, it contains 20 ng of template DNA, 0.20 mmol / L of dNTPs, 0.13 μmol / L of upstream / downstream primers, 2.00 U of Taq DNA polymerase, and ddH2O is added to make up the total volume to 30 μL; The amplification reaction procedure: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 2 min, for 40 cycles; extension at 72 °C for 10 min.

Citation Information

Patent Citations

  • Method for identifying Vietnam camellia oleifera, Camellia odorata, Camellia frutescens and common Camellia oleifera

    CN114574614A

  • SNP (Single Nucleotide Polymorphism) marker for Hainan island camellia oleifera resource identification and detection method

    CN114941037A