Application of deubiquitinating enzyme USP49 in preparation of medicine for regulating and controlling esophageal cancer cell radiosensitivity

Abstract

The invention belongs to the field of biomedicine, and particularly relates to application of deubiquitinating enzyme USP49 in preparation of drugs for regulating and controlling esophageal cancer cell radiosensitivity. Ubiquitination mediated by USP49 inhibits degradation of RPA70, and promotes recruitment of RPA70 and downstream Rad51 in DSBs, so that HR is enhanced, cell proliferation is promoted, and EC cells generate resistance to IR and Olaparib. In vivo experiments prove that the knock-down of USP49 inhibits the growth of esophageal cancer and makes tumor tissues more sensitive to IR. In addition, high expression of the USP49 is in negative correlation with prognosis of EC patients receiving radical radiotherapy and chemotherapy. These findings reveal a molecular mechanism that USP49 induces EC cell radioresistance by promoting phase separation and HR.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to application of a deubiquitinating enzyme USP49 in preparing a drug for regulating the radiosensitivity of esophageal cancer cells. Background Art

[0002] EC is a common malignant tumor of the digestive system, with the morbidity and mortality ranking seventh and sixth respectively worldwide. Although the popularity of early screening has improved the early diagnosis rate of esophageal cancer, some patients are still in the locally advanced stage or have distant metastasis when diagnosed. Currently, radical chemoradiotherapy is the standard treatment option for patients with inoperable esophageal cancer. Radiotherapy, as an important means of treating esophageal cancer, has significantly improved the prognosis of patients and improved their quality of life. However, radioresistance is still one of the important reasons for the failure of EC treatment. Therefore, elucidating the molecular mechanism of EC radioresistance is crucial for the development of therapeutic targets with clinical value.

[0003] Radiotherapy mainly damages DNA double strands through physical and chemical means, so the enhancement of DDR capacity of tumor cells is one of the key factors leading to radioresistance. DDR is a complex biological process involving multiple proteins and regulated by post-translational modifications. In particular, ubiquitination modification plays an important role in DDR. Ubiquitin ligases RNF8 and RNF168 are essential for the ubiquitination of histone H2A at DSBs, thereby remodeling chromatin and promoting the recruitment of downstream DDR-related proteins such as 53BP1 and BRCA1, initiating non-homologous end joining or homologous recombination repair of the DDR pathway. With the cooperation of BARD1, BRCA1 itself acts as a ubiquitin ligase and participates in the initiation of HR rather than non-homologous end joining in the S and G2 phases of cells, thereby affecting the choice of DNA repair pathways. In addition, ubiquitination regulates the recruitment or release of key DDR-related proteins at DSBs. Ubiquitination of the 296th lysine residue of XRCC4 enhances its interaction with the Ku70 / 80 complex, promotes non-homologous end joining, and ultimately leads to cell radioresistance. RPA and Rad51 that cannot be ubiquitinated will continue to be recruited at DSBs, hindering the process of HR, making cells more sensitive to IR. Currently, a large number of studies have confirmed that ubiquitination regulates the process of DDR and thus affects the radiosensitivity of cells by activating the DDR pathway, affecting the selection of DDR pathways, and recruiting and dissociating DDR repair molecules.

[0004] Deubiquitinating enzymes (DUBs) are another important component of the ubiquitination modification system, and the latest studies have gradually revealed their important role in regulating DDR. The human genome encodes about 100 DUBs, which can be divided into seven categories according to their domains: USPs, UCHs, OTUs, MJDs, JAMMs, MINDY, and ZUFSP / ZUP1. Among them, the USPs family has the largest number and is the most widely studied. MDM2 promotes p53 degradation through ubiquitination. Some studies have further pointed out that USP7 can continuously deubiquitinate MDM2 to maintain its stability and maintain the low expression level of p53. The expression of USP7 in DDR is inhibited by PPM1G, which then downregulates MDM2 to activate P53-related pathways and promote DDR. USP51 stabilizes DGCR8 through deubiquitination, increases the recruitment of DGCR8 and RNF168 at DNA damage sites, thereby promoting histone ubiquitination, enhancing DDR and inducing radiation resistance. Jie et al. found that USP9X mediates the deubiquitination of KDM4C, thereby activating DDR-related pathways and inducing radioresistance in lung cancer cells. These studies highlight the key role of DUBs in DDR regulation and its impact on the radiosensitivity of tumor cells. In addition, the protein degradation targeted chimera (PROTAC) technology based on the ubiquitin-proteasome degradation pathway has attracted great attention from researchers due to its wide range of drug targets and low toxicity and side effects. In-depth exploration of the important role of ubiquitination in tumor radiosensitivity and the development of radiosensitizers based on PROTAC technology provide new strategies for improving or resolving tumor radioresistance.

[0005] In the present invention, we observed that USP49 was significantly upregulated after IR, formed LLPS and was recruited to DSBs. At the same time, the recruitment of USP49LLPS at DSBs required the participation of ATM. In addition, USP49 binds to and inhibits the ubiquitination degradation of RPA70. This interaction promotes the assembly of RPA70 and Rad51 at DSBs, thereby enhancing HR in an RPA70-dependent manner and inducing radioresistance in esophageal cancer cells. Summary of the invention

[0006] The present invention provides a method for preparing a drug for regulating the radiosensitivity of esophageal cancer cells using a deubiquitinating enzyme USP49.

[0007] The technical solution of the present invention is as follows:

[0008] A deubiquitinase USP49 is used in the preparation of a drug for regulating the radiosensitivity of esophageal cancer cells. The deubiquitinase USP49 regulates the radiosensitivity of esophageal cancer cells through phase separation and homologous recombination repair as a biomarker for the diagnosis, treatment and prognosis evaluation of esophageal cancer.

[0009] Recipients: pCMV-Flag-USP49, pCMV-Flag-USP49-D1, pCMV-Flag-USP49-D2, pCMV- Flag-USP49C262A, pCMV-EGFP-USP49, pCMV-HA-RPA70, pCMV-HA-RPA70-D1, pCMV- HA-RPA70-D2, pCMV-HA-RPA70-D3, pCMV-HA-RPA70-D4, pCMV-HA-RPA70-D5, PGL4 .10-USP49-luc、pRL-TK-luc、pCAGGS-I-secI、pCAGGS-mCherry、pCMV-NHEJ-GFP。

[0010] siRNA transfection:

[0011] siUCHL1#1GGACAAGAAGUUAGUCCUA;

[0012] siUCHL1#2CCGCGAAGAUGCAGCUCAA;

[0013] siUCHL3#1GGGACAAGAUGUUACAUCA;

[0014] siUCHL3#2CCAGUUUCUUAAAACAAUUA;

[0015] siUCHL5#1AGAUGUGAUUCGACAAGUA;

[0016] siUCHL5#2GCAGAAGAUAGCAGAGUUA;

[0017] siUSP1#1GGTTGCTAGTACAGCGTTT;

[0018] siUSP1#2GAGAACCAGAGACAAAACTA;

[0019] siUSP4#1GGCAGACCUUGCAGUCAAA;

[0020] siUSP4#2AGUUGAGCAAGCUAGACAA;

[0021] siUSP37#1GCUAGUAGUCACACAAA;

[0022] siUSP37#2GGAUCAGAAUAAAGGUGAA;

[0023] siUSP49#1GGTCATGCATCACGGGAAA;

[0024] siUSP49#2GGACTACGTGCTCAATGAT;

[0025] siBAP1#1GAAGGACCCACAACTACGA;

[0026] siBAP1#2GAACCGTCAGACAGTACTA;

[0027] siRPA70GACCATTTGTGCTCGTGTT;

[0028] sip53#1GGAGTATTTGGATGACAGA;

[0029] sip53#2AGAGAATCTCCGCAAGAAA;

[0030] siRNF8GGACAAUUAUGGACAACAA;

[0031] siRNF168GACACUUUCUCCAGAUA.

[0032] An immunoassay kit comprising a reagent for detecting the deubiquitinating enzyme USP49.

[0033] The beneficial effects of the present invention are as follows:

[0034] Radiotherapy is one of the important treatments for esophageal carcinoma (EC), but its efficacy is significantly reduced due to radioresistance, which usually leads to poor prognosis. Ubiquitination and deubiquitination are involved in regulating the radiosensitivity of tumors by affecting the DNA damage response (DDR). The present invention reveals the important role of the deubiquitinase USP49 in DDR and radioresistance of esophageal cancer. After ionizing radiation (IR) treatment, USP49 is transcriptionally upregulated by p53 and forms liquid-liquid phase separation (LLPS). USP49LLPS is recruited by ATM to DNA double-strand breaks (DSBs), which then promotes homologous recombination (HR) repair and increases radioresistance. In addition, USP49 interacts with the DNA binding domain B of RPA70 and promotes the deubiquitination of RPA70 through its intrinsic USP domain. USP49-mediated deubiquitination inhibits the degradation of RPA70 and promotes the recruitment of RPA70 and downstream Rad51 at DSBs, thereby enhancing HR, promoting cell proliferation, and making EC cells resistant to both IR and Olaparib. In vivo experiments confirmed that knocking down USP49 inhibited the growth of esophageal cancer and made tumor tissue more sensitive to IR. In addition, high expression of USP49 was negatively correlated with the prognosis of EC patients receiving radical chemoradiotherapy. These findings reveal the molecular mechanism by which USP49 induces EC cell radioresistance by promoting phase separation and HR. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic representation of the present invention showing that USP49 is a DUB that promotes radioresistance via DDR in ECs.

[0036] Figure: A. A heat map showing the role of 94 DUBs in DDR from three dimensions based on Nishi's study: DSB localization, effect on DDR, and increase in tail moment. The location of DSBs is divided into two categories: 0 (no effect) and 1 (recruitment). The tail moment is also scored according to the degree of increase in tail moment: 0 (no increase in tail moment) or 1 (increase in tail moment). B. CNV heat map of 8 DDR-related DUBs in EC generated using cBioPortal. C. Histogram of USP49 CNV analyzed and generated in the Pan-Cancer TCGA dataset by cBioPortal. D. Histogram of mRNA expression of 8 DDR-related DUBs in EC and normal tissues in the TCGA database analyzed using UALCAN. E. Histogram of the average relative mRNA expression levels of 8 DUBs after using siRNA to inhibit the expression of the corresponding genes. F. Cloning experiment analyzes the effect of knocking down 8 DUBs on IR sensitivity in EC cells. GH. Functional enrichment analysis results of genes positively correlated (correlation coefficient > 0.3) or negatively correlated (correlation coefficient < -0.3) with USP49 in TCGA obtained from UALCAN using Metascape.

