Bacterial compositions and methods for promoting plant growth

Abstract

The invention relates to a bacterial strain, a composition and application of the bacterial strain and the composition in preventing and treating plant diseases and promoting plant growth. In one aspect, there is provided an isolated bacterial strain RR15 of Pantoea (preserved in Australian National Metrology Research Institute on June 9, 2022 with a preservation number of V22 / 011015). Also provided are methods for utilizing the bacterial strains and compositions to promote plant growth, promote plant tuber growth, inhibit pathogen-induced plant root infection, and inhibit pathogen-induced plant root disease.

Description

[0001] Priority claim

[0002] This application claims priority to Australian Provisional Patent Application No. 2022901887 filed on July 5, 2022, the contents of which are incorporated herein by reference. Technical Field

[0003] The present invention generally relates to bacterial compositions and their use in controlling plant diseases and promoting plant growth. Background Art

[0004] Many plant diseases and pests reduce crop yields, making agricultural food production challenging. Root exudation is an important process in the plant rhizosphere that regulates plant-microbe interactions. For example, root exudates in the rhizosphere have multiple effects, including inducing chemotaxis, inhibiting and stimulating microbial growth, and regulating pathogen colonization and activation. In many cases, especially for pathogens that produce environmentally resistant spores, pathogen activation by host root exudates is a common event in many soil-borne disease systems.

[0005] The initial stage of infection by soil-borne pathogens and beneficial interactions with microorganisms is root colonization. Chemical signals released by plants and microorganisms control this dynamic relationship in the following way: plant roots initiate communication with soil bacteria by producing signals that are detected by microorganisms, which in turn produce signals that trigger colonization.

[0006] For example, in potato, powdery scab of tubers has long been recognized as the main disease caused by infection with Spongospora subterranea f.sp. subterranea, resulting in reduced quality of harvested tubers. In this regard, potato roots produce chemically specific stimulatory compounds that are involved in the early germination of dormant spores of S. subterranea. This confirms findings from other disease systems, where individual host-specific compounds found in root exudates chemotactically attract pathogen spores, thereby promoting infection. Therefore, it is becoming increasingly important to study multitrophic interactions between organisms to better understand pathogenesis and disease management in plants. In fact, multitrophic interactions are now widely recognized to mediate the ability of soil pathogens to produce plant diseases and the ability of bacterial antagonists to suppress diseases.

[0007] Rhizosphere-dwelling microorganisms have a variety of qualities that directly or indirectly improve plant health and prepare plants to resist various diseases. For example, plants exude root exudates that are selective for specific bacterial strains, which in turn release metabolites that are beneficial to the plant. Therefore, there is a need to identify plant-associated rhizosphere-dwelling microorganisms that can be used to promote plant health and growth as well as inhibit plant root infections and inhibit plant root diseases mediated by soil-borne pathogens.

[0008] The discussion of documents, acts, materials, devices, articles and the like in this specification is intended solely to provide a context for the present invention. There is no suggestion or representation that any or all of these formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application. Summary of the invention

[0009] The present invention is based in part on the identification of bacterial strains that have the ability to degrade pathogen-irritating compounds in plant root exudates and can promote plant development and growth.

[0010] Therefore, in a first aspect, the present invention provides an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0011] In some embodiments, the present invention provides a culture of a bacterial strain according to the first aspect of the present invention. In some embodiments, a supernatant obtained from the culture is provided. In some embodiments, a composition is provided, comprising a bacterial strain, a culture and / or a supernatant.

[0012] In some embodiments, the bacterial strain promotes plant growth. In some embodiments, the bacterial strain promotes plant root growth. In some embodiments, the bacterial strain increases plant tuber yield. In some embodiments, the size and / or weight of the tuber is increased. In some embodiments, the plant belongs to the Solanaceae family. In some embodiments, the plant is a species of the genus Solanum tuberosum.

[0013] In some embodiments, the bacterial strain inhibits plant root infections caused by pathogens. In some embodiments, the bacterial strain inhibits plant root diseases caused by pathogens. In some embodiments, the pathogen is potato powdery scab (Spongospora subterranea).

[0014] In some embodiments, the composition further comprises a biological agent. In some embodiments, the biological agent is a plant growth promoter. In some embodiments, the composition further comprises a bacterial stabilizer. In some embodiments, the bacterial stabilizer is xanthan gum.

[0015] In another aspect, the present invention provides a method for promoting plant growth, the method comprising: applying an effective amount of the bacterial strain, culture, supernatant and / or composition according to the first aspect of the present invention to the plant or to the soil in which the plant will or is growing.

[0016] In another aspect, the present invention provides a method for increasing plant tuber yield, the method comprising: applying an effective amount of a bacterial strain, culture, supernatant and / or composition according to the first aspect of the present invention to the plant or to the soil in which the plant will or is propagating. In some embodiments, the size and / or weight of the tubers is increased.

[0017] In another aspect, the present invention provides a method for inhibiting plant root infection caused by pathogens, the method comprising: applying an effective amount of the bacterial strain, culture, supernatant and / or composition according to the first aspect of the present invention to the plant or the soil in which the plant will or is growing.

[0018] In another aspect, the present invention provides a method for inhibiting plant root diseases caused by pathogens, the method comprising: applying an effective amount of the bacterial strain, culture, supernatant and / or composition according to the first aspect of the present invention to the plant or the soil in which the plant will or is growing.

[0019] In another aspect, the present invention provides a method for promoting plant growth, increasing plant tuber yield, inhibiting plant root infection caused by pathogens, or inhibiting plant root diseases caused by pathogens, the method comprising: applying an effective amount of the bacterial strain, culture, supernatant and / or composition according to the first aspect of the present invention to the plant or the soil in which the plant will or is growing.

[0020] On the other hand, the present invention provides a composition comprising an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0021] On the other hand, the present invention provides a composition comprising a culture of an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0022] On the other hand, the present invention provides a composition comprising the supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0023] In some embodiments, the bacterial strain of the composition promotes plant growth. In some embodiments, the bacterial strain promotes plant root growth. In some embodiments, the bacterial strain increases plant tuber yield. In some embodiments, the size and / or weight of the tuber is increased. In some embodiments, the plant belongs to the Solanaceae family. In some embodiments, the plant is a species of the genus Solanum tuberosum.

[0024] In some embodiments, the bacterial strain of the composition inhibits plant root infection caused by a pathogen. In some embodiments, the bacterial strain inhibits plant root disease caused by a pathogen. In some embodiments, the pathogen is potato powdery scab (Spongospora subterranea).

[0025] In some embodiments, the composition further comprises a biological agent. In some embodiments, the biological agent is a plant growth promoter. In some embodiments, the composition further comprises a bacterial stabilizer. In some embodiments, the bacterial stabilizer is xanthan gum.

[0026] In some embodiments, the composition is used to promote plant growth, increase plant tuber yield, inhibit plant root infection caused by pathogens, and / or inhibit plant root diseases caused by pathogens.

[0027] In another aspect, the present invention provides a method for promoting plant growth, the method comprising: applying to the plant or to the soil in which the plant will or is propagating an effective amount of:

[0028] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0029] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0030] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0031] (iv) A composition comprising (i), (ii) and / or (iii).

[0032] In another aspect, the present invention provides a method for increasing tuber yield in a plant, the method comprising: applying to the plant or to the soil in which the plant will or is propagating an effective amount of:

[0033] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0034] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0035] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0036] (iv) A composition comprising (i), (ii) and / or (iii).

[0037] In some embodiments, tuber size and / or weight is increased.

[0038] In another aspect, the present invention provides a method for inhibiting plant root infection caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0039] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0040] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0041] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0042] (iv) A composition comprising (i), (ii) and / or (iii).

[0043] In another aspect, the present invention provides a method for inhibiting plant root diseases caused by pathogens, the method comprising: applying to a plant or soil in which the plant will or is growing an effective amount of:

[0044] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0045] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0046] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0047] (iv) A composition comprising (i), (ii) and / or (iii).

[0048] In another aspect, the present invention provides a method for promoting plant growth, increasing plant tuber yield, inhibiting plant root infection caused by pathogens, or inhibiting plant root diseases caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0049] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0050] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0051] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0052] (iv) A composition comprising (i), (ii) and / or (iii).

[0053] In another aspect, the present invention provides a composition for promoting plant growth, increasing plant tuber yield, inhibiting pathogen infection of plant roots and / or inhibiting plant root diseases caused by pathogens, the composition comprising an effective amount of:

[0054] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0055] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0056] (iii) The supernatant of the culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0057] In another aspect, the present invention provides a composition, which, when used to promote plant growth, increase plant tuber yield, inhibit pathogen infection of plant roots and / or inhibit plant root diseases caused by pathogens, comprises an effective amount of:

[0058] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0059] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0060] (iii) The supernatant of the culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0061] In another aspect, the present invention provides a method for promoting plant growth, the method comprising: applying to the plant or to the soil in which the plant will or is propagating an effective amount of:

[0062] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0063] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0064] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0065] (iv) A composition comprising (i), (ii) and / or (iii).

[0066] In another aspect, the present invention provides a method for increasing tuber yield in a plant, the method comprising: applying to the plant or to the soil in which the plant will or is propagating an effective amount of:

[0067] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0068] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0069] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0070] (iv) A composition comprising (i), (ii) and / or (iii).

[0071] In another aspect, the present invention provides a method for inhibiting plant root infection caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0072] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0073] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0074] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0075] (iv) A composition comprising (i), (ii) and / or (iii).

[0076] In another aspect, the present invention provides a method for inhibiting plant root diseases caused by pathogens, the method comprising: applying to a plant or soil in which the plant will or is growing an effective amount of:

[0077] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0078] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0079] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0080] (iv) A composition comprising (i), (ii) and / or (iii).

[0081] In another aspect, the present invention provides a method for promoting plant growth, increasing plant tuber yield, inhibiting plant root infection caused by pathogens, or inhibiting plant root diseases caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0082] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0083] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0084] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0085] (iv) A composition comprising (i), (ii) and / or (iii).

[0086] In another aspect, the present invention provides a composition comprising:

[0087] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0088] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0089] (iii) the supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10.

[0090] In another aspect, the present invention provides a method for reducing the level of one or more pathogen stimulating compounds in the rhizosphere environment of a plant, the method comprising: applying to the plant or to the soil in which the plant will or is growing an effective amount of:

[0091] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0092] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0093] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0094] (iv) A composition comprising (i), (ii) and / or (iii).

[0095] In another aspect, the present invention provides a method for reducing the level of one or more pathogen stimulating compounds in the rhizosphere of a plant, the method comprising: applying to the plant or to the soil in which the plant will or is growing an effective amount of:

[0096] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0097] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0098] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0099] (iv) A composition comprising (i), (ii) and / or (iii).

[0100] In another aspect, the present invention provides a method for reducing the level of one or more pathogen stimulating compounds in the rhizosphere environment of a plant, the method comprising: applying to the plant or to the soil in which the plant will or is growing an effective amount of:

[0101] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0102] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0103] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0104] (iv) A composition comprising (i), (ii) and / or (iii).

[0105] In another aspect, the present invention provides a method for reducing the level of one or more pathogen stimulating compounds in the rhizosphere of a plant, the method comprising: applying to the plant or to the soil in which the plant will or is growing an effective amount of:

[0106] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0107] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0108] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0109] (iv) A composition comprising (i), (ii) and / or (iii).

[0110] In some aspects, the one or more pathogen stimulating compounds are selected from L-glutamine and tyramine.

[0111] Other aspects and embodiments of the invention are described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0112] For a further understanding of the aspects and advantages of the present invention, reference should be made to the following detailed description taken in conjunction with the accompanying drawings. These drawings illustrate certain embodiments of the present invention.

[0113] Figure 1 Shown is a flow chart showing the steps involved in isolating and screening rhizobacterial microorganisms that degrade L-glutamine and L-tyramine according to one embodiment of the present invention.

[0114] Figure 2 Shown is a schematic representation of the experimental steps used to identify and quantify bacterial root colonization, including: (I) bacterial counts on the root surface; and (II) bacterial numbers within root tissue.

[0115] Figure 3 Shown are micrographs of representative pure culture bacterial isolates from the potato rhizosphere that demonstrated the ability to grow in minimal medium with Gln and Tyr as sole carbon sources (Leica MZ12 stereoscope; magnification 2x; scale bar = 10 mm; MSM agar).

[0116] Figure 4Shown are graphs showing the time course monitoring of bacterial isolate growth (A) or metabolite degradation (B) in M9 minimal medium enriched with 2 mM Gln or Tyr at 20°C and 180 rpm (96 hours). Each value is the mean ± standard error of the results of 3 replicates.

[0117] Figure 5 Shown is a graphic representation of Tyr and Gln degradation by rhizobacterial isolates of strains RR15 and RR09 (measured by UPLC-MS / MS after 48 h of cultivation in minimal medium broth supplemented with 2 mM of each sole carbon source). Each data point represents the mean of three independent replicates. Different letters indicate significant treatment (α=0.05) effects for each compound.

[0118] Figure 6 Shown are the ancestral taxonomic relationships of Gln- and Tyr-degrading rhizobacterial isolates inferred by using the maximum likelihood method and the Tamura-Nei model. The percentage of replicate trees in which related taxa clustered together in the bootstrap experiment (1000 replicates) is shown below the branches. Red branches represent rapid degraders that were used for further study, while blue branches represent partial degraders for comparison. Phylogenetic analyses were performed in MEGAX.

[0119] Figure 7 Shown are the ancestral states of candidate strains RR15 (A) and RR09 (B) inferred by the neighbor-joining method. The tree shows the closest set of nucleotide sequences from the 16S rRNA database. All positions with gaps and missing data were removed, totaling 223 and 125 positions, respectively, in the final dataset. Evolutionary analyses were performed in MEGA X.

[0120] Figure 8 Shown are graphs and images showing colonization of tissue culture roots by candidate isolates RR15 (E) and RR09 (D): (A) progression of bacterial growth on the root surface assessed by colony forming units (CFU); (B) internal roots assessed by qPCR15; (C) in vitro growth system; and (D, E, F) microscopic observation of colonization activity visualized by root staining with 6% aniline blue / glacial acetic acid in aqueous solution (15:1:4 by volume).

[0121] Fig. 9 Shown is a comparison of significantly reduced L-glutamine and tyramine levels in soil exudates at a p-value threshold of 0.05: (A) average levels calculated within the rhizosphere between uninoculated and bacterially treated plants; and (B) heatmaps of Gln and Tyr concentrations available after 8 weeks of monitoring.

[0122] Fig.10 Shown are the significant metabolite features identified by ANOVA plots and Tukey's HSD with a p-value threshold of 0.05. Red dots represent metabolites that are significant, while green dots represent metabolites that are not significant in discriminating the variables studied.

[0123] Fig.11 Shown is a schematic representation of the static pot soil growth system used in Example 2, which consists of experimental equipment for inoculum preparation, transplantation, secretion collection and analysis, and recovery of improved microbial inoculants.

[0124] Fig.12 Shown is a graph showing the expression of selected metabolites by fold change analysis given a count threshold of 2.0. Plotted data represent significant absolute values ​​of changes between plant bacterial treatments and control plants. Results are presented on a log2 scale, which indicates that the same fold change (up / down regulated metabolites) is the same distance from a zero baseline. Metabolites that are up / down regulated from a zero baseline are represented by colored dots, while gray dots represent no significant fold changes.

[0125] Fig.13 Shown is a heat map analysis of the abundance of representative compounds found in root exudates of control and bacterial-treated plants: (A) organic compounds; (B) amino acids; and (C) glutamine and tyramine, 8 weeks after inoculation. Metabolite feature areas were normalized and range-scaled for all experimental samples.

[0126] Fig.14 Shown is a graph showing the copy number of the target bacterial 16S rRNA gene in rhizosphere and non-rhizosphere soil at different sampling times. Absolute gene copy number was determined based on a dilution curve series of 5 ng template DNA with known standards. Error bars are one standard error of the mean of replicate qPCR reactions.

[0127] Fig.15 Shown are the total read abundance of bacterial populations present in the rhizosphere of potato seed “ranger russet” 8 weeks after inoculation: (A) a bar graph showing the abundance of OTUs at the phylum level (97% similarity) and the assigned taxonomic category for all individual samples; and (B) a Venn diagram showing the number of unique and shared bacterial ASVs in control, non-rhizosphere, and rhizosphere samples. ASVs in the Venn diagram were included only if they accounted for at least 0.1% of the total ASVs in each sample.

[0128] Fig.16Shown are the differences in relative abundance of bacterial taxa between rhizosphere environments (with plants) and non-rhizosphere environments (without plants) amended with the bacterial isolates under study. The inner and outer rings represent rhizosphere and non-rhizosphere communities, respectively. Different colors represent bacterial genera, and the percentages represent the relative abundance of each sample type.

[0129] Fig.17 Shown is a graph showing the effect of single and combined bacterial inoculations on potato growth 8 weeks after planting. The bar at the top of each column represents the standard deviation (n=5). Significant differences (p≤0.05) according to Tukey's HSD test are indicated by lowercase letters between treatments.

[0130] Fig.18 Shown is a schematic diagram illustrating the exudate sampling technique of the plant soil system used in the study of Example 3.

[0131] Fig.19 Shown is a graph showing the total counts of Pantoea species strain RR15 in the rhizosphere of susceptible and resistant potato cultivars subjected to various treatments during three sampling periods. Bacterial copy numbers represent the number of bacterial DNA per microliter as determined by qPCR. Values ​​are expressed as mean ± SD of three biological and technical replicates.

[0132] Fig. 20 Shown is a graph showing glutamine and tyramine concentrations in soil affected by treatment with Pantoea RR15. The data indicate the average levels of glutamine and tyramine in the incubated soil at 4, 12 and 21 weeks after treatment. Bars within the same letter group are not statistically different (p<0.05, Tukey's HSD test).

[0133] Fig.21 Shown is a heat map showing metabolic shifts of target amino acids and organic compounds whose abundance significantly increased or decreased in response to RR15 inoculation with or without P. solanum. Data were collected from 3 experimental replicates, with each sample extracted and analyzed in triplicate. Green indicates that all values ​​were below the detection limit.

[0134] Fig. 22 Shown is a graph showing significant biochemical changes in target potato exudates from resistant and susceptible cultivars determined using fold change (FC) analysis. Each point in the graph was calculated using a p-value and fold change value (set to FC threshold equal to 2.0 and t-test threshold equal to 0.5). Points meeting the criteria are highlighted in red and blue, respectively, indicating that they are significantly up-regulated / down-regulated, while grey indicates no significant fold change.

[0135] Fig.23Shown is a graph showing the effect of the plant growth promoting Pantoea isolate RR15 on the growth and development of resistant and susceptible potato cultivars 21 weeks after treatment (control = no bacteria - no pathogen; RR15 = no pathogen in the presence of bacteria; Sss+RR15 = pathogen infection in the presence of bacteria; Sss = pathogen only). Error bars show the standard deviation of the mean of four replicates. Different letters on the bars indicate statistically significant differences between treatments at p>0.05.

[0136] Fig.24 Shown are photographs showing tuber yield of resistant and susceptible varieties 21 weeks after treatment.

[0137] Fig.25 Shown are photographs showing the effect of strain Pantoea RR15 on the vegetative growth of resistant and susceptible potato cultivars at 4, 12 and 21 weeks after inoculation.

[0138] Fig.26 Shown are photographs showing the extent of development of disease symptoms in roots and tubers of resistant and susceptible potatoes 21 weeks after bacterial treatment. DETAILED DESCRIPTION

[0139] Nucleotide sequences are referred to herein by sequence identifier number (SEQ ID NO: ). A summary of sequence identifiers is provided in Table 1. A sequence listing is also provided at the time of filing this application.

[0140] Table 1 Summary of sequence identifiers

[0141] Sequence Identifier describe SEQ ID NO:1 Nucleotide sequence of oligonucleotide primer 515F SEQ ID NO:2 Nucleotide sequence of oligonucleotide primer 806R1 SEQ ID NO:3 Nucleotide sequence of oligonucleotide primer RR15-2F SEQ ID NO:4 Nucleotide sequence of oligonucleotide primer RR15-2R SEQ ID NO:5 Nucleotide sequence of oligonucleotide probe RR15-2prb SEQ ID NO:6 Nucleotide sequence of oligonucleotide primer RR09-1F SEQ ID NO:7 Nucleotide sequence of oligonucleotide primer RR09-1R SEQ ID NO:8 Nucleotide sequence of oligonucleotide probe RR09-1prb SEQ ID NO:9 Nucleotide sequence of oligonucleotide primer 341F SEQ ID NO:10 Nucleotide sequence of oligonucleotide primer 806R2

[0142] As noted above, the present invention is based in part on the isolation and characterization of rhizobacterial isolates that have a marked affinity for the plant rhizosphere environment. These pathogens have the ability to degrade pathogen irritating compounds in plant root exudates.

[0143] Therefore, certain disclosed embodiments provide bacterial strains, compositions, and methods having one or more advantages. For example, some advantages of some embodiments disclosed herein include one or more of the following: novel isolated bacterial strains (including isolated bacterial strains of Pantoea, Rhodococcus, Bacillus, Brevibacterium, and Streptomyces); isolated bacterial strain RR15 of Pantoea (deposited at the National Measurement Institute of Australia on June 9, 2022, with a deposit number of V22 / 011015); cultures, supernatants, and compositions containing the above strains; methods for using the strains to promote plant growth (including potato growth) and promote plant tuber yield; methods for using the strains to inhibit plant root infections (including potato root infections) caused by pathogens; methods for using the strains to inhibit plant root diseases (including potato root diseases) caused by pathogens; or providing commercial alternatives to existing compositions and methods. Other advantages of some embodiments of the present disclosure are provided herein.

[0144] Twelve bacterial isolates (named RR01, RR04, RR05, RR07, RR09, RR10, RR12, RR13, RR14, RR15, RR16, and RR17) that have been identified as colonizing the plant rhizosphere and showing the ability to grow in minimal media supplemented with L-glutamine or tyramine as the sole carbon source are described. RR01, RR04, RR05, RR12, RR13, RR14, RR15, RR16, and RR17 are Gram-positive bacteria, while RR07, RR09, and RR10 are Gram-negative. All isolates except RR12, which forms a single layer of hyphae and produces a string of spores, do not produce spores. The cells of the isolates varied in morphology, ranging from 0.3 to 0.9 μm in length and 0.5 to 1.2 μm in diameter. The overall morphology of these isolates was generally irregular to rounded in shape with raised or convex edges, a smooth shiny colony surface, and a range of white and yellow pigments. Cell morphology included spherical to rod-shaped cells, cell chains, single cells, and clustered organization of cells, which are summarized in Table 2 for RR08 (Bacillus), RR09 (Rhodococcus), RR12 (Streptomyces), RR15 (Pantoea), and RR17 (Breibacterium).

[0145] The bacterial strain Pantoea isolate RR15 exhibited a strong ability to degrade pathogen-stimulating compounds (including L-glutamine or tyramine) in potato root exudates. In addition, the strain promoted plant development and growth in both resistant and susceptible cultivars, as evidenced by visible root improvements and increased plant biomass. In addition, plant tubers treated with the RR15 bacterial inoculant exhibited enhanced emergence and early growth, and increased tuber yield (including increased tuber size and tuber weight) compared to untreated (control) plants.

[0146] Therefore, in a first aspect, the present invention provides an isolated bacterial strain RR15 of the genus Pantoea (deposited on June 9, 2022 at the National Measurement Institute of Australia (1 / 153 Bertie Street, Port Melbourne 3207, Victoria, Australia), with the deposit number V22 / 011015). The deposit was made in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and its regulations. This ensures that living cultures can be retained for 30 years from the date of deposit. In accordance with the terms of the Budapest Treaty, the organism will be provided by the National Measurement Institute. The treaty ensures that the public can obtain these organisms permanently and without restriction after the relevant patents are issued.

[0147] In the present invention, "isolated" refers to material that has been extracted from its original environment (e.g., the natural environment if it occurs naturally) and has thus been "artificially" modified from its natural state. For example, isolated bacterial strains encompassed herein are strains that have been extracted from their natural growth environment (i.e., plant rhizosphere roots and associated soil) by steps known in the art, including: washing plant roots; centrifuging the washed plant roots; resuspending the washed root pellet in a suitable culture medium (e.g., minimal salts medium); and subsequently plating to form single colonies.

[0148] The isolated bacterial strain RR15 of the genus Pantoea may be referred to herein as "RR15", "RR-15", etc. RR15 is a yellow Gram-negative bacterium having the morphological characteristics listed in Table 2 when plated on 2.5% (w / v) agar in minimal salts medium supplemented with one or both of glutamine and tyramine. The bacterium can also grow on the most common bacterial culture media, including Luria broth agar, tryptic soy agar, and nutrient agar. The morphological characteristics of RR15 colonies include rounded morphology with convex ridges, smooth colony surface, opaque appearance, and yellow color, with short rod-shaped cells present alone.