[0037] Figure 2 This is a schematic diagram of the in vitro experiments of the present invention confirming that USP49 promotes tumor proliferation and radiation resistance.

[0038] In the figure: A. Western blot shows the protein expression level of USP49 in normal esophageal epithelial cells HEEC and three esophageal cancer (EC) cell lines. BC. Inhibition and overexpression of USP49 were verified by RT-PCR and Western blot. D. CCK-8 experiment detected the effect of USP49 knockdown on cell proliferation. E. Representative microscopic images of EdU-positive cells after changing USP49 expression. F. Bar graph shows the average proportion of EdU-positive cells in microscopic images. GH. Cloning experiment evaluated the effect of changes in USP49 expression on the radiosensitivity of EC cells, revealing the important role of USP49 in inducing radioresistance.

[0039] Figure 3 FIG. 4 is a schematic diagram showing that USP49 of the present invention induces resistance of EC cells to IR and Olaparib by promoting homologous recombination (HR).

[0040] In the figure: A. Representative microscopic images of USP49 cellular localization at different time points after linear DNA double-strand breaks (DSBs) were generated by laser. The graph shows the relative average intensity of GFP-USP49 at laser-induced DSBs. B. Western blot images of co-immunoprecipitation (Co-IP) experiments showing the interaction between exogenous USP49 and IR-induced γ-H2AX. CF. Representative microscopic images of γ-H2AX foci at the indicated time points after exposure to IR after USP49 knockdown (C, E) or overexpression (D, F). The bar graph shows the average proportion of γ-H2AX-positive (>20 foci) cells among all cells in these microscopic images (n>100). G. Validation of USP49 inhibition and overexpression in U2OS cells using Western blot. HI. Bar graphs showing the effect of USP49 inhibition or overexpression on the efficiency of non-homologous end joining (NHEJ) (H) and homologous recombination (HR) (I). JK. Bar graph showing the effect of USP49 knockdown on cell viability after treatment with different concentrations of Olaparib. LM. Clonogenic assay to examine the sensitivity of EC cells to Olaparib treatment after USP49 inhibition (L) or overexpression (M).

[0041] Figure 4 This is a schematic diagram showing that USP49 of the present invention promotes the proliferation and radioresistance of EC xenograft tumors and predicts a poor prognosis.

[0042] In the figure: A. Schematic diagram of the experimental design used to verify the biological function of USP49 in vivo. BC. Photos of the established USP49 knockdown animal model and the tumors collected from each group of mice. D. Growth curves of xenograft tumors in each group. EF. Western blot images of USP49 protein expression levels in xenograft tumors in each group. G. Representative microscopic images of immunohistochemical staining of USP49 and γ-H2AX in tumors in each group. H. Kaplan-Meier curves of survival data of EC patients with high (n=143) or low (n=39) USP49 mRNA expression were analyzed and generated using GEPIA2.0. I. Representative microscopic images of immunohistochemical staining of USP49 protein expression in tumors of EC patients who received only radical chemotherapy. J. Kaplan-Meier curves showing the survival rate of EC patients who received only radical chemotherapy and had high (n=11) or low (n=13) USP49 protein expression.

[0043] Figure 5 Schematic diagram of USP49 of the present invention deubiquitinating and stabilizing RPA70 through its USP domain.

[0044] In the figure: A. Venn diagram showing the intersection between proteins related to HR repair obtained from the GO database (n=226) and proteins that may interact with USP49 identified by mass spectrometry analysis (n=146). BD used ZDOCK to predict and visualize the top three docking models of USP49 and RPA70 and evaluated them using PDBePISA. E. Western blot image of Co-IP experiment showing the interaction between exogenous USP49 and endogenous RPA70. F. Western blot image of Co-IP experiment showing the interaction between endogenous USP49 and exogenous RPA70. GH. Schematic diagram of truncation mutants of USP49 (G) and RPA70 (H). I. Western blot image of Co-IP experiment showing the interaction between exogenous USP49 truncation mutants and RPA70. Full-length exogenous USP49 was used as a positive control. J. Western blot images of Co-IP experiments show the interaction between exogenous RPA70 truncation mutants and USP49. Full-length exogenous RPA70 was used as a positive control. KL. Western blot images show the protein expression of USP49 and RPA70 at different time points after CHX treatment and USP49 knockdown in KYSE-30 (K) and ECA-109 (L) cells. shCtrl was used as a control group. The bar graph shows the relative amount of RPA70 protein expression relative to the group not treated with CHX. M. Western blot results of ubiquitination experiments show that USP49 inhibits the ubiquitination of RPA70. N. Western blot results of ubiquitination experiments show that USP49 reverses IR-induced RPA70 ubiquitination. O. Western blot results of ubiquitination experiments show that USP49 inhibits the ubiquitination of RPA70 mainly through its own USP domain. P. Western blot results of ubiquitination experiments showed that USP49 reversed IR-induced RPA70 ubiquitination mainly through its own USP domain.

[0045] Figure 6 This is a schematic diagram showing that USP49 of the present invention promotes HR through RPA70 and induces resistance of EC cells to IR and Olaparib.

[0046] In the figure: AC. Western blot images show the expression of USP49 and RPA70 proteins in EC cells (AB) and U2OS cells (C) transfected with shUSP49 and RPA70 plasmids separately or co-transfected. D. The bar graph shows the efficiency of HR under different treatment conditions, indicating that USP49 promotes HR through RPA70. EF. Representative microscopic images of -H2AX foci at different time points after exposure to IR under different treatment conditions. The bar graph shows the average proportion of -H2AX-positive (>20 foci) cells in all cells (n>100) in these microscopic images. G. Representative microscopic images of EdU-positive cells 2 hours after exposure to IR under different treatment conditions. The bar graph shows the average proportion of EdU-positive cells in the images. H. Representative microscopic images of EdU-positive cells after 48 hours of treatment with 100 μM Olaparib under different treatment conditions. The bar graph shows the average proportion of EdU-positive cells in the images. IJ. The sensitivity of EC cells to IR (I) or Olaparib (J) treatment after USP49 knockdown and RPA70 overexpression was tested by clonogenic assay.

[0047] Figure 7 Schematic diagram of the USP49 of the present invention promoting HR and inducing EC cells resistance to IR and Olaparib by deubiquitinating RPA70 through its USP domain.

[0048] Figures: A-C. Representative images of Western blots showing protein expression levels of USP49 and its truncation mutants under specific treatment conditions in EC (A-B) and U2OS cells (C). D. Bar graph showing HR efficiency in cells transfected with different USP49 mutant plasmids. EF. Representative microscopy images of IF experiments showing the number of -H2AX foci at different time points after IR treatment in KYSE-30 (E) and ECA-109 (F) cells transfected with specific siRNAs and plasmids. GH. Bar graphs depicting the average proportion of -H2AX-positive (>20 foci) cells in microscopy images to all cells (n>100). I. Representative microscopy images of EdU-positive cells 2 hours after IR exposure and under different treatment conditions. The bar graph shows the average proportion of EdU-positive cells in the images. J. Representative microscopy images of EdU-positive cells after 48 hours of Olaparib100M treatment after different treatments. The bar graph shows the average proportion of EdU-positive cells in the images. KL. Clonogenic assay was used to examine the sensitivity of EC cells transfected with USP49 truncation mutants to IR (K) or Olaparib (L) treatment after knockdown of endogenous USP49.

[0049] Figure 8 Schematic diagram of the present invention showing that LLPS recruitment of USP49 at DNA DSBs and its mediated radioresistance are dependent on ATM.

[0050] In the figure: A. Graph showing the disorder tendency of USP49. B. Time-lapse microscopy images showing the fusion and fission of GFP-USP49 puncta. C. Representative images of microscopy images showing the changes of GFP-USP49 puncta in EC cells under the indicated treatments. The bar graph shows the average proportion of cells with GFP-USP49 puncta in the image. D. Time-lapse microscopy images of GFP-USP49 puncta before and after photobleaching. The curves show the relative average intensity of GFP-USP49 puncta. EI. Representative images of microscopy images of USP49 localization at DSBs in EC cells under the indicated treatments. The curves depict the relative average intensity of GFP-USP49 at DSBs. JK. Western blot images of co-immunoprecipitation (Co-IP) analysis showing the interaction of exogenous USP49 with IR-induced γ-H2AX under different treatments. LM. Clonogenic survival assay to detect the sensitivity of EC cells to IR under the indicated treatments. N. Schematic diagram depicting the mechanism by which USP49 regulates HR and promotes radioresistance in EC cells. This figure was drawn using Figdraw.

[0051] Fig. 9 Schematic diagram of representative microscopic images of the neutral comet assay of the present invention.

[0052] In the figure: A. Representative microscopic images of neutral comet assay showing IR-induced DNA damage after USP49 knockdown. shCtrl-transfected cells that were not treated with IR served as the control group. The bar graph shows the quantitative results of the tail movement of each group. B. Representative microscopic images of neutral comet assay showing IR-induced DNA damage after USP49 overexpression. The bar graph shows the quantitative results of the tail movement of each group. C. Representative Western blot images of USP49 protein expression in EC cells with stable USP49 knockdown constructed using shRNA. DE. Representative microscopic images of EdU-positive cells after 2 hours of IR exposure after USP49 knockdown (D) or overexpression (E). The bar graph shows the average proportion of EdU-positive cells in the image. FG. Representative microscopic images of EdU-positive cells treated with 100 μM Olaparib for 48 hours after USP49 knockdown (F) or overexpression (G). The bar graph shows the average proportion of EdU-positive cells in the image. H. Representative images of fluorescence intensity in xenograft tumors of mice from each group. I. Analysis and generation of a bar graph showing the mRNA expression of USP49 in different EC tumor grades.