[0149] The above-mentioned isolated bacterial strains mentioned herein include mutants or variants of these strains (including mutants or variants of RR15). Therefore, the present invention also covers these mutants and variants. Mutants may include, but are not limited to, spontaneous ("naturally occurring") mutant strains or strains produced by mutagenesis of parent strains by chemical methods (such as treatment with N-methyl-N'-nitro-N-nitrosoguanidine or ethylmethane sulfone), gamma rays, x-rays or ultraviolet radiation, or other methods known to those skilled in the art. The variants of the bacterial strains described herein will have all the identification characteristics of the bacterial strains described herein, and can be identified as having a genome that hybridizes with the genome of the parent bacterial strain under high stringency conditions. Variant strains may also include cell fusion strains and genetically recombinant strains. The mutants and variants of the bacterial strains described herein retain the characteristics of the parent strains and may have higher activity than the parent strains in some cases.

[0150] The present invention also includes a culture of one or more bacterial strains described herein, including a culture of bacterial strain RR15. Standard techniques known in the art can be used to produce cultures of bacterial strains (e.g., see Ball AS, 1997, Bacterial Cell Culture: Essential Data, John Wiley & Sons, Inc.). These cultures also form the basis for supernatant separation as described below. The culture of one or more bacterial strains described herein may also include one or more additional bacterial strains (such as bacterial strains known to have significant affinity for plant rhizosphere environments, the ability to degrade pathogen-stimulating compounds in plant root exudates, and / or to promote plant growth).

[0151] The bacterial strains described herein can be grown in a nutrient medium (also referred to as a basal medium or complete medium) containing a carbon source for bacterial growth, water, various salts required for bacterial growth, and amino acids and a nitrogen source (e.g., beef, yeast extract). This is an undefined medium because the amino acid source contains a variety of compounds whose exact composition is unknown. Nutrient media contain all the elements required for most bacterial growth and are non-selective, so they are used for general cultivation and maintenance of bacteria in laboratory culture storage.

[0152] Bacterial cells can also be grown in minimal media. Minimal media include those containing the minimum nutrients suitable for bacterial growth (usually without amino acids). For example, minimal media can include: a carbon source for bacterial growth; various salts (which can vary depending on the bacterial species and growth conditions and provide elements that assist the bacteria in synthesizing proteins and nucleic acids (such as magnesium, nitrogen, phosphorus and sulfur); and water.

[0153] Generally, any enriched medium may be used, such as NB (nutrient broth), LB (Luria-Bertani broth, Luria broth, lysogeny broth), TB (terrific broth), or minimal medium with or without added carbon and nitrogen. The cells may be cultured in suitable flasks (shaking at, e.g., 150-300 rpm) in the presence of oxygen at a temperature ranging from at least 20° C. (for slow growth) to 37° C. (for fast growth) (OD 200,000). 600 For RR15, strain samples obtained from frozen sources can be grown from bacterial streaks on appropriate bacterial media as described above (such as Luria broth agar, tryptic soy agar, and nutrient agar). A single colony isolated from the bacterial streak can be inoculated into 100 mL of LB broth (1 L of medium containing 10 g peptone, 5 g yeast, and 5 g NaCl, pH 5.8) in a 250 mL flask in an orbital shaker (set at 150 rpm and 23°C) until an OD of preferably up to 1 is reached. 600 These parameters can be scaled up or down depending on the desired culture volume of the bacterial strain.

[0154] It has been shown herein that the bacterial strains encompassed by the present invention can metabolize L-glutamine and tyramine. Thus, in some embodiments, these bacterial strains can be cultured in a culture medium comprising glutamine and / or tyramine as the sole carbon source. Under these culture conditions, the concentration of glutamine and / or tyramine in the culture medium can be approximately 20 mM. As will be appreciated by those skilled in the art, other concentrations are contemplated.

[0155] The present invention also includes a supernatant obtained from a culture of one or more bacterial strains described herein (including a supernatant obtained from a culture of bacterial strain RR15). The supernatant can be obtained using standard techniques (e.g., by centrifuging a culture of bacterial cells to separate the cultured cellular material). Typically, but not necessarily, the supernatant can also be filtered after being separated from the cellular components of the culture.

[0156] Once separated from the culture supernatant, the cell components can also be stored as cell extracts for future use. Alternatively, culture cell samples in the form of culture suspensions can be stored for future use. In this regard, cell culture samples can be stored on agar slants for short periods of time, or mixed with 50% glycerol and frozen at -80°C for longer storage.

[0157] In some embodiments, the invention provides a kind of composition comprising bacterial strain as above, strain culture and / or culture supernatant.As those skilled in the art will appreciate, the amount of bacteria in said composition will be specified according to the character of said composition and the formula of said composition (being relevant with the mode that it is intended to be applied to plant), and this will be further described hereinafter.When composition is solid form (such as particle, microparticle or powder form), said composition can comprise the stabilization bacterial cell mixed with inert carrier (comprising talcum, vermiculite, perlite, diatomaceous earth, modified clay etc.).When composition is liquid form (such as the form of cell suspension, solution, emulsion or aerosol), said composition can comprise the stable bacterial cell mixed with suitable liquid carrier, and this is known in the art, and will be further described hereinafter.

[0158] The compositions encompassed by the present invention may include an excipient (also referred to herein as an "acceptable carrier"). Excipients may be any material that environmental samples (including soil and water samples), plants and / or plant materials can tolerate. Examples of these excipients include water, saline, Ringer's solution, glucose solution, balanced salt solution (Hank's solution) and other physiologically balanced saline solutions. Non-aqueous carriers may also be used, such as fixed oils, sesame oil, ethyl oleate or triglycerides. Materials that enhance the isotonicity and chemical stability of the composition are also examples of excipients. These materials may include various buffers (such as phosphate, bicarbonate and Tris buffer) and preservatives (such as thimerosal or o-cresol, formalin and benzyl alcohol). Excipients may also be used to extend the half-life of the composition, and include, for example, polymer controlled release carriers, biodegradable implants, liposomes, oils, esters and glycols.

[0159] In some embodiments, the composition described herein comprises a bacterial stabilizer. The stabilizer is biocompatible and ensures that the bacterial strain remains active in the composition before and after application. Therefore, the stabilizer will not reduce the activity of the bacterial strain. Suitable stabilizers are known in the art, for example, including xanthan gum, cellulose derivatives, acrylic acid derivatives, modified clays and highly dispersed silica.

[0160] In some embodiments, the compositions encompassed by the present invention further comprise a biological agent that enhances or supplements the activity of the bacterial strain present in the composition. For example, the biological agent can be another plant growth promoter (such as a compound with auxin activity). The compound with auxin activity can be natural or synthetic, such as IAA (indole-3-acetic acid), 2,4-D (2,4-dichlorophenoxyacetic acid) or NAA (1-naphthaleneacetic acid). The biological agent can also be an insecticide.

[0161] The compositions encompassed by the present invention can be formulated in a manner specified by the intended mode of application of the composition and the properties of the composition. Examples may include solutions, emulsions, suspensions, powders, foams, pastes, granules, sachets, aerosols, microcapsules of polymeric substances, and ULV cold mist and hot mist formulations. The nature of the formulation is not limited by the present invention. Depending on the formulation, the composition may require the presence of one or more liquid solvents, pressurized liquefied gases, solid carriers, emulsifiers and / or dispersants, and foam formers.

[0162] Examples of liquid solvents include aromatic hydrocarbons (such as xylene, toluene or alkylnaphthalene), chlorinated aromatic or chlorinated aliphatic hydrocarbons (such as chlorobenzene, vinyl chloride or methylene chloride), aliphatic hydrocarbons (such as cyclohexane or paraffins, for example mineral oil fractions), alcohols (such as butanol or ethylene glycol) and their ethers and esters, ketones (such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone), strongly polar solvents (such as dimethylformamide and dimethyl sulfoxide), water, and mineral, animal and vegetable oils (for example, palm oil or other vegetable seed oils).

[0163] Liquefied gas extenders or carriers are liquids that are gaseous at normal temperature and pressure, for example aerosol propellants (such as halogenated hydrocarbons and butane, propane, nitrogen and carbon dioxide).

[0164] Suitable solid carriers may include, for example, ground natural minerals (such as kaolin, clay, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth) and ground synthetic minerals (such as highly dispersed silica, alumina and silicates). Suitable solid carriers of particles include, for example, crushed and classified natural rocks (such as calcite, pumice, marble, sepiolite, dolomite and synthetic particles of inorganic and organometallic materials) and particles of organic materials (such as sawdust, coconut shells, corn cobs and tobacco stems).

[0165] Suitable dispersants and / or emulsifiers include nonionic, anionic or cationic dispersants or mixtures of nonionic or anionic dispersants. Suitable nonionic dispersants include ethylene oxide / propylene oxide block polymers, alkylphenol polyglycol ethers, tristyrylphenol polyglycol ethers and their phosphated or sulfated derivatives. Suitable anionic dispersants include lignin sulfonates, salts of polyacrylic acid and aryl sulfonate / formaldehyde condensates.

[0166] Binders (such as carboxymethyl cellulose), natural and synthetic polymers (such as gum arabic, polyvinyl alcohol and polyvinyl acetate) in powder, granule or latex form, natural phospholipids (such as cephalin and lecithin) and synthetic phospholipids can also be used to prepare the formulation of the composition of the present invention. Colorants (such as inorganic pigments (such as iron oxide, titanium oxide and Prussian blue) and organic dyes (such as madder pigment, azo and metal phthalocyanine dyes)) and trace nutrients (such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc) can also be included. When formulated, a wetting agent can also be included in the composition. Suitable wetting agents include diisopropyl or diisobutyl naphthalene sulfonate.

[0167] The formulation can also be a controlled release form, which can slowly release the composition into the environment (including soil) or slowly release it into or onto a plant, plant material or plant part. As used herein, a controlled release formulation is included in the composition of the present invention in a controlled release carrier. Suitable controlled release carriers include, but are not limited to, biocompatible polymers, polymer matrices, capsules, microcapsules, microparticles, pills, osmotic pumps, diffusion devices, liposomes and lipid globules. Preferred controlled release formulations are biodegradable (i.e., bioerodible).

[0168] Preferred controlled release formulations of the present invention are capable of releasing the composition to the target site preferably over a period of about 1 to about 12 months. Preferred controlled release formulations are capable of achieving treatment for preferably at least about 1 month (more preferably at least about 3 months, even more preferably at least about 6 months, even more preferably at least about 9 months, even more preferably at least about 12 months).

[0169] The bacterial strains encompassed by the present invention have the ability to promote plant growth when applied to plants. In this regard, the growth of the plant is increased relative to a control plant (e.g., a plant of the same origin to which the bacterial strain is not applied). A plant having an increased growth rate refers to a plant having an increased growth rate of 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 6 times, 70 times, 80 times, 90 times, 100 times or more compared to a control plant.

[0170] The term "when applied to plants" in the context of the present invention refers to applying the bacterial strain to the whole plant, applying the bacterial strain to a specific part of the plant (such as roots, seeds or vegetative propagation bodies (such as tubers)), applying the bacterial strain to the rhizosphere environment of the plant and / or applying the bacterial strain to the soil where the plant will or is being propagated. As mentioned above, the application of the bacterial strain includes the application of the bacterial strain itself, the application of the culture of the bacterial strain, the application of the supernatant obtained from the culture of the bacterial strain and / or the application of a composition comprising one or more of these substances.

[0171] In some embodiments, plant root growth is an indicator of plant growth. Plant root growth can be measured by root development, root length, root (fresh root and dry root) weight and root structure. In some embodiments, plant aerial part growth is an indicator of plant growth. Plant aerial part growth can be measured by aerial part development, aerial part length and aerial part (fresh aerial part and dry aerial part) weight.

[0172] In some embodiments, harvestable products including tubers, corms, bulbs, flowers, seeds and fruits are an indicator of plant growth. Harvestable products can be measured by weight, number, size and quality.

[0173] Thus, a plant with increased growth may be one having any one or more of the following characteristics or phenotypes (each relative to a corresponding control plant): (i) better root development; (ii) greater root length; (iii) greater root (fresh and dry) weight; (iv) better aerial development; (v) greater aerial length; (vi) greater aerial (fresh and dry) weight; (vii) increased yield, weight, quantity, size and / or quality of tubers, bulbs or other plant products; and (viii) increased weight, quantity, size and / or quality of flowers, fruits or seeds. Other parameters reflecting plant growth are also contemplated by the present invention. In this regard, examples of plants with increased growth may include: (ix) greater total dry matter weight; (x) greater fresh mass; (xi) greater root-to-crown ratio; and (xii) greater chlorophyll content per leaf.

[0174] The bacterial strains encompassed by the present invention have the ability to promote plant tuber yield when applied to plants, thereby increasing the tuber yield of the plant relative to a control plant (e.g., a plant of the same origin to which the bacterial strain is not applied). In some embodiments, this can be viewed as an increase in tuber size and / or tuber weight compared to an untreated (control) plant. Thus, a plant having increased tuber yield refers to a plant having an increased tuber yield of 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 6 times, 70 times, 80 times, 90 times, 100 times or more compared to a control plant.