[0053] Fig.10 GSEA of the present invention shows a schematic diagram of enhanced DNA repair in EC patients.

[0054] Figures: AB. GSEA showed enhanced DNA repair in EC patients, especially increased HR. C. Kaplan-Meier analysis of the GSE53625 dataset showed that higher RPA70 levels were associated with poor prognosis in EC patients. DE. GSEA showed enhanced DNA repair, especially HR, in EC patients with higher RPA70 expression. F. Bubble chart of KEGG analysis showed DEGs between high and low RPA70 expression groups. G. Bar chart shows significant GSVA results of 50 landmark genes between high and low RPA70 expression groups (P<0.05). H. Representative microscopy images showing colocalization of RPA70 and USP49. The curves depict the fluorescence intensity of RPA70 and USP49 in the specified linear regions in these images.

[0055] Fig.11 Schematic diagram of Western blot images of USP49 and RPA70 protein expression after separate or co-transfection of siRPA70 and USP49 plasmids of the present invention.

[0056] Figures: AC. Western blot images of USP49 and RPA70 protein expression after transfection of siRPA70 and USP49 plasmids separately or co-transfected in EC cells (AB) and U2OS cells (C). D. Bar graphs show the efficiency of HR under different treatments, indicating that USP49 promotes HR through RPA70. EF. Representative microscopic images of -H2AX foci at the indicated times after exposure to IR and under different treatments. The bar graph shows the average proportion of -H2AX-positive cells (>20 foci) in all cells (n>100) in these microscopic images. G. Representative microscopic images of EdU-positive cells 2 hours after exposure to IR and under different treatments. The bar graph shows the average proportion of EdU-positive cells in the images. H. Representative microscopic images of EdU-positive cells after treatment with 100M Oraparib for 48 hours after different treatments. The bar graph shows the average proportion of EdU-positive cells in the images. IJ. Clonal survival assay was used to detect the sensitivity of EC cells to IR (I) or Olaparib (J) after knockdown of RPA70 and overexpression of USP49.

[0057] Fig.12 Schematic diagram of representative microscopic images of RPA70 foci of cells of the present invention at different time points after IR treatment.

[0058] In the figure: AB. Representative microscopic images of RPA70 foci at different time points after IR treatment in cells with USP49 knockdown (A) or overexpression (B). The dot plots show the quantification of RPA70 foci per cell when USP49 was knocked down or overexpressed (n>100). C. Western blot images of Co-IP experiments showing the interaction between USP49 and -H2AX under the indicated treatments. DF. Representative microscopic images of RPA70 and Rad51 foci at different time points under different treatments after exposure to IR (DE). The dot plots show the quantification of RPA70 and Rad51 foci per cell (n>100) (F). G. Representative microscopic images of GFP-USP49 localization at different time points after linear DSBs (double-strand breaks) were generated by laser and endogenous RPA70 was knocked down. The curves show the relative average intensity of GFP-USP49 at laser-induced DSBs. H. Western blot images of Co-IP experiments showing the interaction between USP49 and -H2AX under the indicated treatments.

[0059] Fig.13 This is a schematic diagram of 24 hours after the treatment of the present invention.

[0060] In the figure: A. The bar graph shows the mean value of USP49 mRNA expression within 24 hours after IR treatment relative to cells not exposed to IR. B. Representative Western blot images show the expression of USP49 and γ-H2AX proteins within 24 hours after a given dose of X-ray treatment. C. Representative Western blot images show the expression of USP49 and γ-H2AX proteins in EC cells exposed to IR at different time points. D. The bar graph shows the mean relative value of USP49 mRNA expression after endogenous p53 was knocked down and under different treatment conditions. Cells transfected with siCtrl and not treated with IR were used as controls. E. The scatter plot shows the Pearson correlation coefficient of USP49 and p53 mRNA expression in EC tissues from TCGA and GEO databases. FG. Representative Western blot images show the expression of USP49 and p53 proteins in KYSE-30 (F) and ECA-109 (G) cells at different time points after IR treatment and p53 knockdown. The bar graphs show the average relative values ​​of USP49 protein expression levels in KYSE-30 and ECA-109 cells at different time points after IR treatment and p53 knockdown. Cells not treated with IR were used as a control group. HI. USP49 Chip-Seq peak graph after p53 knockdown (H) and IR treatment (I) in the GEO database. J. The bar graph shows the average relative values ​​of luciferase activity after different treatments. Cells transfected with siCtrl were used as a control. K. The bar graph shows the expression of USP49 mRNA in EC under different p53 mutation states. L. Schematic diagram showing the types and frequencies of p53 mutations in EC samples from TCGA generated using cBioPortal. M. USP49 Chip-Seq peak graph after p53 mutation in the GEO database. DETAILED DESCRIPTION

[0061] The following is combined with Figure 1-Figure 13 And embodiments further illustrate the present invention.

[0062] Embodiment 1.

[0063] A deubiquitinase USP49 is used in the preparation of a drug for regulating the radiosensitivity of esophageal cancer cells. The deubiquitinase USP49 regulates the radiosensitivity of esophageal cancer cells through phase separation and homologous recombination repair as a biomarker for the diagnosis, treatment and prognosis evaluation of esophageal cancer.

[0064] Recipients: pCMV-Flag-USP49, pCMV-Flag-USP49-D1, pCMV-Flag-USP49-D2, pCMV- Flag-USP49C262A, pCMV-EGFP-USP49, pCMV-HA-RPA70, pCMV-HA-RPA70-D1, pCMV- HA-RPA70-D2, pCMV-HA-RPA70-D3, pCMV-HA-RPA70-D4, pCMV-HA-RPA70-D5, PGL4 .10-USP49-luc、pRL-TK-luc、pCAGGS-I-secI、pCAGGS-mCherry、pCMV-NHEJ-GFP。

[0065] siRNA transfection:

[0066] siUCHL1#1GGACAAGAAGUUAGUCCUA;

[0067] siUCHL1#2CCGCGAAGAUGCAGCUCAA;

[0068] siUCHL3#1GGGACAAGAUGUUACAUCA;

[0069] siUCHL3#2CCAGUUUCUUAAAACAAUUA;

[0070] siUCHL5#1AGAUGUGAUUCGACAAGUA;

[0071] siUCHL5#2GCAGAAGAUAGCAGAGUUA;

[0072] siUSP1#1GGTTGCTAGTACAGCGTTT;

[0073] siUSP1#2GAGAACCAGAGACAAAACTA;

[0074] siUSP4#1GGCAGACCUUGCAGUCAAA;

[0075] siUSP4#2AGUUGAGCAAGCUAGACAA;

[0076] siUSP37#1GCUAGUAGUCACACAAA;

[0077] siUSP37#2GGAUCAGAAUAAAGGUGAA;

[0078] siUSP49#1GGTCATGCATCACGGGAAA;

[0079] siUSP49#2GGACTACGTGCTCAATGAT;

[0080] siBAP1#1GAAGGACCCACAACTACGA;

[0081] siBAP1#2GAACCGTCAGACAGTACTA;

[0082] siRPA70GACCATTTGTGCTCGTGTT;

[0083] sip53#1GGAGTATTTGGATGACAGA;

[0084] sip53#2AGAGAATCTCCGCAAGAAA;

[0085] siRNF8GGACAAUUAUGGACAACAA;

[0086] siRNF168GACACUUUCUCCAGAUA.

[0087] Embodiment 2.

[0088] An immunoassay kit comprising a reagent for detecting the deubiquitinating enzyme USP49.

[0089] Materials and Methods

[0090] Cell lines and culture

[0091] Human epithelial cell line HEEC and three human esophageal cancer cell lines KYSE-30, ECA-109 and KYSE-150 were cultured in RPMI-1640 medium (KeyGENBioTECH, China) containing 10% fetal bovine serum (FBS; VivaCell, China). U2OS cells and U2OS-DR-GFP cells were cultured in DMEM (Gibco, USA) containing 10% FBS. All cells were authenticated by STR testing and cultured in an incubator at 37°C and 5% CO2.

[0092] Plasmids, siRNA, and transfection

[0093] The plasmids used in the present invention include: pCMV-Flag-USP49, pCMV-Flag-USP49-D1, pCMV-Flag-USP49-D2, pCMV-Flag-USP49C262A, pCMV-EGFP-USP49, pCMV-HA-RPA70, pCMV-HA-RPA70-D1, pCMV-HA-RPA70-D2, pCMV-HA-RPA70-D3, pCMV-HA-RPA70-D4, pCMV-HA-RPA70-D5, PGL4.10-USP49-luc, pRL-TK-luc, pCAGGS-I-secI, pCAGGS-mCherry, pCMV-NHEJ-GFP. PGL4.10-USP49-luc and pRL-TK-luc were purchased from Tsingke Biotech (China). pCAGGS-I-secI, pCAGGS-mCherry and pCMV-NHEJ-GFP were provided by Dr. Ma Chengxian (National Center for Protein Science, Beijing). All other plasmids were purchased from MiaoLingBiology (China). All siRNAs used in the present invention were purchased from RiboBio (China) or TsingkeBiotech (China). siRNAs and their sequences are as follows:

[0094] siUCHL1#1GGACAAGAAGUUAGUCCUA;

[0095] siUCHL1#2CCGCGAAGAUGCAGCUCAA;

[0096] siUCHL3#1GGGACAAGAUGUUACAUCA;

[0097] siUCHL3#2CCAGUUUCUUAAACAAUUA;

[0098] siUCHL5#1AGAUUGUGAUUCGACAAGUA;

[0099] siUCHL5#2GCAGAAGAUAGCAGAGUUA;

[0100] siUSP1#1GGTTGCTAGTACAGCGTTT;

[0101] siUSP1#2GAGAACCAGAGACAAACTA;

[0102] siUSP4#1GGCAGACCUUGCAGUCAAA;

[0103] siUSP4#2AGUUGAGCAAGCUAGACAA;

[0104] siUSP37#1GCCUAGUAGUUCACUACAA;

[0105] siUSP37#2GGAUCAGAAUAAAGGUGAA;

[0106] siUSP49#1GGTCATGCATCACGGGAAA;

[0107] siUSP49#2GGACTACGTGCTCAATGAT;

[0108] siBAP1#1GAAGGACCCACAACTACGA;

[0109] siBAP1#2GAACCGTCAGACAGTACTA;

[0110] siRPA70GACCATTTGTGCTCGTGTT;

[0111] sip53#1GGAGTATTTGGATGACAGA;

[0112] sip53#2AGAGAATCTCCGCAAGAAA;

[0113] siRNF8GGACAAUUAUGGACAACAA;

[0114] siRNF168GACACUUUCUCCAGAUA.

[0115] These plasmids and siRNA were transfected using JetPRIME (Polyplus, France).

[0116] Construction of stable USP49 knockdown cell lines

[0117] Lentiviruses used to construct shCtrl and shUSP49 were purchased from Genechem (China). To construct USP49 knockdown cells, lentiviruses were transfected into designated cells using HitransGP. Then, transfected cells were cultured in a medium containing 2 μg / mL puromycin until there was no obvious cell death. The knockdown of USP49 protein was confirmed by Western blot. The constructed stable USP49 knockdown cells were cultured in a medium containing 1 μg / mL puromycin.

[0118] Quantitative real-time PCR (qRT-PCR)

[0119] RNA extraction and qRT-PCR were performed as described previously. The primers used were as follows:

[0120] UCHL1 forward primer: 5′-GGAGTGGTGCCTCATGGAAA-3′;

[0121] UCHL1 reverse primer: 5′-CCTGCTGGTTCTTCTCCTGG-3′;

[0122] UCHL3 forward primer: 5′-GGAGAGGGCTGTGGATTCAG-3′;

[0123] UCHL3 reverse primer: 5′-TTGGTGACCCTCTTAACCGC-3′;

[0124] UCHL5 forward primer: 5′-ATTGGGTAGGTGAAGTCGCT-3′;

[0125] UCHL5 reverse primer: 5′-GGGCAAGCTATCTTGGGAAC-3′;

[0126] USP1 forward primer: 5′-TTCAAGAAACATGCCAACTCCT-3′;

[0127] USP1 reverse primer: 5′-CAGAATGCCTCATACTGTCCATC-3′;

[0128] USP4 forward primer: 5′-CAAAATCAAGCACTGCGCCT-3′;

[0129] USP4 reverse primer: 5′-ATGAGAGGATGGTGGCTCCT-3′;

[0130] USP37 forward primer: 5′-TTCCATTACCCTCGGCTCCT-3′;

[0131] USP37 reverse primer: 5′-GGCTTTGTTTCGCTCCACTG-3′;

[0132] USP49 forward primer: 5′-GCGTGCTGATGATGGCGATT-3′;

[0133] USP49 reverse primer: 5′-TGGTGGCACACTCTAAGCAG-3′;

[0134] BAP1 forward primer: 5′-GCGTTCCACTTTGTCAGCTATG-3′;

[0135] BAP1 reverse primer: 5'-TGTCTGTCCACTCCTCGTCCTC-3'.

[0136] Public database acquisition and analysis

[0137] The copy number variations (CNVs) of USP49 in various cancers, especially EC, were analyzed through the cBioPortal website (https: / / www.cbioportal.org / ). The expression of these DUBs, including UCHL1, UCHL3, UCHL5, USP1, USP4, USP37, USP49, and BAP1, in normal tissues and EC tissues were analyzed using the UALCAN database (https: / / ualcan.path.uab.edu / index.html). Genes with a Pearson correlation coefficient greater than 0.3 or less than -0.3 with USP49 were retrieved from the UALCAN database, and functional enrichment analysis of these related genes was performed using Metascape (https: / / www.metascape.org). The GEPIA database was used to explore the correlation between USP49 expression and disease-free survival (DFS) of EC patients. The GSE53625 dataset downloaded from the GEO database contains 179 pairs of EC tissue and adjacent tissue samples with survival information. Differential expression analysis was performed using the “limma” R package, and genes with a false positive rate (FDR) < 0.05 and |log(foldchange)| > 1 were defined as differentially expressed genes (DEGs). Kaplan-Meier analysis was performed using the “survminer” R package. Functional enrichment analysis, including KEGG, GSVA, and GSEA analysis, was performed using the “clusterProfiler” and “GSVA” R packages. All analyses were performed using Rv4.1.1 version.

[0138] Clone survival assay

[0139] The sensitivity of EC cells to IR or Olaparib was assessed by clonogenic survival assay as described previously. 50 Briefly, the day after cells were seeded in six-well plates, cells were treated with corresponding doses of X-ray or Olaparib. After 10 to 14 days, clones were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet (Biosharp, BS941). Then, clones were scanned and counted using ImageJv1.53a.

[0140] Western Blot

[0141] The cells were lysed using RIPA lysis buffer (KeyGEN, China) and a protease inhibitor cocktail (MCE, USA). After sonication, the cells were centrifuged at 12,000 × r for 10 minutes at 4°C. After the protein concentration was determined using a BCA protein assay kit (Beyotime, China), the cell lysate was boiled at 100°C for 10 minutes. Then, the cell lysate was separated by 10% SDS-PAGE (EpiZyme, China), and the proteins were transferred to a PVDF membrane (Millipore, USA). After transfer, the membrane was blocked with 5% skim milk powder and incubated overnight at 4°C. The next day, the membrane was washed with TBST and then incubated with the secondary antibody at room temperature for 1 hour. Protein bands were detected using enhanced chemiluminescence (ECL) detection reagents (KeyGEN, China) and Tanon5260 multi-system (Tanon, China). The primary and secondary antibodies used were as follows: rabbit anti-USP49 (1:1000; HPA030254; Atlas Antibodies, USA); rabbit anti-Flag (1:400; F7425; Sigma, USA); mouse anti-Flag (1:1000; F1804; Sigma, USA); rabbit anti-RAP70 (1:1000; 2267S; CST, USA); rabbit anti-γ-H2AX (Ser139) (1:1000; 2577; CST, USA); rabbit anti-p53 (1:5000; 10442-1-AP; Proteintech, USA) ; rabbit anti-HA (1:1000; AF0039; Beyotime, China); mouse anti-ubiquitin (1:1000; sc-271289; Santa, USA); mouse anti-RNF8 (1:1000; sc-271462; Santa, USA); mouse anti-RNF168 (1:1000; sc-101125; Santa, USA); HRP-labeled goat anti-mouse IgG secondary antibody (1:10000; A21010; Abbkine, USA); HRP-labeled goat anti-rabbit IgG secondary antibody (1:10000; A21020; Abbkine, USA).

[0142] CCK8 experiments

[0143] To evaluate the viability of EC cells, CCK8 assay was performed after 2000 cells were seeded per well in a 96-well plate. After 6 hours of incubation, the medium was replaced and incubated for 1 hour in a 10% CCK8 medium (MCE, USA), and then the optical density (OD) was measured at 450 nm using an iMark Microplate absorbance reader (Bio-Rad, USA). Subsequently, the OD values ​​at 24, 48, 72, and 96 hours were obtained in the same manner.

[0144] EdU experiments

[0145] The proliferation capacity of EC cells was assessed by EdU assay as described previously. 50 Briefly, cells were incubated in a medium containing 50 μM EdU for 2 h, fixed with 4% paraformaldehyde, and neutralized with glycine solution (2 mg / mL). Subsequently, cells were permeabilized with 0.5% Triton X-100 and stained according to the instructions of Cell-Light Ed U Apollo 567 In Vitro Kit (RiboBio, China).

[0146] X-ray radiation and laser micro-irradiation

[0147] In the present invention, an XCELL160 stand-alone X-ray radiation system (KUBTEC, USA) was used to perform X-ray radiation of cells, with the voltage and current set to 160 kV and 18.6 mA, respectively, to maintain a dose rate of 1 Gy / min.

[0148] Laser micro-irradiation was used to study protein localization at DSBs. Cells were seeded in 35 mm confocal culture dishes and transfected with GFP-USP49 plasmid. 48 hours after transfection, cells were incubated in fresh medium containing Hoechst33258 (Sigma, USA) for 0.5 to 1 hour. Laser micro-irradiation was performed using a Nikon C2 confocal system (Nikon, Japan). After acquiring three images, a 450 nm laser was used to treat the linear region of the nucleus at 8 fps for 30 seconds, followed by 5 minutes of imaging at 15 second intervals. For FRAP experiments, a 488 nm laser was used to bleach GFP-tagged USP49 at 10% laser power. After bleaching, images were taken at 10 second intervals for 10 minutes.

[0149] Immunofluorescence (IF)

[0150] After the cells were seeded in the confocal culture dish, a certain dose of X-ray radiation was given. After a certain period of time, the cells were fixed with 4% paraformaldehyde for 20 minutes at room temperature. To analyze the aggregation formation of RAP70 and Rad51, the cells were pretreated with CSK+RNase buffer (10mM pH 7.0 PIPES / NaOH, 100mM NaCl, 300mM sucrose, 3mM MgCl2, 1mM EGTA, 0.7% TritonX-100, 0.3mg / mL RNaseA) for 5 minutes before fixation. Then, the cells were treated with TritonX-100 for 30 minutes and blocked with 3% BSA for 1 hour at room temperature, and then incubated with the primary antibody at 4°C overnight. The next day, the secondary antibody was incubated for 1 hour at room temperature in the dark, and the final experiment was stained with Hoechst332258 for 30 minutes. The NikonC2 confocal system was used for photography.

[0151] The antibodies used for IF were as follows: rabbit anti-RPA70 (1:75; 2267S; CST, USA); mouse anti-Rad51 (1:50; sc-398587; Santa Clara, USA); rabbit anti-γ-H2AX (Ser139) (1:300; 2577; CST, USA); mouse anti-γ-H2AX (Ser139) (1:100; JBW301; Millipore, USA); AlexaFluor TM 594-labeled goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody (1:200; A11012; ThermoFisher, USA); AlexaFluor TM 594-labeled goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody (1:200; A11005; ThermoFisher, USA); AlexaFluor TM 488-labeled goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody (1:500; A0423; Beyotime, China); AlexaFluor TM 488-labeled goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody (1:500; A0428; Beyotime, China).