[0175] Plants mentioned herein relate to all plant parts and plant populations, such as desired and undesired wild plants or crop plants (including naturally occurring crop plants). Crop plants can be plants obtained by traditional breeding and optimization methods, biotechnology and recombinant methods or a combination of these methods, including transgenic plants.

[0176] Plant parts refer to all above-ground and underground parts and organs of plants (such as herbs, pseudostems, shoots, leaves, bracts, leaf sheaths, petioles, blades, flowers and roots). Specific examples include leaves, needles, stalks, stems, flowers, fruiting bodies, fruits, roots, tubers, rhizomes, branches, root outgrowths and secondary growth. Plant parts also include crop material and vegetative and sexual propagation material (e.g., cuttings, tubers, grafts and seeds).

[0177] Examples of plants encompassed by the present invention include plant species and plant varieties and parts thereof, which are found in the wild or obtained by conventional biological breeding methods (such as hybridization, meristem culture, micropropagation, somatic embryogenesis, direct organogenesis or protoplast fusion). When referring to a plant, it is also possible to refer to transgenic plants and plant varieties obtained by recombinant methods (if appropriate, combined with traditional methods (transgenic organisms), such as transformation and micropropagation by particle bombardment of Agrobacterium or embryonic cells). Preferred plants are those commercially available or used plant varieties (such as plants that can produce fruits or vegetables or have other commercially valuable traits).

[0178] Plants encompassed by the present invention are those plants in which the bacterial strains of the present invention are able to colonize the rhizosphere environment of the plant. In some embodiments, plants encompassed by the present invention are those plants that contain L-glutamine and / or tyramine in the root exudates of the plant. Root exudation is an important process that determines the interaction between plants and the soil environment. Plant root exudates affect the composition of the plant's rhizosphere environment, which is the narrow soil area surrounding the roots of the plant. Methods for identifying the presence of glutamine and / or tyramine in the root exudates of plants are known in the art, including applications based on mass spectrometry.

[0179] Exemplary plants according to the invention include Solanaceae sp. (e.g., potatoes), cotton, flax, grapevines, vegetables, fruits (e.g., kiwifruit and pineapple), such as Rosaceae sp. (e.g., pome fruits such as apples, pears, in addition to stone fruits such as apricots, cherries, almonds, peaches, and soft fruits such as strawberries) or pomegranates of the genus Punica, Ribesioidae sp., Juglandaceae sp., Betulaceae sp., Anacardiaceae sp., Fagaceae sp., Moraceae sp., Oleaceae sp., Actinidaceae sp., Lauraceae sp., Musaceae sp. sp.) (e.g., banana plants, banana plantations, and plantain), Rubiaceae sp. (e.g., coffee), Theaceae sp., Sterculiceae sp., Rutaceae sp. (e.g., citrus, lemons, oranges, and grapefruit), Solanaceae sp. (e.g., tomatoes), Liliaceae sp., Asteraceae sp. (e.g., lettuce), Umbelliferae sp., Cruciferae sp., Chenopodiaceae sp., Cucurbitaceae sp. (e.g., cucumbers, melons, gourds, and pumpkins), Alliaceae sp. (e.g., leeks and onions), Papilionaceae sp. sp.) (e.g., peas), major crop plants such as Gramineae sp. (e.g., corn, maize, turf and cereals such as wheat, rye, rice, barley, oats, sorghum, millet, triticale, etc.), Asteraceae sp. (e.g., sunflower), Brassicaceae sp. (e.g., cabbage such as Chinese cabbage and red cabbage, broccoli, cauliflower, Brussels sprouts, pakchoi, kohlrabi and radish, in addition to rapeseed, mustard, horseradish and watercress), Fabacae sp. (e.g., beans and peanuts), Papilionaceae sp.) (e.g. soybean), Chenopodiaceae sp. (e.g. sugar beet, fodder beet, chard and beetroot), useful and ornamental plants for gardens and forests and, in each case, transgenic versions of these plants.

[0180] In some embodiments, the plant belongs to the Solanaceae family. The Solanaceae family is a class of flowering plants that includes annual and perennial herbs, lianas, creepers, epiphytes, shrubs, trees, many crops, medicinal plants, spices, weeds, and ornamental plants. The Solanaceae family includes many genera and species that are commonly collected or cultivated. The most economically important genus in this family is Solanum, which includes potato (S. tuberosum), tomato (S. tycopersicum), and eggplant (S. melongena). Another important genus (Capsicum) produces peppers and bell peppers. In some embodiments, the plant is a potato (Solanum tuberosum) genus and species.

[0181] When applied to plants, the bacterial strains encompassed by the present invention have the ability to inhibit plant root (and / or other plant parts present underground) infections caused by pathogens. When applied to plants, the bacterial strains encompassed by the present invention may also have the ability to inhibit plant root (and / or other plant parts present underground) diseases caused by pathogens. The measurement index of the inhibitory effect can be as follows: relative to control plants (e.g., plants of the same source to which the bacterial strains are not applied), plant root (and / or other plant parts present underground) infection is reduced, or plant root (and / or other plant parts present underground) disease is reduced. Plants having reduced infection and / or disease in the roots of plants (and / or other plant parts present below ground) are plants having 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 6-fold, 70-fold, 80-fold, 90-fold, 100-fold or more reduced infection or disease compared to control plants.

[0182] The degree of inhibition of infection and / or disease of plant roots (and / or other plant parts present underground) caused by pathogens can be measured in a variety of ways, and the degree of inhibition can depend on the plant type. Measurements of infection and / or disease of plant roots (and / or other plant parts present underground) can include the presence and abundance of invading pathogens in infected tissues and / or the presence and degree of galls, rots, lesions, malformed growth or growth retardation or other disease symptoms on plant roots (and / or other plant parts present underground). In some embodiments where the plant is a species of the genus Solanum, the degree of plant root infection and plant root disease can be determined with reference to the presence of tuber lesions or measurements of tuber yield (size and number of potato tubers).

[0183] Molecular biology-based methods can also be used to detect the presence and extent of pathogens in plant roots (and / or other plant parts present below ground). These methods include: using antibodies specific for the pathogen of interest; and detecting antibody binding using immunological assays (such as ELISA-based assays). PCR-based assays can also be used, where, for example, oligonucleotide primers specific for the pathogen of interest are used to amplify DNA obtained from plant roots.

[0184] In the context of the present invention, reference to pathogens encompasses any pathogen that can infect plant roots (and / or other plant parts present below ground).Plant pathogens are microorganisms belonging to a taxonomic group that includes bacteria, viruses, fungi, protozoa and nematodes.

[0185] Most phytopathogenic fungi belong to the classes Ascomycetes and Basidiomycetes. Fungi reproduce sexually and asexually by producing spores and other structures. Spores can be carried over long distances by air or water, and can also be spread through soil. Many soil-dwelling fungi are able to survive saprotrophically, completing part of their life cycle in the soil. Biotrophic fungal pathogens colonize living plant tissues and obtain nutrients from living host cells. Necrotrophic fungal pathogens infect and kill host tissues and extract nutrients from dead host cells. Important fungal plant pathogens of the class Ascomycetes include Fusarium spp., Thielaviopsis spp., Verticillium spp., Magnaporthe grisea, and Sclerotinia sclerotiorum. Important fungal plant pathogens of the Basidiomycetes include Ustilago spp., Rhizoctonia spp., Phakospora pachyrhizi, Puccinia spp., and Armillaria spp. Fungal-like organisms are also pathogenic. These fungal-like organisms include Oomycetes (such as Phytophthora spp. and Pythium spp.), Chytridomycetes (such as Olymphyte), and Phytomyxea (such as Plasmodiophora and Spongospora), which are also examples of soil-borne pathogens.

[0186] Most of the bacteria associated with plants are actually saprophytic bacteria and harmless to the plants themselves. However, a few species are pathogenic and cause diseases. Most plant pathogens are rod-shaped (bacilli). In order to be able to colonize on plants, they have specific virulence factors. Five main types of bacterial virulence factors are known, including cell wall degrading enzymes, toxins, effector proteins, plant hormones and exopolysaccharides. Pathogens such as Erwinia species use cell wall degrading enzymes to cause soft rot. Agrobacterium species change the level of plant auxins to use plant hormones to cause tumors. Exopolysaccharides are produced by bacteria and block the xylem vessels, which usually leads to plant death. Important bacterial plant pathogens include Agrobacterium spp., Burkholderia spp., Ralstonia spp., Pseudomonadota, Xanthomonas spp., Pseudomonas spp., Pectobacterium spp., Dickea spp., Clavibacter spp., Streptomyces spp., Xylella spp., and Candidatus Liberibacter spp.

[0187] Plant viruses are obligate intracellular parasites that do not have the molecular machinery to replicate in the absence of a host. Plant viruses can be pathogenic to higher plants. Most plant viruses are rod-shaped, with protein disks forming a tube surrounding the viral genome; isometric particles are another common structure. They rarely have an envelope. Most viruses have an RNA genome, which is usually a small single-stranded (ss) RNA genome, but some have double-stranded (ds) RNA, ssDNA, or dsDNA genomes. In order to spread from one plant to another and from one plant cell to another, plant viruses must use strategies that are generally different from those of animal viruses. Most plants do not move, so plant-to-plant transmission usually involves vectors (such as insects). Examples of plant viruses include Tobacco mosaic virus, Tomato spotted wilt virus, Tomato yellowleaf curl virus, Cucumber mosaic virus, Potato virus Y, Cauliflower mosaic virus, African cassava mosaic virus, Plum pox virus, Brome mosaic virus, Potato virus X, Citrus tristeza virus, Tobacco rattle virus, Barley yellow dwarf virus, Potato leafroll virus, and Tomato bushy stunt virus.

[0188] Nematodes are small multicellular worm-like animals. Many nematodes live freely in the soil, but some species also parasitize plant roots. Plant parasitic nematodes belong to several genera and can have different parasitic lifestyles, including endoparasitic (living inside the plant) and ectoparasitic (living and feeding outside the body). Endoparasites can be migratory (moving easily within the invaded tissue) or sedentary (staying in place once infection occurs). Some nematodes also have the ability to transmit plant viruses. Globodera pallida and G. rostochiensis are examples of potato cyst nematodes, which cause significant losses in Europe every year. Cyst nematodes are sedentary root-feeding endoparasites. Root-knot nematodes, such as Meloidogyne spp., are also common sedentary root-feeding endoparasites with a fairly large host range. Root-knot and cyst nematodes can cause radical changes in root cells to facilitate their lifestyle. Lesion nematodes, such as Pratylenchus spp., are ectoparasites of plant roots and commonly affect a wide variety of plant species.

[0189] In some embodiments, the pathogen is the potato powdery scab fungus (Sss) that causes powdery scab in potatoes. Potato powdery scab can infect the underground structure of the host plant. Infection causes host cell hypertrophy and hyperplasia and eventually rupture. Zoospores infect root hairs by attaching to the outer surface, forming cysts and then penetrating the epidermis. Once inside, the multinuclear plasmodium splits to form zoosporangium, which in turn produces secondary zoospores, which will be released and promote further infection. Root infection can occur at all stages of plant development. In the later stage of root infection, the infected host cell enlarges into galls. A pellet of dormant spores is formed in the root gall, which is called a dormant spore pile. Eventually, the gall swells up, breaks through the epidermis of the tuber, and releases spores back into the soil. The severity of the gall depends on the level of the inoculum, the soil environment and the potato cultivar. Tuber infection is most common in the early stages of tuber formation, and potato tissue is not corked. Blister-like lesions form, in which dormant spore masses form. As the lesions mature, they burst, releasing the dormant spore mass inoculum into the soil. The dormant spore masses within the tuber lesions look like powdery masses, which gives the disease its name.

[0190] As described above, the bacterial strains covered by the present invention have the ability to promote plant growth. Therefore, the present invention provides a method for promoting plant growth, the method comprising: applying an effective amount of the bacterial strains, cultures of the bacterial strains, culture supernatants and / or compositions containing them as described above to plants or soil in which the plants will or are growing.

[0191] The term "application to plants" as used herein has the same meaning as the term "when applied to plants" as defined above. In practice, the method is carried out directly on the whole plant or parts of the plant, or by acting on the plant's surroundings, such as the soil in which the plant is propagated, the rhizosphere environment or the general habitat of the plant. The bacterial strains, cultures of bacterial strains, supernatants of cultures and / or compositions comprising them can be applied to the plant using standard treatment methods, such as spraying, dipping, atomizing, irrigating, dusting, spraying, foaming, coating, painting, watering, drip irrigation, etc. As described above, the materials to be applied will be formulated accordingly.

[0192] As described above, the bacterial strains covered by the present invention have the ability to promote plant tuber yield. Therefore, the present invention provides a method for promoting plant tuber yield, the method comprising: applying an effective amount of the bacterial strains, cultures of the bacterial strains, culture supernatants and / or compositions containing them as described above to plants or soil in which the plants will or are growing.

[0193] As described above, the bacterial strains covered by the present invention have the ability to inhibit plant root infection caused by pathogens and inhibit plant root diseases caused by pathogens. Therefore, the present invention provides a method for inhibiting plant root infection caused by pathogens or inhibiting plant root diseases caused by pathogens, the method comprising: applying an effective amount of the bacterial strains, cultures of the bacterial strains, culture supernatants and / or compositions containing them as described above to plants or soil in which the plants will or are growing.

[0194] In some embodiments, the inhibition of plant root infection and plant root disease can be achieved by treating the propagation material of the plant with bacterial strains, cultures of bacterial strains, supernatants of cultures and / or compositions comprising them. Plant propagation material refers to any part or product of a plant that can produce another plant with the same basic characteristics alone or in combination with other parts or products of the plant. In this regard, propagation material can include seeds, cuttings, seedlings, etc.

[0195] Treatment of plant propagation material protects the material and germinating plants from soil-borne pathogens, thereby avoiding the need to treat plant crops at or shortly after planting. In the case of treatment of plant seeds, by seed encrustation, seed coating, etc., the material to be applied is preferably formulated as a dry powder for dry seed treatment, a solution for seed treatment, or a water-soluble powder for slurry treatment.

[0196] In some embodiments of the methods described herein, bacterial strains, cultures of bacterial strains, supernatants of cultures, and / or compositions comprising them can be applied to soil in which plants are growing, plants are to be propagated, or propagation materials of plants are to be grown. Alternatively, soil can be prepared in advance to contain related materials such as in a slow-release formulation. Related materials can be applied to soil in which plants are growing by any suitable method as described above (e.g., by plant crop spraying, crop irrigation, crop watering, crop drip irrigation, etc.).

[0197] The methods for inhibiting plant root infections and inhibiting plant root diseases as described herein can be practiced in both a treatment and a preventative manner.

[0198] As mentioned above, the methods described herein need to apply an effective amount of bacterial strains, cultures, supernatants or compositions comprising one or more of these substances. An effective amount is an amount that a bacterial strain, culture, supernatant or composition promotes plant growth, inhibits plant root infection and / or inhibits plant root disease when applied to a plant. The amount applied to the plant will depend on the specific characteristics of the bacterial strain, the plant to be treated (or soil) and the properties of the material preparation. Those skilled in the art will be able to determine suitable dosages based on these and other factors. The effective amount of bacterial strains of the present invention, cultures, supernatants or compositions comprising one or more of these substances is not particularly limited.

[0199] For the treatment of plant parts, the effective application rate of the relevant materials is generally 0.1 to 10,000 grams per hectare. For the treatment of plant propagation material, the effective application rate of the relevant materials is generally 0.001 to 50 g / kg of propagation material. For application to the soil in which the plant is growing, the plant will be propagated therein, or the propagation material of the plant will be grown therein, the effective application rate of the relevant materials is generally 0.1 to 10,000 grams per hectare.

[0200] The following aspects of the invention reflect specific embodiments of the invention and do not limit the scope of the invention as described herein.

[0201] In a second aspect, the present invention provides a composition comprising an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0202] In a third aspect, the present invention provides a composition comprising a culture of an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0203] In a fourth aspect, the present invention provides a composition comprising the supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0204] In a fifth aspect, the present invention provides a method for promoting plant growth, the method comprising: applying to the plant or the soil in which the plant will or is propagating an effective amount of:

[0205] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0206] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0207] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0208] (iv) A composition comprising (i), (ii) and / or (iii).

[0209] In a sixth aspect, the present invention provides a method for increasing plant tuber yield, the method comprising: applying to the plant or the soil in which the plant will or is propagating an effective amount of:

[0210] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0211] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0212] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0213] (iv) A composition comprising (i), (ii) and / or (iii).

[0214] In a seventh aspect, the present invention provides a method for inhibiting plant root infection caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0215] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0216] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0217] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0218] (iv) A composition comprising (i), (ii) and / or (iii).

[0219] In an eighth aspect, the present invention provides a method for inhibiting plant root diseases caused by pathogens, the method comprising: applying to a plant or soil in which the plant will or is growing an effective amount of:

[0220] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0221] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0222] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0223] (iv) A composition comprising (i), (ii) and / or (iii).

[0224] In a ninth aspect, the present invention provides a composition for promoting plant growth, increasing plant tuber yield, inhibiting pathogen infection of plant roots and / or inhibiting plant root diseases caused by pathogens, the composition comprising an effective amount of:

[0225] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0226] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0227] (iii) The supernatant of the culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0228] In a tenth aspect, the present invention provides a composition, when used to promote plant growth, increase plant tuber yield, inhibit pathogen infection of plant roots and / or inhibit plant root diseases caused by pathogens, the composition comprises an effective amount of:

[0229] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0230] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0231] (iii) The supernatant of the culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015).

[0232] In an eleventh aspect, the present invention provides a method for promoting plant growth, the method comprising: applying to the plant or the soil in which the plant will or is propagating an effective amount of:

[0233] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0234] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0235] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0236] (iv) A composition comprising (i), (ii) and / or (iii).

[0237] In a twelfth aspect, the present invention provides a method for increasing plant tuber yield, the method comprising: applying to the plant or the soil in which the plant will or is propagating an effective amount of:

[0238] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0239] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0240] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0241] (iv) A composition comprising (i), (ii) and / or (iii).

[0242] In a thirteenth aspect, the present invention provides a method for inhibiting plant root infection caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0243] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0244] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0245] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0246] (iv) A composition comprising (i), (ii) and / or (iii).

[0247] In a fourteenth aspect, the present invention provides a method for inhibiting plant root diseases caused by pathogens, the method comprising: applying to the plant or the soil in which the plant will or is growing an effective amount of:

[0248] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0249] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0250] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0251] (iv) A composition comprising (i), (ii) and / or (iii).

[0252] In a fifteenth aspect, the present invention provides a composition comprising:

[0253] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0254] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0255] (iii) the supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10.

[0256] As described above, the present invention relates to bacterial strains capable of degrading pathogen stimulating compounds (such as L-glutamine and tyramine) in plant root exudates in the rhizosphere environment of plants. Therefore, in a sixteenth aspect, the present invention provides a method for reducing the level of one or more pathogen stimulating compounds in the rhizosphere environment of a plant, the method comprising: applying to a plant or soil in which the plant will or is growing an effective amount of:

[0257] (i) an isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015);

[0258] (ii) a culture of the isolated bacterial strain RR15 of the genus Pantoea (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); and / or

[0259] (iii) a culture supernatant of an isolated bacterial strain of the genus Pantoea, strain RR15 (deposited with the National Measurement Institute of Australia on 9 June 2022, with accession number V22 / 011015); or

[0260] (iv) A composition comprising (i), (ii) and / or (iii).

[0261] In a seventeenth aspect, the present invention provides a method for reducing the level of one or more pathogen stimulating compounds in the rhizosphere environment of a plant, the method comprising: applying to the plant or to the soil in which the plant will or is growing an effective amount of:

[0262] (i) an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10;

[0263] (ii) a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or

[0264] (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or

[0265] (iv) A composition comprising (i), (ii) and / or (iii).

[0266] In some embodiments of the sixteenth or seventeenth aspect of the invention, the one or more pathogen stimulating compounds are selected from L-glutamine and tyramine.

[0267] With regard to the second to seventeenth aspects of the present invention, the properties of plant growth promotion, plant tuber yield enhancement, plant root growth promotion, plant families and species, plant root infection inhibition, plant root disease inhibition, pathogens, biological agents, plant growth promoters, bacterial stabilizers, the manner of applying the composition to plants, etc. have been described above with regard to the first aspect of the present invention.

[0268] The present invention is further described in the following examples, which are intended only to describe specific embodiments and are not intended to limit the above description.

[0269] Example 1

[0270] Selection of rhizobacteria that degrade root exudate compounds associated with pathogen germination and chemotaxis

[0271] Root exudates have been implicated in mediating interactions between plants and diverse soil biota, including rhizosphere microbial populations, and, less commonly, plant pathogens. Potato root exudates such as L-glutamine (Gln) and tyramine (Tyr) have previously been shown to facilitate the germination of dormant spores of the plasmodiophorid pathogen Pseudomonas solanacearum. The aim of this study was to isolate and characterize bacteria capable of degrading Gln and Tyr in the potato rhizosphere, thereby indirectly inhibiting the pathogen infection process. This is the first study to describe the selection of rhizobacteria capable of degrading potato pungent compounds as targets to combat germination and attraction of plant pathogens.

[0272] Materials and Methods

[0273] Unless otherwise specified, all media and buffers used were of analytical grade and purchased from Sigma-Aldrich Pty Ltd. (St. Louis, MO, USA). Assay preparations were diluted with Milli-Q (Merck kGaA, Darmstadt, Germany) deionized purified water and sterilized by autoclaving.

[0274] Isolation and initial screening of cultures

[0275] Rhizosphere samples were collected from five randomly selected plants of a commercial potato cultivar ("ranger russet") grown in northwest Tasmania. Potato plants were sampled approximately 75 days after planting. The plant roots were shaken to remove loosely attached soil; the remaining soil firmly attached to the roots was considered the rhizosphere soil (Barillot CDC et al., 2012, Annals of Microbiology, 63(2): 471-476). The roots were rinsed four times in a conical flask filled with salted distilled water (0.85% NaCl) and vortexed three times for 30 seconds. Subsequently, the cleaned roots were transferred to a 50 mL Falcon centrifuge tube filled with 30 mL phosphate buffered saline (PBS, 0.1 M) and centrifuged at 12000 x g for 15 minutes at 25°C. The supernatant was discarded, and the resulting rhizosphere soil pellet was collected and stored at 4°C for later use (Barillot CDC et al., 2012, supra; Buermans HO and den Dunnen JT, 2014, Biochim Biophys Acta, 1842(10):1932-1941). To isolate bacteria, 0.2 g of the pelleted rhizosphere soil was added to 50 mL of sterile minimal salt medium (MSM) broth, and the mixture was centrifuged at 3000 g for 5 minutes. The supernatant was serially diluted 10 times with MSM. -1 Up to 10 -8 A 150 μl aliquot was plated on agar containing filter-sterilized Gln (2.92 mg L -1 ) or Tyr(2.74mg L -1 ) 2.5% (w / v) agar MSM stock solution (1X). The plate was inverted, incubated at 18-23°C, and the growth was monitored. Bacteria with morphologically different colonies and coloration were selected for subculture, purification, and restreaking on fresh agar plates ( Figure 1). To confirm the purity of the culture, standard microbiological assessments were performed, including streaking on nutrient agar and macroscopic and microscopic observations of colony and cell morphology by wet mount and Gram staining according to Bergey's Manual of Systematic Bacteriology: Volume 3. The Firmicutes (DeVos PG et al., 2009, Bergey's Manual of Systematic Bacteriology: Volume 3. The Firmicutes). Pure cultures were stored in 50% glycerol and kept at -80°C.

[0276] Identification of isolates

[0277] Colony and cell morphology

[0278] Visual observations of colony growth on solid media were assessed using a Leica MZ12 stereomicroscope (magnification 2x). Cells collected from fully developed colonies were Gram-stained and cell morphology was evaluated using a Leica DMLB compound microscope (Lieca Microsystem, Wetzlar GmbH, Germany) at 400x magnification.

[0279] Molecular typing and phylogenetic analysis

[0280] Genomic DNA was extracted from 48-hour exponentially growing cultures using the dNeasy Ultra Clean Microbial Kit (Qiagen, Germany) according to the manufacturer's protocol. The DNA extract was then used for 16S rRNA gene amplification using primers 515F: 5'-GTGCCAGCMGCCGCGGTAA-3' (SEQ ID NO: 1) and 806R1: 5'-GGACTACHVGGGTWTCTAAT-3' (SEQ ID NO: 2). The reaction was performed on an Eppendorf Master cycler using the following thermal cycle profile: 95°C (5 minutes), followed by 30 cycles of 95°C (1 minute), 65°C (1 minute) and 72°C (1.5 minutes); and a final extension of 72°C (10 minutes). After electrophoresis in 1% agarose gel and 0.01% SYBR safe DNA gel stain (Invitrogen, USA), PCR products were visualized under blue light and purified using the QIAquick PCR purification kit (Qiagen, Germany) following the manufacturer's instructions. The quality and concentration of the extracted gDNA were determined using a 2.0 fluorometer (Lifetechnologies, Darmstadt, Germany) and sent to the Australian Genome Research Facility for sequencing (http: / / www.agrf.org.au / ). To determine the putative identity of the bacteria, homology searches were performed using the Gen Bank DNA database (http: / / www.ncbi.nlm.nih.gov) using the BLAST program. Nucleotide substitution rates and bacterial sequence alignments were defined by ClustalW software (Thompson JD et al., 1994, Nucleic Acids Res., 22: 4673-4680). Evolutionary analysis was tested using MEGAX bootstrapping with 1000 replicates (Saitou N and Nei M, 1987, Mol. Biol. Evol., 4 (4): 406-425). Phylogenetic trees were drawn to scale, with branch lengths in the same units as used to infer the phylogenetic tree.Evolutionary distances were calculated using maximum likelihood and neighbor-joining methods performed in MEGAX (Tamura K et al., 2004, PNAS, 101: 11030-11035).