[0152] NHEJ reporter experiments

[0153] 48 hours after cells were transfected with siRNA or plasmid, pCAGGS-mCherry and pCMV-NHEJ-GFP (linearized with HindIII restriction enzyme) were transfected. Pictures were taken using an AxioVertA1 microscope (Zeiss, Germany). NHEJ efficiency = GFP positive cells / Cherry positive cells × 100%.

[0154] HR Reporting Experiment

[0155] U2OS cells carrying DR-GFP were transfected with siRNA or plasmid for 48 hours, and then transfected with pCAGGS-mCherry and pCAGGS-I-secI (to generate DSBs). After incubation for 48 hours, the cells were photographed using an AxioVertA1 microscope. HR efficiency = GFP-positive cells / Cherry-positive cells × 100%.

[0156] Animal models

[0157] Stable USP49 knockdown ECA-109 cell line (shUSP49) and negative control ECA-109 cell line (shCtrl) were established for the construction of xenograft mouse models. 7The concentration of shCtrl and shUSP49 was suspended in PBS and then injected subcutaneously into BALB / c nude mice (the mice were randomly divided into two groups [shCtrl and shUSP49], 8 mice in each group). The tumor volume was measured every 3 days starting from day 10 and calculated using the following formula: volume = length × width 2 / 2. When the tumor volume reaches 100-200mm 3 Each group was randomly divided into two subgroups (4 mice in each group, one group received X-ray irradiation). X-ray irradiation was performed every two days using an X-ray irradiator (RADSOURCE, USA). Finally, the mice received 16Gy (4Gy×4 times) of X-ray irradiation.

[0158] Human EC tissue collection and immunohistochemistry (IHC)

[0159] Clinical data of 294 EC patients who received radiotherapy only from January 2015 to December 2016 were collected. After excluding patients without corresponding tumor tissues, 24 EC patients were finally included. IHC staining was performed and analyzed independently by two pathologists. The staining intensity ranged from 0 to 3. The staining range ranged from 0% to 100%, and the score was divided into four levels: 0 (0%), 1 (1% to 25%), 2 (26% to 50%), 3 (51% to 75%), and 4 (76% to 100%). The final score of each section was defined as the product of the staining intensity and the range.

[0160] Co-immunoprecipitation (Co-IP)

[0161] The collected cells were lysed on ice with RIPA (weak) lysis buffer (Beyotime, China) containing 1% protease inhibitor cocktail (MCE, USA) and 1mMPMSF (Beyotime, China) for 20 minutes. After ultrasonic treatment, centrifugation was performed at 12000×r for 10 minutes at 4°C. Then, the supernatant was incubated overnight at 4°C with M2 affinity gel (Sigma, USA) against FLAG or HA. The next day, the cells were washed 3 times with RIPA lysis buffer and finally boiled at 100°C for 5 minutes.

[0162] Molecular docking

[0163] In order to perform molecular docking based on the 3D structure, we first obtained the 3D spatial structure file of RPA70 from RCSBPDB (4GOP). Then, we obtained the predicted 3D spatial structure model file of USP49 from AlphaFoldDB. Next, we used ZDOCK 51 , molecular docking was performed on these two files, and the top three prediction results were evaluated using the PDBePISA online tool.

[0164] Ubiquitination reporter assay

[0165] To investigate the ubiquitination level of RPA70, cells were transfected with HA-RPA70, Flag-USP49, Flag-USP49-D1, Flag-USP49-D2, or Flag-USP49C262A plasmids and treated with 10 μM MG132 for 6 hours before harvesting. The harvested cells were lysed using RIPA (weak) lysis buffer. The lysate was incubated with anti-HAM2 affinity gel overnight at 4°C, washed 3 times with RIPA lysis buffer, and then boiled and eluted. The proteins in the lysate were separated by 10% SDS-PAGE, and the ubiquitination level of RPA70 was assessed using ubiquitin antibodies.

[0166] Dual luciferase reporter gene assay

[0167] To examine whether p53 regulates the transcriptional efficiency of USP49 after IR, cells were transfected with p53 siRNA, PGL4.10-USP49-luc, or pRL-TK-luc plasmids and IR-treated 24 h after transfection. Then, cells were lysed with 1× PLB 48 h after transfection, and the lysate was transferred to a new 1.5 mL tube. Next, dual-luciferase The lysates were treated according to the instructions of the ELISA reporter system (Promega, USA), and the samples were analyzed using a SpectraMax iD3 microplate reader (Molecular Devices, USA).

[0168] Neutral comet assay

[0169] Neutral comet assay is also used to study the extent of DNA damage. 48 hours after cells were transfected with corresponding siRNA or plasmid, 6GyX-ray irradiation was given. After 2 hours of incubation, 1×10 6 / mL of cell suspension. Next, the neutral comet assay was performed according to the instructions of the DNA damage detection kit (KeyGEN, China), and the results of each section were analyzed using ImageJ. Each group included 50 to 100 cells.

[0170] Ethical approval

[0171] The animal experiments were approved by the IACUC of Nanjing Medical University. The collection of EC patient tissues was approved by the Affiliated Cancer Hospital of Nanjing Medical University.

[0172] Statistical analysis

[0173] All statistical analyses were performed using GraphPad Prism 9 software, using Student's t test and ANOVA, depending on the type of analysis being performed. All data are presented as mean values, and P < 0.05 was considered statistically significant.

[0174] result:

[0175] Screening for deubiquitinases that induce radioresistance in esophageal cancer via DDR

[0176] Radiotherapy kills tumor cells mainly by inducing DNA damage, especially lethal double-strand breaks. Gene set enrichment analysis showed that the activity of DNA repair pathways was increased in esophageal cancer (Figure S2A-B), suggesting that esophageal cancer has radioresistance. Although a large number of studies have confirmed the role of E3 ligases and ubiquitination processes in DDR and radiosensitivity, in order to screen DUBs associated with esophageal cancer radioresistance, we collected 94 DUBs to systematically evaluate their effects on DNA damage response. Figure 1 As shown in A, eight DUBs (BAP1, UCHL1, UCHL3, UCHL5, USP1, USP4, USP37, and USP49) have strong DDR regulatory effects in three dimensions and are therefore selected for further screening. It is worth noting that USP49 is the only DUB with strong effects in all three dimensions. By analyzing the mutation levels of these DUBs in esophageal cancer through cBioPortal, we found that USP49 has the highest mutation frequency, and its form is mainly amplification changes ( Figure 1 B). At the same time, pan-cancer analysis found that USP49 had the highest mutation level in esophageal and gastric cancers ( Figure 1 C). In addition, we analyzed the expression levels of these eight DUBs in the TCGA cohort using UALCAN. There was no difference in the expression of USP4 between esophageal cancer tissues and normal tissues, while the expression of the other DUBs was upregulated ( Figure 1 D) The upregulation of USP49 expression is consistent with the changes in its gene amplification mutation.

[0177] To evaluate whether these DDR-associated DUBs affect the radiosensitivity of EC cells, we first inhibited their expression and verified it by RT-PCR ( Figure 1 E). We then performed a clonal survival experiment ( Figure 1 F), the results showed that knocking down BAP1, USP1 or USP37 had no effect on the radiosensitivity of EC cells, while knocking down UCHL1 or UCHL5 enhanced the radioresistance of EC cells. In contrast, knocking down UCHL3, USP4 or USP49 made EC cells more sensitive to IR ( Figure 1 F). These results suggest that only UCHL3 and USP49, two DUBs upregulated in EC tissues, promote radioresistance. Given the significant effect of USP49 on DDR ( Figure 1A) and its up-regulated expression in EC tissues, we finally selected USP49 to study its biological role in DDR and esophageal cancer radiosensitivity.

[0178] In addition, we explored the biological function of USP49 by using transcriptional data from the TCGA database. Using UALCAN, we identified 1,767 genes co-expressed with USP49 with correlation coefficients greater than 0.3 or less than -0.3. Subsequently, we performed functional enrichment analysis of these co-expressed genes using Metascape. Interestingly, these genes were enriched in DDR-related pathways, including double-strand break (DSB) repair, recombination repair, and homologous recombination (HR) ( Figure 1 GH). These findings suggest that USP49 plays a key role in the DNA damage response and radiosensitivity of esophageal cancer.

[0179] USP49 promotes proliferation and radioresistance of esophageal cancer cells

[0180] Next, we investigated the biological role of USP49 in vitro. We first evaluated the protein expression of USP49 in normal esophageal epithelial cells (HEEC) and a series of EC cells ( Figure 2 A). We selected KYSE-30 and ECA-109 cells with significantly upregulated USP49 expression, established USP49 knockdown and overexpression cell models, and verified the success of the model construction by RT-PCR and Western blot ( Figure 2 BC). Figure 2 As shown in DF, knockdown of USP49 significantly inhibited the proliferation of KYSE-30 and ECA-109 cells. The clone survival assay also showed that the radiosensitivity of cells increased after downregulation of USP49 expression. In addition, overexpression of USP49 significantly promoted the proliferation and radioresistance of EC cells ( Figure 2 GH). These results reveal the key role of USP49 in regulating EC cell proliferation and radiosensitivity.

[0181] USP49 induces esophageal cancer resistance to IR and Olaparib by promoting homologous recombination repair

[0182] To clarify the function of USP49 in DDR, we induced linear DNA damage in EC cells transfected with GFP-USP49 and observed the changes in fluorescence intensity. The obvious accumulation of green fluorescence at the laser-induced linear DNA damage indicated that USP49 was localized at the DNA damage site ( Figure 3 A). Similarly, Co-IP experiments confirmed the interaction between USP49 and γ-H2AX after IR, confirming that USP49 localizes to sites of DNA damage ( Figure 3 B). We detected the formation of γ-H2AX foci (a marker of DNA damage) in EC cells after IR treatment by IF. The number of γ-H2AX foci induced by IR decreased significantly after 24 h and almost recovered to the level before IR, indicating that IR-induced DNA damage usually recovers within 24 h. Compared with the control group, the repair efficiency of the USP49 knockdown group was suppressed, and a high level of γ-H2AX foci was still present after 24 h, indicating that DDR was impaired ( Figure 3 C, E). In contrast, the number of γ-H2AX foci in the USP49 overexpression group was lower than that in the control group, suggesting that DDR was enhanced ( Figure 3 D, F). Neutral comet assay further showed that IR-induced DNA damage increased in the USP49 knockdown group, indicating a defect in DDR (Figure S1A), while cells in the USP49 overexpression group showed enhanced DDR and reduced DNA damage compared with the control group (Figure S1B). These results suggest that USP49 plays a key role in IR-induced DDR.