[0281] Bacterial degradation characteristics test

[0282] To achieve a uniform inoculum size, bacterial isolates that grew well on Gln or Tyr as the sole carbon source were enriched by inoculating them into 100 mL of LB broth (1 L medium (pH 5.8) containing 10 g of peptone, 5 g of yeast, and 5 g of NaCl) in a 250 mL flask in an orbital shaker set at 150 rpm and 23 °C until OD 600=1 (Lami MJ et al., 2020, J. Appl. Microbiol., 129(5): 1321-1336). Subsequently, the bacterial cells were harvested by centrifugation at 6000g for 5 minutes at 4°C. Then, the procedure was repeated three times under similar conditions, while 1 mL of the culture solution was removed and reconstituted in 100 mL of fresh MSM medium, which was then used as the starting culture for further studies (Krishnan M et al., 2018, Sci. Rep., 8(1): 2609. doi10.1038 / S41598-018-20718-1). The culture medium from each bacterial isolate (adjusted to OD 1.0) was introduced into 50 mL of MSM supplemented with 20 mM filter-sterilized Tyr and Gln (Millex-GS syringe filter device, 0.22 μm). 600 =0.110 -8 CFU mL -1 The degradation potential of the selected isolates was studied by adding 100 μL of active inoculant of 1% (set value) of 1% (set value). All flasks were incubated at 18-23°C on an orbital shaker set at 150 rpm. Uninoculated sterile culture medium was used as a control to examine abiotic degradation under the same conditions (Mahboubifar M et al., 2010, Food Analytical Methods, 4 (2): 150-154). 1 mL of aliquots of inoculated broth were taken out regularly to measure turbidity by OD on a spectrophotometer (λ = 600 nm) for bacterial growth monitoring; at the same time, the residual compounds in the culture samples were transferred to Falcon centrifuge tubes and centrifuged at 12000 × g for 5 minutes, while the supernatant was collected and transferred to a collection tube for reversed phase ultra-high pressure liquid chromatography (UPLC) analysis. For all experiments, each test was performed in triplicate.

[0283] In vitro evaluation of root colonization ability

[0284] The ability of two bacterial strains (designated RR15 and RR09) to colonize potato roots of three-week-old tissue-cultured potato plants (cv. Ranger Russet) was examined. Roots of 36 potato plants (6 time points × 2 bacterial isolates × 3 replicates) were suspended in 20 mL of liquid potato medium and incubated with 10 -8 CFU mL -1 Suspensions of either bacterial isolate were treated and then sampled at 24-hour intervals over 15 days (three replicates per sampling). External (root surface) and internal (within root tissue) populations of inoculated bacteria were quantified on potato proliferation broth at 1, 3, 6, 9, 12, and 15 days after inoculation.

[0285] To determine the root surface colonization, roots of each replicate plant were cut and weighed and placed in 50 mL Falcon centrifuge tubes containing 25 mL sterile phosphate buffered saline (pH 7.4). After vortexing the tubes at 5000×g for 5 minutes, the suspension was collected and serial dilutions of the suspension were plated on LB agar. Then, the number of viable cells was counted and expressed as CFU / gram root. At the same time, the same roots were used again to identify root colonization. Then, the roots were surface sterilized in three steps: washing with ethanol for 60 seconds; washing with 3.1% sodium hypochlorite (NaOCl) for 6 minutes; washing with ethanol for 30 seconds; and finally rinsing in sterile Milli-Q water. To confirm bacterial colonization within the root tissue, the root segments were macerated and the homogenate was placed in a collection tube. DNA was isolated from the homogenate after centrifugation at 3000g for 10 minutes at 4°C ( Figure 2 Total DNA was extracted using the Qiagen dNeasy Power Plant Pro kit.

[0286] The two candidate isolates were quantified in planta using primers unique to the target strains to amplify 250-300 bp. Primers unique to the target strains were used to amplify 250-300 bp and two candidate isolates were quantified in planta simultaneously. Primers and TaqMan probes were designed based on the 16S region of each isolate using Primer Quest software. Primers RR15-2F (ACGGCCGCAAGGTTAAA) (SEQ ID NO: 3), RR15-2R (GCTGGATGTCAAGAGTAGGTAAG) (SEQ ID NO: 4) and probe RR15-2 prb (ACAAGCGGTGGAGCATGTGGTTTA) (SEQ ID NO: 5) were used to detect and count isolate RR15, while primers RR09-1F (CGGAATCACTGGGCGTAAA) (SEQ ID NO: 6), RR09-1R (GTTCCACCAACCTCTACCATAC) (SEQ ID NO: 7) and probe RR09-1prb (CGGAATCACTGGGCGTAAA) (SEQ ID NO: 8) were used to monitor isolate RR09. In order to normalize the qPCR results for quantitative analysis, the marine bacterium Pseudoaltemoranas prydzensis was used as a positive internal reference (Bowman JP, 1998, Int. J. Syst. Bacteriol., 48 Pt 3, 1037-1041). qPCR was performed using the Rotor-Gene Q system (Qiagen, Hilden, Germany) using 10 ng of bacterial DNA and HEX probes. Three biological replicates (each with three technical replicates) were used to analyze each sample. The basic curve method defined for qPCR analysis was used to analyze relative quantification.

[0287] In situ assessment of metabolite degradation by bacterial isolates

[0288] A total of 64 potato plants were grown in a greenhouse maintained at 20 ± 2 ° C for 8 weeks. At 2, 4, 6 and 8 weeks after bacterial inoculation, four pots were randomly selected from each group (untreated control plants and plants treated with bacteria) for exudate collection. Root exudate metabolites from potted plants were collected through a hole in the center of the conical pot bottom in the following manner: first, the soil was soaked with 300 mL of distilled water for 2 hours, and then an aliquot of 100 mL of leachate (hereinafter referred to as root exudate) was collected from the pot. The leachate was shaken at 100 rpm for 10 minutes and then centrifuged at 5000 x g for 10 minutes. The supernatant containing water-soluble components was sterilized by filtration through a 0.22 μm microporous filter, frozen, and stored at -20 ° C, and then analyzed by UPLC-tandem mass spectrometry (UPLC-MS / MS). The analysis targeted 16 common amino acids (aAs) and 23 common organic compounds (oCs) previously found in soil-root exudates of potato plants (Balendres MA et al., 2016a, J. Agric. Food Chern., 64(40):7466-7474; Balendres MA et al., 2016b, Australasian Plant Pathology, 45(3):229-240).

[0289] Statistical analysis

[0290] ANOVA and Tukey's HSD post hoc test were used to examine mean differences between treatments, with a significance threshold of p ≤ 0.05 for SPSS Statistics version 28.0.0.0 (SPSS Inc., NY, USA). The values ​​of metabolite data were log10 transformed using the R package MetaboAnalystR (https: / / www.metaboanalyst.ca / ) to meet the assumptions of normality and homogeneity of variance in ANOVA.

[0291] result

[0292] Characterization of bacterial isolates

[0293] The overall morphology of representative bacterial strains grown on minimal medium modified with Gln and Tyr as the sole carbon source was found to be generally irregular to round in shape, with raised or convex edges, a smooth shiny colony surface, and a range of white and yellow pigments. Cell morphology included spherical to rod-shaped cells, cell chains, single cells, and clustered organizations of cells ( Figure 3 ; Table 2).

[0294] Table 2 Gross morphology of candidate bacterial isolates capable of degrading Gln and Tyr

[0295]

[0296] Classification is based on Bergey's Manual of Systematic Bacteriology, published in 1984 (see De Vos PG et al., 2009, supra).

[0297] Bacterial isolates RR01, RR04, RR05, RR16, RR17, RR12, RR13, RR14, and RR15 were Gram-positive, while isolates RR07, RR09, and RR10 were Gram-negative. All isolates did not produce spores, except RR12, which formed a layer of hyphae and produced a string of spores. The cells of the isolates varied in morphology, ranging from 0.3 to 0.9 μm in length and 0.5 to 1.2 μm in diameter.

[0298] like Figure 4 As shown in Figure 1, bacteria cultured in minimal medium supplemented with 20 mM Gln or Tyr exhibited significant changes in growth as measured by the turbidity of the medium. Bacterial assays supplemented with Gln appeared viscous and turbid, but assays supplemented with Tyr were less turbid even after 96 hours. In the presence of Gln, isolate RR17 (OD 600 =2.1), RR15(OD 600 =5.1), RR09(OD 600 =5.6) grew faster than the other isolates tested ( Figure 4 A-left), which results in a more rapid depletion of Gln from the culture medium ( Figure 4 B-left panel). On the other hand, all isolates grew relatively poorly in medium supplemented with Tyr ( Figure 4 A-right), as evidenced by the fact that the degradation of Tyr during the incubation period was less than 100% ( Figure 4 B-right).

[0299] like Figure 5 As shown, after 48 hours, no RR15 bacterial assay (0.002 ± 0.003 ng / mL) was detected in the culture medium. -1 Hour -1 ) had residual glutamine in the supernatant, while isolate RR09 (0.017±0.009ng / mL -1 Hour -1 ) took 96 hours to reach a similar level of glutamine substrate degradation. The degradation rate of tyramine by both isolates was lower than that of glutamine, but the degradation rate of tyramine by isolate RR15 was higher than that of isolate RR09, with an average of 0.035±0.019 ng / mL, respectively. -1 Hour -1and 0.058±0.004ng / mL -1 Hour -1 .

[0300] Bacterial identification and degradation characteristics

[0301] Sequencing of a portion of the 16s rRNA gene of five of the most promising bacterial isolates based on the degradation rates of Gln and Tyr revealed 99–100% homology with Pantoea species (RR15), Rhodococcus species (RR09), Bacillus species (RR08), ​​Brevibacterium species (RR17), and Streptomyces species (RR12). Figure 6 ). These five species belong to three common soil bacterial phyla, namely: Firmicutes, Proteobacteria, and Actinobacteria. 16S rRNA sequence comparison showed that isolate RR15 had 99% GC homology with P.vagans LEM67, while strain RR09 had 99% GC homology with Rhodococcus species IN105 ( Figure 7 ).

[0302] Bacterial colonization in roots

[0303] The ability of the isolated rhizobacterial strains RR15 and RR09 to colonize potato roots was evaluated by conventional colony forming unit measurements, microscopic observations, and quantitative PCR. The results showed that both isolates successfully colonized the internal and external surfaces of the roots. Compared with RR09, strain RR15 colonized the root hair surface and intercellular spaces faster in the elongation zone ( Figure 8 AB). In most cases, isolate RR15 was detected in differentiated zones of potato roots and appeared on the surface of root hairs after inoculation ( Figure 8 D), while isolate RR09 was observed to be randomly attached along the basal region of the root hair surface, while showing no preferred site for external colonization ( Figure 8 C).

[0304] In situ degradation of key compounds

[0305] UPLC-MS / MS was used to evaluate the metabolomic profile of control and bacterial-treated plants potted under greenhouse conditions. A total of 39 low molecular weight compounds (16 amino acids and 23 other organic compounds) were determined in all samples. Two bacterial isolates, RR15 and RR09, reduced the target metabolites alone or in combination. The results showed that bacterial degradation of Gln was significantly reduced after inoculation with the bacterial isolates alone or in combination, while Tyr degradation was slower, with only considerable losses observed after co-inoculation with the bacterial isolates ( Fig. 9A). When observing the in situ degradation trends of Gln and Tyr over time, the degradation of glutamine by bacterial isolate RR15 was observed as early as 2 weeks and was almost undetectable after 8 weeks; however, even though the degradation caused by isolate RR09 could be observed as early as 2 weeks, Gln levels somehow started to increase after 8 weeks, while the decrease in Gln levels was delayed until 6 weeks when co-inoculated ( Fig. 9 B). At the same time, whether it is improved by single inoculation or mixed inoculation, the reduction of Tyr concentration occurs after 4 weeks, but the main difference is that although RR15 and RR09 can reduce Tyr levels for up to 8 weeks, co-inoculation reduces Tyr concentration to the minimum detection limit as early as 4 weeks ( Fig. 9 B). In the control group, Gln or Tyr levels remained high, while a decrease was observed after 8 weeks ( Fig. 9 B).

[0306] When examining the various components found in the potato rhizosphere, it was observed that the bacterially amended plants released various amino acids and organic compounds in the soil exudates. Interestingly, succinic acid and lactic acid seemed to be produced in large quantities in the treated plants but not in the control plants, while chlorogenic acid and caffeic acid seemed to be quite high in the control plants but gradually decreased in the treated samples (Table 3).

[0307] Although most metabolites changed according to treatment and time, several compounds were not detected in the control or treatment groups (Table 3), such as amino acids (threonine, serine, alanine, histidine, methionine, and lysine) and organic compounds (piperidine, tartaric acid, malic acid, syringic acid, and gluconic acid) as well as sugars (ribose C5, sucrose disaccharide, and glucose C6). However, gallic acid, lactic acid, succinic acid, isoleucine, leucine, putrescine, choline, and valine showed significant fold differences between the control and treatment groups ( Fig.10 ).

[0308] Table 3 Amino acids and organic components in the potato metabolome quantified 8 weeks after bacterial inoculation

[0309]

[0310]

[0311] Discussion

[0312] In this study, 12 culturable bacteria were isolated from the potato rhizosphere environment that were able to grow on minimal medium supplemented with Gln or Tyr as the sole carbon source. Among these isolates, two isolates (RR15 and RR09) showed the greatest ability to rapidly and completely degrade Gln and Tyr. Morphological and molecular identification revealed that isolates RR15 and RR09 were members of the genera Pantoea and Rhodococcus, respectively.

[0313] Pantoea species are Gram-negative yellow bacteria belonging to the Enterobacteriaceae family and include many species isolated from different environments (Walterson & Stavrinides, 2015). Rhodococcus species are non-spore-forming, non-motile, aerobic Gram-positive members of the Nocardiaceae family (Johnson KB and Stockwell VO, 1998, Annual Rev. Phytopathol., 36: 227-248). Pantoea and Rhodococcus species are the main members of soil communities in the Proteobacteria and Actinobacteria phyla, respectively, and have been shown to have good ability to degrade metabolites and other organic molecules (Blaszak M et al., 2011, Water, air, and soil pollution, 220(1-4):373-385; Zeng Q et al., 2016, pLoS ONE:11(4):e0152894, https: / / doi.org / 10.1371 / journal.pone.0152894). Several Pantoea isolates have been developed as commercial biocontrol agents, which have the ability to resist protozoa through competitive niche exclusion, antibiotic production and induce plant systemic resistance (Johnson KB and Stockwell VO, 1998, supra; Johnson KB et al., 2000, Phytopathology, 90(11):1285-1294).

[0314] Pantoea species also show remarkable environmental diversity and adaptability as well as a wide range of biosynthetic and biodegradation capabilities. Some Rhodococcus strains have been studied for their commercial uses due to their unique ability to degrade and / or transform refractory compounds, making them ideal strains for biocatalysis and bioremediation processes (Alvarez H, 2010, Biology of Rhodococcus. Springer Science & Business Media, pp. 231-256. Mendez-Volas, A. Microbes in applied research; current advances and challenges; proceedings. World Scientific, pp. 197-200).

[0315] Many reports have documented the degradation of aromatic hydrocarbons by Gram-negative bacteria. For example, Pseudomonas putida has a plasmid-encoded degradative nah gene (encoding an upstream pathway enzyme involved in the conversion of naphthalene to salicylate), which is identical to Ralstonia sp. U2, which has a nag gene containing an upstream pathway enzyme involved in the conversion of naphthalene to gentisate. Several Gram-positive degrading bacteria were identified in our study, but the Gram-negative Pantoea isolate RR15 showed the greatest efficacy in the degradation of the target metabolite.

[0316] Root colonization is one of the most critical stages of the interaction between bacteria and their host. In this study, it was observed that bacterial cells frequently colonized the root hair surface in the elongation zone within 24 hours. The results showed that Pantoea RR15 was able to quickly and efficiently colonize the roots as early as 24 hours after inoculation and reached 4x10 4 The maximum CFU / g root was obtained. This result is comparable to that of Soluch R et al. (2021, Environ. Microbiol., 23(4): 2260-2273). Soluch R et al. found that Pantoea species rapidly colonized wheat roots in individual plants 5 hours after inoculation, and the population size increased significantly during the experiment, eventually reaching 5.1x10 7 According to Wheatley RM and Poole PS, 2018, FEMS Microbiol. Rev., 42: 448-461, the rapid, consistent and robust colonization of Pantoea populations is most likely mediated by pili and attachment proteins binding or responding to plant chemical signals.

[0317] In the 8th week of the greenhouse study, the chemical composition of root exudates released into the rhizosphere environment was altered after bacterial inoculation. This finding is consistent with previous studies that have also demonstrated changes in the metabolite composition of whole plants by specific soil microorganisms, indicating a two-way interaction between root and rhizosphere microbial populations (Curzi MJ et al., 2008, Journal of Plant Interactions, 3:163-173). In this study, out of the 39 compounds analyzed, seven metabolites were differentially expressed in treated plants compared to controls, while significant fold changes were observed for gallic acid, lactic acid, succinic acid, isoleucine, putrescine, choline, and valine. In addition to any direct effects of root colonization of Pantoea RR15 on these compounds, there may be indirect effects from close interactions of Pantoea RR15 with other competing microorganisms in the soil, which could affect the production of secondary metabolites, similar to the findings of Tyc O et al. (2017, Microb. Biotechnol., 10:910-925). Tyc O et al. found that biotic interactions (such as interspecies competition) especially in the rhizosphere can trigger changes in metabolite production (as can be observed in Streptomyces), where interspecies interactions with other soil bacteria affect the synthesis of antimicrobial compounds by stimulating and inhibiting the synthesis of antimicrobial compounds.

[0318] In conclusion, this study demonstrated the successful isolation and characterization of a rhizobacterial isolate (Pantoea isolate RR15) that exhibited a remarkable affinity for the potato rhizosphere and demonstrated a robust ability to degrade pathogen-stimulating compounds in potato root exudates. Targeted degradation of these key metabolites that stimulate pathogen germination and chemotaxis provides a novel approach for biocontrol of soil-borne diseases by manipulating soil chemical ecology.

[0319] Example 2

[0320] Metabolism and microbial regulation driven by bacteria that degrade phytochemicals:

[0321] Powdery scab control concept

[0322] The aim of this study was to test the hypothesis that disease management would be achieved by delivering bacterial degraders to the plant rhizosphere, triggering systemic changes in the plant secretion profile. In this regard, the efficacy of controlling potato powdery scab was investigated.

[0323] Materials and Methods

[0324] Inoculant preparation

[0325] In this study, bacterial isolates identified in Example 1 (Pantoea species strain RR15 and Rhodococcus species strain RR09) were studied. These specific isolates were chosen for their ability to degrade key chemicals involved in pathogen germination and their ability to colonize and persist in potato roots in artificial inoculation bioassays. The isolates were enriched at least 6-fold and a loopful of culture was streaked on LB agar plates. Individual colonies were picked for restreaking and cultured by growing on fresh LB medium (NaCl 10 g L -1 , yeast extract 5g L -1 and tryptone 5 g L -1 ) were subcultured to purify these single colonies repeatedly. The purified isolates were cultured on LB agar and the bacterial stock was frozen in 50% (v / v) glycerol at -80°C (Lami MJ et al., 2020, J.Appl.Microbiol., 129 (5): 1321-1336). Inoculants from each isolate were prepared from bacterial cultures grown in 50mL LB broth and incubated overnight on a rotary shaker (150rpm) at 23°C. The cells were harvested by centrifugation at 6000xg for 10 minutes at 4°C, and the pellets were resuspended in sterile PBS buffer (10mM NaH2PO4, 0.8% NaCl, pH6.5) (Liao CHand Shollenberger LM, 2003, Letters in Applied Microbiology, 37: 45-50). The final inoculant for improvement and potted experiments was determined, and the OD was measured using PBS buffer. 600 Adjust to 0.5.

[0326] Planting and microbial improvement

[0327] To determine the effects of the two bacterial isolates studied, greenhouse experiments were set up to identify and capture changes in metabolic profiles, shifts in bacterial community structure in the rhizosphere, and their effects on plant development. All plants were grown in tissue culture vessels (containing 20 mL of semi-solid 1Sterilized tissue culture cuttings of potato cv. Ranger Russet grown in 1 / 2 strength Murashige and Skoog (MS) minimal medium (Sigma-Aldrich, Darmstadt, Germany) (containing 0.8% agar; pH 5.8) (Murashige T and Skoog F, 1962, Physiologia Plantarum, 15:473). After 3 weeks, individual seedlings (n=64) approximately 3 cm tall with 3 or 4 fully expanded leaves were uprooted and rinsed three times with sterile distilled water to remove all attached semisolid medium. Prior to transplanting, the roots of the seedlings were immersed in an inoculant suspension of each isolate (containing approximately 10 8 CFU / mL -1 ) for 5 h to apply the bacteria, while control seedlings were root-dipped in sterile distilled water. After bacterial dipping, seedlings were transferred to pots (17 cm × 19 cm, with drainage holes in the bottom) containing 2.5 L of field (ferrosol) and potting mix (a 1:1:8 mixture of peat, coarse sand, and pine bark compost), and the seedlings were lightly watered to assist establishment. A total of 160 pots were used in this study and divided into two groups: (1) pots with plants (rhizosphere soil); and (2) pots without plants (non-rhizosphere soil). Each pot received the following treatments: 1) ddH20 as a negative control; 2) Pantoea species strain RR15; 3) Rhodococcus species strain RR09; and 4) dual bacterial inoculation of RR15 + RR09 (DBI). Each treatment had five replicates, which were evaluated sequentially over four different time periods (2, 4, 6, and 8 weeks). The experiment was carried out in a greenhouse where the temperature was maintained at 20 ± 3 ° C and additional lighting provided a photoperiod of 16 hours of light / 8 hours of darkness. The flower pots were watered 2-3 times a week to maintain moist soil suitable for plant growth. In each sampling period, 100 mL of leachate (containing root exudates) was carefully collected from each flower pot (flower pots with plants and flower pots without plants) that received bacterial treatment (RR15, RR09, co-inoculation and control). After the final collection of leachate, three soil core samples (15 cm deep) were collected and combined as non-rhizosphere soil samples taken from treated flower pots (flower pots without plants), while rhizosphere soil samples were taken from treated flower pots (flower pots with plants). Three copies of each soil sample were collected. Then, the relative growth of all plants was evaluated. Each plant was harvested, the roots were washed several times to remove organic matter, and the length of the roots and the aboveground parts and the fresh weight of the roots and the aboveground parts were measured, and then dried at 60 ° C for 48 hours and the dry matter content was re-weighed.

[0328] Analysis of flowerpot leachate

[0329] Root exudates were collected at specified times during the study. Exudates were collected by slowly pouring sterile water over the soil surface of the entire plant-soil system until 100 mL of leachate ( Fig.11 ). The leachate was divided into two parts (50 mL each), one part as the insurance stock solution and the other part for metabolomics analysis. The metabolomics samples were placed in 50 mL Falcon centrifuge tubes and centrifuged at 7000 x g for 5 minutes. Subsequently, the supernatant was collected, syringe filtered through a 0.22 μm filter (Merck Millipore, Darmstadt, Germany), and all samples were quickly frozen at -20 ° C (Williams A et al., 2021, Soil Biology and Biochemistry, 161). As described by Gika HG et al. (2012, J. Chromatogr., 1259: 121-127), in order to determine the composition of root exudates, the frozen root exudate samples were thawed and 1 mL of each root exudate sample was transferred to an HPLC glass vial, and the root exudate extracts were identified and quantified using high-precision ultra-high-efficiency LC-tandem MS technology and additional internal standards. A Waters Acquity H-Class UPLC was used to examine potato metabolites (Waters, Millford, MA). The solvents used in the mobile phase were solvent A (acetonitrile / water (95 / 5 (v / v)), 0.1% formic acid, and 0.075% NH4OH) and solvent B (acetonitrile / water (2 / 98 (v / v)), 0.2% formic acid, and 0.1% NH4OH). The gradient program started with a 4-minute isocratic step of 100% mobile phase A, then advanced to 28% mobile phase B, held for 21 minutes, and finally advanced to 60% mobile phase B in 5 minutes, followed by equilibration for another 12 minutes until the initial conditions. Between two injections, the injection system was subjected to two weak and strong solvent washing cycles. The column eluate was introduced into the mass spectrometer with an injection volume of 10 μL. Metabolite detection was accomplished by utilizing selective ion monitoring and an electrospray ionization source operating in positive and negative ion modes. Electrospray settings were as follows: capillary voltage was 2.5 or 3 kV; cone and desolvation temperatures were 150 °C and 400 °C, respectively; desolvation gas flow was 950 L / h; and cone flow was 100 L / h. For each analyte, the cone voltage was optimized by analyzing standard compounds as pure standards and injected into root exudate samples, and metabolite identification was verified by detecting predicted [M+H]+ or [MH] molecules at accepted retention indices. The MRM transition responses for each analyte were averaged and analyzed using MassLynx TMPeak identification and quantification were performed using software (Waters Corporation, Milford, MA). Standard laboratory procedures were used to evaluate basic test performance characteristics (sensitivity, precision, accuracy, and linearity). In order to analyze the differences and multiple changes between treatments, the raw metabolite data were log10 transformed to meet the requirements of the statistical model and to normalize the distribution between the putative metabolites. A cluster heat map of k-means clustering based on the average metabolite intensity of each species was generated to present the impact of treatment on the metabolite spectrum. In order to determine how large the metabolite differences between the control and treatment groups were, univariate analysis (t-test) was performed on the log10 transformed data of each metabolite, and the control plants were compared with T1 (inoculated with isolate RR15), T2 (inoculated with isolate RR09) and T3 (inoculated with isolate RR15, RR09) plants (co-inoculated). The Benjamini-Hochberg false discovery rate (FDR) adjustment method was used to adjust the p-values ​​for multiple comparisons. In order to compare the metabolite features that continuously changed (i.e., up-regulated or down-regulated) between the groups, the fold change (FC) analysis was performed by selecting the significant metabolites (-log10 p value>5) that also had a log2 fold change greater than 2.0 or less than 2.0 to obtain the putative identity from all three binary comparisons (control vs. T1_+RR15, control vs. T2_+RR09, and control vs. T3_total inoculation). These analyses were performed using the R package MetaboAnalystR version 5.0 (https: / / github.com / xia-lab / MetaboAnalystR) (Bijlsma S et al., 2006, Anal. Chern., 78(2): 567-574).