[0183] Since IR-induced DSBs are mainly repaired by nonhomologous end joining (NHEJ) and HR, we performed NHEJ and HR reporter experiments. The results showed that there was no significant difference in NHEJ efficiency between the control group and the USP49 knockdown group ( Figure 3 GH), but knockdown of USP49 significantly reduced HR efficiency, while overexpression of USP49 significantly increased HR efficiency ( Figure 3 I). These results suggest that USP49 primarily promotes HR rather than NHEJ.

[0184] Olaparib (AZD2281) is a PARP inhibitor used to treat HR-deficient tumors caused by BRCA1 / 2 mutations. In theory, the expression level of USP49 will affect the sensitivity of cells to Olaparib. CCK-8 experiments showed that USP49 knockdown enhanced the sensitivity of EC cells to Olaparib ( Figure 3 JK). Clonal survival experiments also confirmed that USP49 knockdown increased the sensitivity of EC cells to Olaparib, while USP49 overexpression induced cell resistance to Olaparib ( Figure 3 LM). These results suggest that USP49 promotes HR repair and enhances the resistance of EC cells to IR and Olaparib.

[0185] USP49 promotes proliferation and radioresistance of EC cells and is associated with poor prognosis of EC patients

[0186] To further verify that USP49 promotes EC cell radioresistance in vivo, we constructed stable USP49 knockdown EC cells and verified it by Western blot (Figure S1C). EdU experiments showed that USP49 reversed the decrease in cell viability caused by IR, indicating an increase in radioresistance (Figure S1D-E). In addition, cells with SP49 knockdown were also more sensitive to Olaparib (Figure S1F-G). Next, we established a subcutaneous transplant tumor model with ECA-109 cells and irradiated the tumor with X-rays ( Figure 4 A). The expression level of USP49 in each model was detected by Western blot and IHC analysis to confirm the successful establishment of the model ( Figure 4 EG). Compared with the control group, knockdown of USP49 significantly inhibited tumor growth. In addition, in the group receiving X-ray irradiation, knockdown of USP49 further reduced tumor volume, suggesting enhanced radiosensitivity ( Figure 4 BD, Figure S1H). IHC analysis of γ-H2AX expression in tumor tissues showed that IR induced upregulation of γ-H2AX. Knockdown of USP49 further increased γ-H2AX expression, which was consistent with its results of inhibiting tumor growth ( Figure 4 G).

[0187] As mentioned above, bioinformatics analysis showed that USP49 gene amplification is common in various cancers, especially in EC, and the expression of USP49 in EC tissues is higher than that in normal tissues ( Figure 1 BD). In addition, we found that USP49 was upregulated in poorly differentiated EC tissues (Figure S1I) and positively correlated with shorter disease-free survival (DFS) ( Figure 4 H). These results suggest the prognostic value of USP49 in EC patients. To further validate its ability to predict prognosis in patients receiving radiotherapy, we collected tumor tissue and clinical data from EC patients who received radical chemoradiotherapy. The expression of USP49 in tumor tissue was evaluated by IHC, and Kaplan-Meier analysis showed that patients with higher USP49 expression had a poorer prognosis ( Figure 4 IJ). These results are consistent with in vivo and in vitro experiments, indicating that USP49 in EC induces radioresistance and is associated with poor prognosis in EC patients receiving radiotherapy.

[0188] USP49 mainly interacts with the DNA-binding domain B of RPA70 and deubiquitinates and stabilizes RPA70 through its own USP domain

[0189] To elucidate the molecular mechanism of USP49-mediated radioresistance, we performed mass spectrometry analysis and identified 146 proteins that could potentially interact with USP49. In addition, we cross-referenced these potential proteins with 226 proteins involved in the homologous recombination (HR) pathway in the GO database and only screened out RPA70 ( Figure 5 A). RPA70 forms a complex with RPA32 and RPA14, binds to single-stranded DNA (ssDNA), prevents ssDNA degradation, and recruits Rad51 to DSBs during HR to promote HR. Kaplan-Meier analysis of RNA sequencing data of the GSE53625 cohort showed that patients with high RPA70 expression had a worse prognosis than those with low RPA70 expression (Figure S2C). GSEA showed that the DNA repair pathway was significantly activated in esophageal squamous cell carcinoma patients with high RPA70 expression (Figure S2D). Although there was no significant difference, the activation of the HR pathway was also increased (Figure S2E). Further bioinformatics analysis showed that the differential genes between the RPA70 high and low expression groups were enriched in KEGG pathways related to proteolysis, such as ubiquitin-mediated proteolysis and proteasome (Figure S2F). GSVA showed that pathways related to tumorigenesis and progression, especially DNA repair, were highly activated in the RPA70 high expression group (Figure S2G). These results all suggest that USP49 may promote HR in an RPA70-dependent manner.

[0190] First, we tried to use the three-dimensional structures of RPA70 and USP49 to predict whether USP49 interacts with RPA70 using ZDOCK. The molecular docking results were evaluated by PDBePISA, showing a large interface area and low free energy, indicating that USP49 may form a stable complex with RPA70 ( Figure 5 BD). Subsequently, we verified the interaction between USP49 and RPA70 by Co-IP. Figure 5 As shown in EF, exogenous Flag-USP49 or HA-RPA70 interacted with endogenous RPA70 or USP49 in ECA-109 cells. In addition, IF results confirmed the colocalization of USP49 and RPA70 in the nuclei of KYSE-30 and ECA-109 cells (Figure S2H).

[0191] Next, we constructed mutants based on the domains of USP49 and RPA70 to investigate the regions of their interaction. These mutants included USP49 lacking the USP domain (Flag-D1, 1-251), USP49 lacking the ZnF domain (Flag-D2, 252-688), RPA70 lacking the N-terminal oligonucleotide binding (OB) fold (HA-D1, 110-616), RPA70 lacking the linker between the N-terminal OB fold and the DNA binding domain (DBD) A (HA-D2, 1-110, 181-616), RPA70 lacking DBDA (HA-D3, 1-181, 301-616), RPA70 lacking DBDB (HA-D4, 1-301, 422-616), and RPA70 lacking DBDC (HA-D5, 1-422, 422-616). Figure 5 GH). Interestingly, Co-IP revealed that USP49 mutants lacking either the ZnF or USP domains still interacted strongly with RPA70 ( Figure 5 I). Compared with other RPA70 mutants, the interaction between DBD-B deletion mutant and USP49 was significantly weakened ( Figure 5 J). Taken together, these results indicate that DBD-B is essential for the interaction between RPA70 and USP49.

[0192] Due to the strong interaction between USP49 and RPA70, we attempted to explore whether USP49 regulates the expression level of RPA70 as a deubiquitinase. Therefore, we used CHX to inhibit protein synthesis to determine the effect of USP49 on RPA70 expression. Compared with the control group, RPA70 expression in USP49 knockdown KYSE-30 and ECA-109 cells decreased significantly with increasing treatment time ( Figure 5 KL). These results suggest that USP49 increases the stability of RPA70 and prevents its degradation. Subsequently, we performed ubiquitination experiments to investigate whether USP49 is involved in regulating ubiquitination-mediated proteolysis of RPA70. Figure 5 As shown in Figure 2, USP49 overexpression significantly reduced the ubiquitination level of RPA70 compared with the control group. We also observed that IR can trigger the ubiquitination of RPA70, while USP49 overexpression inhibited this process ( Figure 5 N). Overall, these findings suggest that USP49 stabilizes RPA70 by inhibiting ubiquitination-mediated degradation.

[0193] Next, we explored which domain of USP49 is responsible for the deubiquitination of RPA70. We used a catalytically inactive USP49 mutant (Flag-USP49C262A) as a negative control, and overexpression of Flag-USP49C262A had no effect on the ubiquitination level of RPA70 ( Figure 5 Similarly, a truncated mutant of USP49 lacking the USP domain (Flag-D1) had no effect on the ubiquitination of RPA70, whereas a truncated mutant of USP49 with the USP domain (Flag-D2) still retained the ability to deubiquitinate RPA70 ( Figure 5 O). In addition, IR-triggered ubiquitination of RPA70 can also be inhibited by full-length USP49 and a mutant containing the USP domain (Flag-D2). This inhibitory effect was not observed in mutants lacking the USP domain (Flag-D1) or catalytic activity (Flag-USP49C262A) ( Figure 5 P). Taken together, these results suggest that USP49 stabilizes RPA70 via its deubiquitinase activity, which is dependent on its own USP domain.

[0194] USP49 promotes HR through RPA70 and induces resistance to IR and Olaparib in esophageal cancer

[0195] To determine whether USP49 promotes HR through RPA70 and induces resistance of esophageal cancer to IR and Olaparib, we constructed a cell model for rescue experiments and verified its expression level by Western blot ( Figure 6 AC, Figure S3A-C). Using these cell models, further rescue experiments were performed. The results of IF showed that cells co-transfected with RPA70 and USP49 targeting shRNA had fewer γ-H2AX foci after IR treatment compared with cells transfected with shRNA targeting USP49 ( Figure 6 EF). The effect of reduced γ-H2AX foci caused by USP49 overexpression was abolished after knockdown of RPA70, indicating that RPA70 plays an essential role in USP49-driven DNA repair (Figure S3E-F). Subsequent HR reporter experiments also showed that RPA70 overexpression not only promoted HR but also restored the impaired HR caused by USP49 knockdown ( Figure 6 D). In contrast, the HR enhancement effect mediated by USP49 overexpression was abolished by RPA70 knockdown (Figure S3D). These results confirm that USP49-mediated HR enhancement is dependent on RPA70.

[0196] Next, the present invention investigated whether RPA70 affects USP49-mediated resistance of esophageal cancer cells to IR and Olaparib. EdU experiments showed that when cells overexpressed RPA70, USP49 knockdown could hardly reduce the proliferation activity of cells treated with IR or Olaparib ( Figure 6 GH). Consistent with these findings, RPA70 knockdown significantly suppressed the increase in cell viability after IR or Olaparib treatment caused by overexpression of USP49 (Fig. S3G-H). In addition, clone survival assays showed no significant difference in survival between the control group and cells co-transfected with RPA70 plasmid and USP49-targeting shRNA after IR or Olaparib treatment ( Figure 6 IJ). Importantly, knockdown of RPA70 abolished the increased survival mediated by upregulated USP49 expression (Figure S3I-J). These results suggest that USP49 depends on RPA70 to promote HR and induce resistance of EC cells to IR and Olaparib.

[0197] USP49 promotes HR and resistance to IR and olaparib by deubiquitinating RPA70 and promoting its recruitment to DSBs

[0198] To further investigate whether USP49 enhances HR by deubiquitinating RPA70, we performed rescue experiments by transfecting cells with full-length USP49 or different USP49 mutants after knockdown of endogenous USP49 ( Figure 7 AC). We analyzed the effects of different USP49 mutants on DDR by IF. Figure 7 E, G) and ECA-109( Figure 7 F, H) In cells, endogenous USP49 deficiency resulted in a greater number of γ-H2AX foci upon IR treatment compared to control treatment. After knocking down endogenous USP49, cells transfected with only exogenous full-length USP49 plasmid or a mutant containing the USP domain (Flag-D2) showed a reduction in γ-H2AX foci, indicating that DDR was restored. In contrast, overexpression of mutants without deubiquitinase activity, such as Flag-D1 and Flag-USP49C262A, failed to alleviate the increase in γ-H2AX foci caused by endogenous USP49 deficiency. HR reporter experiments further demonstrated that transfection of only exogenous full-length USP49 or USP49 mutants containing the USP domain could offset the impaired HR efficiency caused by endogenous USP49 knockdown ( Figure 7 D) These results indicate that the ability of USP49 to promote HR depends on its deubiquitinase activity mediated by its USP domain.

[0199] Next, we evaluated the effects of different USP49 mutants on the sensitivity of cells to IR and Olaparib by EdU and clonogenic survival assays. Figure 7 As shown in IJ, the decrease in cell viability caused by knockdown of endogenous USP49 after IR or Olaparib treatment could be reversed by overexpression of exogenous full-length USP49 or a mutant (Flag-D2) that retained deubiquitinase activity, while a mutant lacking deubiquitinase activity failed to reverse this decrease. Similarly, the decrease in cell viability of endogenous USP49 knockdown after IR or Olaparib treatment was reversed in the presence of exogenous full-length USP49 or a mutant containing the USP domain (Flag-D2). Figure 7 KL). Collectively, these rescue experiments suggest that USP49 stabilizes RPA70 and promotes HR by relying on its deubiquitinase activity, thereby conferring resistance to IR and olaparib in esophageal cancer cells.

[0200] Considering that RPA70 needs to be recruited to DSBs to promote HR, it is crucial to explore the effect of USP49-mediated deubiquitination on RPA70 localization. As shown in Figure S4A, the formed RPA70 foci peaked at 24 h after IR treatment. Even after 36 h, obvious RPA70 foci were still present in the cells. Knockdown of USP49 significantly reduced the number of RPA70 foci in cells (Figure S4A). In contrast, overexpression of USP49 significantly promoted the formation of RPA70 foci (Figure S4B). This trend was also verified in Co-IP experiments (Figure S4C). We then transfected full-length USP49 or various USP49 mutants into esophageal cancer cells in which endogenous USP49 was knocked down. IF assay results showed that the inhibition of RPA70 focus formation caused by knockdown of endogenous USP49 was reversed by full-length USP49 or Flag-D2. However, this effect was not observed in mutants lacking deubiquitinase activity (Flag-D1 and Flag-USP49C262A) (Figure S4D-F). Since Rad51 is recruited to DSBs through RPA70 and promotes HR, we further explored whether USP49 affects the recruitment of Rad51. As shown in Figure S4D-F, knockdown of endogenous USP49 significantly inhibited the formation of Rad51 foci. This inhibition could be restored by transfection of full-length USP49 or a mutant with deubiquitinase activity (Flag-D2). These results suggest that USP49 promotes the recruitment of RPA70 and downstream Rad51 at DSBs by mediating the deubiquitination of RPA70.

[0201] Considering the strong interaction between USP49 and RPA70, we speculated that USP49 localization to DSBs depends on RPA70. Therefore, we evaluated the effect of RPA70 knockdown on the recruitment of USP49 to laser-induced damage sites. Compared with the control group, the recruitment of USP49 to DSBs was not slowed down in the RPA70 knockdown group, and obvious USP49 recruitment was observed 1 min after laser damage (Figure S4G). As expected, we also observed this RPA70-independent interaction of USP49 with γ-H2AX in the Co-IP experiment (Figure S4H). Overall, the recruitment of USP49 to DSBs is independent of RPA70.

[0202] ATM is required for the recruitment of USP49 to liquid-liquid phase separation (LLPS) at DSBs

[0203] In our previous laser microirradiation experiments, we observed that overexpressed GFP-USP49 fusion protein in EC cells formed distinct spots, suggesting that LLPS occurred ( Figure 3 A). As recent studies have shown that LLPS is essential for DDR and that some proteins undergo LLPS during repair, we further explored whether USP49 also undergoes LLPS and whether this affects its ability to regulate DDR. Interestingly, disorder-prone analysis using the PONDOR website (http: / / www.pondr.com / ) revealed the presence of intrinsically disordered regions in USP49, confirming the potential of USP49 to undergo LLPS ( Figure 8 In particular, live cell imaging reinforced this hypothesis by showing the dynamic fusion and fission of GFP-USP49 condensates, a dynamic process that is considered to be a hallmark of LLPS ( Figure 8 B). In addition, treatment with 5% 1,6-hexanediol (Hex) disrupted weak hydrophobic interactions and led to the disassembly of GFP-USP49 spots, confirming that LLPS of USP49 occurred ( Figure 8 C). To further explore the effect of USP49LLPS on DDR, we used Olaparib to induce a sustained HR process. We observed that Olaparib induced higher USP49LLPS, while the use of 5% Hex could destroy the formed USP49LLPS ( Figure 8 C). Fluorescence recovery after photobleaching (FRAP) analysis performed under olaparib treatment also showed a high recovery rate of fluorescence intensity of GFP-USP49 aggregates, indicating a dynamic exchange between aggregates and the surrounding environment ( Figure 8D). This dynamic process prompted us to explore whether USP49 is recruited to DSBs via LLPS. Interestingly, we observed that the recruitment of USP49 to DSBs was completely inhibited after 5% Hex treatment ( Figure 8 E). Taken together, the above results indicate that USP49 undergoes LLPS during HR and its recruitment to DSBs is mediated by LLPS.

[0204] Although USP49 depends on RPA70 to promote HR, we have verified that its LLPS at DSBs is independent of RPA70. Given the importance of repair protein localization at DSBs for their DDR regulatory capacity, we next sought to elucidate the mechanisms that regulate the LLPS and recruitment of USP49 at DSBs. To this end, we first explored whether this process is regulated by RNF8 or RNF168, two E3 ligases that mediate the full ubiquitination of H2A-type histones and trigger the subsequent recruitment of repair proteins. However, knockdown of RNF8 or RNF168 had no effect on the LLPS and recruitment of USP49 at DSBs ( Figure 8 FG). This phenomenon suggests that the recruitment of USP49 may occur before the recruitment of RNF8 and RNF168. During HR, the recruitment of RNF8 is triggered by ATM-mediated phosphorylation. Therefore, we next explored whether USP49 is recruited by ATM. Laser micro-irradiation experiments showed that in EC cells treated with the ATM inhibitor KU-55933, USP49 could not undergo LLPS and be recruited at DSBs ( Figure 8 Similarly, we observed that KU-55933 completely abolished the interaction between USP49 and γ-H2AX after IR ( Figure 8 JK). In addition, USP49 overexpression failed to enhance the radioresistance of EC cells treated with KU-55933, indicating that USP49 enhancement of HR is ATM-dependent ( Figure 8 LM). Taken together, these results suggest that ATM regulates USP49 to form LLPS at DSBs, which is essential for the recruitment of USP49 to promote HR and resistance to IR.

[0205] USP49 is transcriptionally upregulated by p53 after IR

[0206] To further explore the function of USP49 in radiosensitivity, we investigated whether IR regulates the expression of USP49. We analyzed the expression level of USP49 mRNA after 6Gy X-ray irradiation and found that USP49 mRNA expression increased significantly. Western blot evaluated the expression level of USP49 protein after IR and found that IR induced an increase in USP49 protein expression. With the increase in X-ray radiation dose, the levels of γ-H2AX and USP49 also increased, indicating that USP49 is involved in DDR. It is worth mentioning that the increase in USP49 expression was already obvious within 1 hour after IR.

[0207] The accumulation of USP49 lasted for 24 h after IR, when γ-H2AX levels were lowest, suggesting that USP49 may play a role in the entire DDR process.

[0208] Based on these results, we hypothesized that IR induced upregulation of USP49 expression at the transcriptional level. To identify the putative transcription factors responsible for this regulatory effect, we used the PROMO database and obtained 21 candidate transcription factors, including p53, a key molecule known to be a central coordinator of DDR. Therefore, we investigated whether p53 promoted the upregulation of USP49 expression after IR by RT-PCR. We found that knockdown of p53 did not change USP49 mRNA levels in the absence of IR, but significantly inhibited the upregulation of USP49 mRNA expression induced by IR. In addition, correlation analysis of TCGA and GSE69925 datasets showed that USP49 and p53 were positively correlated in EC. Next, the present invention investigated whether p53 regulates the expression of USP49 protein after IR. IR induced upregulation of p53 and USP49 expression, while knockdown of p53 significantly inhibited the upregulation of USP49 expression. These evidences prompted us to explore whether p53 directly regulates the upregulation of USP49 expression through its transcriptional regulatory ability. ChIP-seq data obtained from two online GEO datasets collectively revealed a weakening of USP49 promoter region binding after knockdown of p53 expression in cell models. At the same time, an increase in binding efficiency was observed upon exposure to IR. Dual-luciferase reporter gene experiments showed that IR indeed enhanced the transcriptional activity of USP49, explaining the observed upregulation of mRNA and protein expression levels. This increase in USP49 transcriptional activity was significantly attenuated after p53 knockdown. In addition, we found that p53 mutations are prevalent in EC patients and that USP49 expression is upregulated in EC patients with p53 mutations. Interestingly, ChIP-seq showed increased binding affinity to the USP49 promoter region in cells carrying the p53R273H mutation, a p53 mutant type that is dominant in EC. Together, these results suggest that IR promotes USP49 expression by increasing the transcriptional activity of p53, thereby enhancing the DDR.

[0209] An important problem faced by EC patients is radioresistance, which is generally attributed to the enhancement of DDR. In the present invention, we revealed that the deubiquitinase USP49 promotes DDR through interaction with RPA70. In response to DNA damage, p53 promotes transcriptional enhancement of USP49 to increase USP49 expression. Subsequently, ATM promotes the recruitment of USP49 at DSBs and the formation of USP49LLPS. The recruited USP49 then catalyzes the deubiquitination of RPA70, thereby promoting the recruitment of RPA70 and Rad51, which in turn promotes HR ( Figure 8N). We found that knockdown of USP49 sensitized EC cells to IR and Olaparib in an RPA70-dependent manner. Clinically, USP49 is upregulated in EC tissues and is associated with poor prognosis in EC patients receiving radical chemoradiotherapy. In addition, experiments in xenograft nude mouse models showed that USP49 knockdown increased tumor sensitivity to IR.

[0210] Previous literature has found that USP49 plays an important biological function in tumors. A literature review found that USP49 can reduce the malignant phenotype of pancreatic cancer and non-small cell lung cancer and increase the sensitivity of cells to chemotherapeutic drugs. In contrast, USP49 has been reported to promote tumor cell proliferation and treatment resistance in colorectal cancer and gastric cancer. The present invention confirms that USP49 is highly expressed in EC tissues and promotes the proliferation and radiation resistance of EC cells. The significant differences in USP49 expression and function in different tumors emphasize the importance of USP49 functional mutations or abnormal expression in tumorigenesis and progression. It is worth noting that the frequency of USP49 amplification in EC tissues is significantly higher than that in other malignant tissues, indicating that this gene is closely related to the malignant progression and treatment resistance of EC. The latest studies also show that there is a connection between USP49 and DNA damage, suggesting its role in DDR regulation. Nishi et al. found that USP49 can be recruited to DSBs, and USP49 knockdown can cause additional DNA damage. Tu's study showed that USP49 can enhance the sensitivity of HCT116 colorectal cancer cells to the DNA damaging agent etoposide by stabilizing p53. In the present invention, we observed that USP49 knockdown significantly increased IR-induced DSBs. These findings were further confirmed by laser micro-irradiation experiments, and the results were consistent with Kim's findings that USP49 was recruited to DSBs in EC cells, suggesting that USP49 is involved in DDR. Through IF and DDR reporter experiments, we explored the function of USP49 in DDR in detail. USP49 promoted HR, but not NHEJ, after IR-induced DNA damage. These results are consistent with Matsui's conclusions. To reconfirm the regulatory role of USP49 in HR, the present invention investigated whether USP49 affects the sensitivity of EC cells to the HR-inducing drug Olaparib. Our results showed that USP49 enhanced the resistance of EC cells to Olaparib, indicating that HR was enhanced. The latest studies have shown that Olaparib can sensitize tumor cells to IR and enhance the effect of radiotherapy in vitro and in vivo. In addition, the results of a phase I dose-escalation clinical trial designed to evaluate whether Olaparib improves the biological effect of radiotherapy in patients with triple-negative breast cancer have been released. In the present invention, the interaction between Olaparib and radiotherapy in EC cells was not the focus of the study, but we may explore this issue in depth in future studies.

[0211] RPA70 is a key component of the RPA complex and plays an important role in HR by participating in end recombination, single-strand invasion, and the recruitment of downstream repair factors. It is a key regulator of the genome maintenance mechanism. The ubiquitination level of RPA70 is significantly altered in response to genotoxic stress caused by UV irradiation or hydroxyurea. Recent studies have shown that E3 ubiquitin ligases RFWD3 and PRP19 interact with the RPA complex and promote its multiple ubiquitination, thereby enhancing HR. These findings suggest that the ubiquitination state of RPA70 is a determinant of HR. Therefore, we hypothesized that the deubiquitinase USP49 regulates HR through deubiquitination of RPA70. Initially, through protein stability assays, we found that USP49 knockdown reduced the stability of RPA70, indicating increased ubiquitination of RPA70. These observations were confirmed by ubiquitination reporter experiments, in which USP49 could inhibit IR-induced ubiquitination of RPA70. The catalytic ability of USP49 is mainly attributed to its USP domain. In the present invention, we found that both domains of USP49 can bind to RPA70, indicating that they may contribute to the ubiquitination dynamics of RPA70. Therefore, we used the inactive mutant of USP49 (C262A) as a negative control, and then performed ubiquitination reporter experiments on truncated USP49 constructs. We found that the missing USP domain of USP49, like the inactive mutant, could not reduce the ubiquitination level of RPA70. Only truncations with deubiquitinase activity can promote HR and induce USP49 resistance to IR and Olaparib. Despite this, the present invention also has some limitations. For example, the ubiquitination sites of RPA70 after IR and the types of RPA70 ubiquitination regulated by USP49 need further study. Despite these limitations, the results of the present invention still confirm that USP49 promotes HR by deubiquitinating RPA70, thereby conferring resistance to IR and Olaparib on EC cells.

[0212] In the process of HR, the dynamic ubiquitination regulation of RPA is crucial. Notably, the studies of Inano and Alexandre showed that RFWD3 and PRP19 not only promote the ubiquitination of the RPA complex and its subsequent degradation, but also promote the dissociation of RPA from DNA damage sites, thereby regulating HR. Results consistent with these findings were obtained in the present invention: USP49 can promote and maintain the recruitment of RPA70 and downstream Rad51 to DNA damage sites by deubiquitinating RPA70. Our comprehensive review of the existing literature found that the specific deubiquitination mechanism regulating RPA70 during the DDR process remains unclear. This invention clearly identifies for the first time a deubiquitinating enzyme that targets RPA70 during the DDR process and improves the understanding of the ubiquitination / deubiquitination regulation of RPA70 in this context. The ubiquitination / deubiquitination balance of RPA70 is crucial for its function in HR.

[0213] During the DDR, several proteins undergo LLPS, and LLPS is essential for the DDR. In the present invention, we show for the first time that USP49 is recruited to DSBs and undergoes LLPS. Although the present invention shows that USP49 promotes HR through RPA70, the LLPS recruitment of USP49 at DSBs is dependent on ATM, not RPA70. Importantly, by inhibiting ATM-mediated phosphorylation using KU-55933, we observed that USP49 was unable to mediate radioresistance, indicating that LLPS localization of USP49 at DSBs is essential for USP49-mediated promotion of HR.

[0214] In general, this study identified USP49 as a key regulator of DDR by causing LLPS at DSBs and reversing the ubiquitination of RPA70; the balance between RPA70 ubiquitination and deubiquitination is critical for the role of RPA70 in HR. In addition, we demonstrated that USP49 promoted the proliferation of EC cells and enhanced their radioresistance in an RPA70-dependent manner. In summary, USP49 is essential for the regulation of the HR pathway and the maintenance of genomic stability, and is a potential target for radiosensitization therapy in EC patients.

Claims

1. Use of a deubiquitinating enzyme USP49 in the preparation of a drug for regulating the radiosensitivity of esophageal cancer cells, characterized in that: Deubiquitinase USP49 regulates the radiosensitivity of esophageal cancer cells through phase separation and homologous recombination repair, serving as a biomarker for the diagnosis, treatment and prognosis of esophageal cancer.

2. A use of the deubiquitinase USP49 as claimed in claim 1 in the preparation of a drug for regulating the radiosensitivity of esophageal cancer cells, characterized in that: The plasmids used include: pCMV-Flag-USP49, pCMV-Flag-USP49-D1, pCMV-Flag-USP49-D2, pCMV-Flag-USP49C262A, pCMV-EGFP-USP49, pCMV-HA-RPA70, pCMV-HA-RPA70-D1, pCMV- HA-RPA70-D2, pCMV-HA-RPA70-D3, pCMV-HA-RPA70-D4, pCMV-HA-RPA70-D5, PGL4.10-USP49-luc, pRL-TK-luc, pCAGGS-I-secI, pCAGGS-mCherry, pCMV-NHEJ-GFP.

3. A use of the deubiquitinase USP49 as claimed in claim 2 in the preparation of a drug for regulating the radiosensitivity of esophageal cancer cells, characterized in that: The siRNA and its sequence are as follows: siUCHL1#1GGACAAGAAGUUAGUCCUA; siUCHL1#2CCGCGAAGAUGCAGCUCAA; siUCHL3#1GGGACAAGAUGUUACAUCA; siUCHL3#2CCAGUUUCUUAAACAAUUA; siUCHL5#1AGAUUGUGAUUCGACAAGUA; siUCHL5#2GCAGAAGAUAGCAGAGUUA; siUSP1#1GGTTGCTAGTACAGCGTTT; siUSP1#2GAGAACCAGAGACAAACTA; siUSP4#1GGCAGACCUUGCAGUCAAA; siUSP4#2AGUUGAGCAAGCUAGACAA; siUSP37#1GCCUAGUAGUUCACUACAA; siUSP37#2GGAUCAGAAUAAAGGUGAA; siUSP49#1GGTCATGCATCACGGGAAA; siUSP49#2GGACTACGTGCTCAATGAT; siBAP1#1GAAGGACCCACAACTACGA; siBAP1#2GAACCGTCAGACAGTACTA; siRPA70GACCATTTGTGCTCGTGTT; sip53#1GGAGTATTTGGATGACAGA; sip53#2AGAGAATCTCCGCAAGAAA; siRNF8GGACAAUUAUGGACAACAA; siRNF168GACACUUUCUCCAGAUA.

4. An immunoassay kit comprising a deubiquitinating enzyme USP49 detection reagent.

Images