[0330] Bacterial Monitoring and Recovery

[0331] DNA extraction

[0332] Extract rhizosphere soil sample from the soil part that about 1mm soil is attached to root.Rinse root gently, transfer it in the 50mL Falcon centrifuge tube that sterile distilled water is housed, and vortex in Falcon centrifuge tube for 20 minutes.Sieve non-rhizosphere soil sample (5g merged sample) with 2mm screen, and use ultrasonic cleaner to stir 20 minutes as rhizosphere soil.Collect soil slurry with 13000xg centrifugal 15 minutes.Discard supernatant, and isolate DNA from remaining centrifugal soil part.Before DNA extraction, use Fast Prep-24 Classic bead beating grinder and lysis system (FastPrep-24 Classic bead beating grinder and lysis system) (MP Biomedicals, OH, USA) to carry out pre-homogenization to the soil part collected by 1 minute bead beating with the speed of 5.5m / s. Genomic DNA was extracted from 250 mg of each rhizosphere and non-rhizosphere soil sample using the dNeasy Power Soil Pro Kit (Qiagen, USA) according to the manufacturer's instructions. DNA quality and concentration were measured using a 2.0 fluorometer (Life technologies, Darmstadt, Germany) and diluted to a stock concentration of 5 ng total gDNA / μL using sterile water for subsequent analysis. In each sample, gBlock fragments at a concentration of 10 ng / μL were used as DNA standards in the quantitative PCR assay (see below).

[0333] Quantitative PCR (qPCR) analysis

[0334] The bacterial inoculants recovered from rhizosphere and non-rhizosphere environments were examined in eight weeks of potato growth using the Rotor Gene-Q real-time PCR system (Qiagen, Hilden, Germany), and three biological replicates and three technical replicates of the qPCR study were used to quantify the individual genes of each isolated DNA. Two pairs of specific primers for the two modified bacterial inoculants were selected to detect the copy number of the 16S rRNA gene in the V3-V4 variable region. These primers were RR15-2F (5'-ACGGCCGCAAGGTTAAA-3') (SEQ ID NO:3), RR15-2F (5'-GCTGGATGTCAAGAGTAGGTAAG-3') (SEQ ID NO:4), RR09-1F (5'-CGGAATCACTGGGCGTAAA-3') (SEQ ID NO:6), RR09-1R (5'-GTTCCACCAACCTCTACCATAC-3') (SEQ ID NO:7).

[0335] qPCR amplification was performed in a 20 μL final volume containing 2 μL of each 5 ng / μL total gDNA, 0.5 μL of each 10 μM forward and reverse specific bacterial primers, specific probes (RR15-2 prb 5'-ACAAGCGGTGGAGCATGTGTTTTA-3'—SEQ ID NO:5; RR09-1 prb 5'-CGGAATCACTGGGCGTAAA-3'-SEQ ID NO:8), 10 μL of 1X SensiFAST TM Probe No-ROX Kit (Bioline Meridian BioScience, USA) and 5 μL of sterile DNA-free water. The reaction was carried out under the following thermal cycling conditions: one cycle of initial denaturation at 95°C for 30 seconds, followed by 40 amplifications (10 seconds at 95°C, 20 seconds at 59°C, and 20 seconds at 72°C). Three technical replicates were performed for each rhizosphere or non-rhizosphere DNA sample, and the marine bacterium Pseudoaltemoranas prydzensis was used as an internal control for normalization of qPCR analysis (Bowman JP, 1998, supra; Kamilova F et aL, 2006, Mol. Plant-Microbe Interact., 19: 250-256). A 10-fold serial dilution (range of 10 per reaction) of a gBlock fragment of a target DNA PCR fragment containing the 16S rRNA gene of the bacteria was used. 8 -10 2The efficiency for all target genes and runs was reported to be 99%, with R 2 The value was higher than 0.99%. The calibration curve of gBlock fragments was used to determine the copy number of the target gene. All data analyses were performed using the Rotor-Gene Q software package (Qiagen, Hilden, Germany).

[0336] Profiling of soil bacterial communities

[0337] The bacterial microbiome in the rhizosphere and non-rhizosphere soil of inoculated potatoes grown in a greenhouse was examined. Total genomic DNA was extracted from 0.25 g of rhizosphere or non-rhizosphere soil samples using the dNeasy Power Soil Pro Kit (Qiagen, USA) according to the manufacturer's instructions. The amount of DNA extracted was measured by 2.0 fluorometer (Life technologies, Darmstadt, Germany) to obtain the standard DNA concentration (about 20ng) required for sequencing service. Then, the primers 341F (5'-CCTAYGGGRBGCASCAG-3'-SEQ ID NO:9) and 806R2 (5'-GGACTACNNGGGTATCTAAT-3'-SEQ ID NO:10) targeting the V3-V4 region of bacteria were used to amplify the fragment of 16S rRNA gene. The Illumina bclfastq2.20.0.422 pipeline of the Australian Genome Research Institute (AGRF, Melbourne) was used according to quality standards (Caporaso JG et al., 2010, Nat.Methods, 7(5):335-336; Caporaso JG et al., 2011, PNAS USA, 8:7) to carry out amplicon sequencing program. Using the internal Illumina MiSeq sequencing workflow, 300bp double-end sequences were merged and the noise of sequences containing sequencing errors was initially removed. The bioinformatics tool QIIME2 2019.7 (Bolyen E et al., 2019, Nat. Biotechnol., 37 (8): 852-857) was used for diversity analysis. The cutadapt plug-in was used to perform primer trimming and quality filtering on the demultiplexed raw reads, and then denoised using q2-DADA2 (Callahan BJ eta / ., 2016, Nat. Methods, 13 (7): 581-583). The classification was assigned to ASV using q2-feature-classifier (Bokulich N et aL, 2018, mSystems, 20 (3): 6).

[0338] Evaluation of plant growth parameters

[0339] After bacterial amendment in a controlled environment, treatments were assigned using a completely randomized design with five replications. To evaluate growth parameters, five plants were carefully uprooted, washed by running tap water to remove attached soil debris, and the aerial parts and roots were separated to analyze plant development indicators. Six quantitative plant growth characteristics were measured: plant height (cm), root length (cm), aerial part length (cm), fresh mass of roots and aerial parts (g), root-to-shoot ratio, and percentage dry matter content. For dry weight measurements, the biomass was dried in an oven at 60°C for 48 h to constant weight. Plant growth parameter data are expressed as mean ± standard deviation (SD). Quantitative differences were evaluated by one-way analysis of variance. Duncan's multiple-range test was performed to separate the means. A significance threshold of p < 0.05 was applied. The data were analyzed using Statistical analyses were performed using SPSS Statistics 28.0.0.0 (SPSS Inc., USA).

[0340] result

[0341] Effects of bacterial inoculants on root exudation characteristics

[0342] To better understand the specific changes in plant root exudates of potato plants treated with the investigated bacterial inoculants, high-resolution mass spectrometry analysis was performed. UPLC MS / MS analysis of the main root exudate fractions showed that bacterial treatment significantly altered the amount of amino acids and organic compounds released from the rhizosphere. A total of 14 amino acids and 21 organic compounds were significantly altered in the rhizosphere after the additional bacterial treatment (two-fold change cutoff P < 0.05 between bacterial treatment and untreated control, multiple comparisons based on FDR correction after one-way ANOVA).

[0343] Log2 fold change analysis showed that the metabolite profiles of plants treated with single bacterial inoculants (Pantoea sp. strain RR15 or Rhodococcus sp. strain RR09) or co-inoculated with these strains were significantly altered (p ≤ 0.05) compared with the untreated control ( Fig.12). The differences in fold changes of amino acids and organic compounds between the treated and control groups revealed a wide range of up- and down-regulation of these components. According to the findings, the metabolites of the bacterial treatment groups had similar metabolic characteristics in terms of their regulation. For example, the amino acids glycine, phenylalanine, lysine, proline, valine, and threonine were shown to be significantly increased in plants after all bacterial treatments; however, tyrosine was increased only in plants treated with RR09. Meanwhile, histidine, methionine, arginine, alanine, and serine were decreased by all treatments, with the exception of leucine. Leucine was up-regulated in plants treated with a single bacterial inoculant and down-regulated in plants treated with co-inoculation of the strains ( Fig.12 A).

[0344] Fold changes in organic compounds revealed a wide range of up- and downregulation of metabolite components. Nine organic compounds (including lactic acid, spermine, tartaric acid, putrescine, choline, piperidine, 3,4DHBA, succinic acid, and syringic acid) showed significant increases in plants after all bacterial treatments, while pyridoxal, malic acid, gallic acid, and thiamine were all downregulated. Other chemicals such as nicotinamide and sucrose disaccharide decreased only in RR15-treated and co-inoculated plants, while ribose C5, gluconic acid, guanidine, and citric acid were all significantly decreased only in RR09-treated and co-inoculated plants ( Fig.12 B).

[0345] Based on these results, bacterial treatments affected both up- and down-regulation of amino acids and organic compounds, resulting in differences in the absolute fold-change values ​​of metabolites relative to the control. The extent of changes in amino acids and organic compounds depended on whether single bacterial treatments or co-inoculated bacterial treatments were used. Bacterial application resulted in an increase or decrease in the levels of some metabolites. For example, application of Pantoea sp. RR15 and / or Rhodococcus sp. RR09 increased the levels of some amino acids by 1.7 to 10.8 log2 FC, while increasing the levels of some organic compounds by 1.4 to 9.1 log2 FC. On the other hand, co-inoculation only increased some amino acids by 1.9 to 10.82 log2 FC, while increasing the levels of organic compounds by 1.2 to 5.7 log2 FC ( Fig.12 ).

[0346] Alternatively, using heat map analysis to show that metabolites clustered over time based on the amount of compounds found in the rhizosphere, the overall secretion pattern of control plants was found to be significantly different from that of treated plants ( Fig.13 ). Among the treatments, the release of organic compounds was very similar between the RR09 and co-inoculated groups, but the plants treated with RR15 had greater variations than the other two groups. In contrast to the organic compounds, the composition of metabolites present in the rhizosphere was similar in the two single treatments (compared to the co-inoculated treatments) ( Fig.13 B). It should be noted that bacterial treatment of the plants reduced the levels of irritant phytochemicals such as glutamine, tyramine, serine, and nicotinamide. In addition, it was found that the application of the combined treatment had a stimulatory effect on compounds that inhibit zoospore tropism (spermine and choline), thereby achieving higher yields of non-irritant compounds compared to individual applications. It is noteworthy that both important compounds previously found to mediate the germination of dormant spores of powdery scab (i.e., glutamine and tyramine) were inhibited by inoculation with a single bacterium or bacterial combination, but the RR15 treatment alone minimized these irritants ( Fig.13 C).

[0347] Bacterial recovery and effects on community composition

[0348] To evaluate the recovery of the introduced bacteria, potato rhizosphere and non-rhizosphere soil samples were obtained from the bacterially treated plants. Among the bacterial isolates tested, Pantoea species strain RR15 showed a higher success rate of recolonization compared to Rhodococcus species strain RR09. qPCR results showed that Pantoea strain RR15 could effectively recolonize both rhizosphere and non-rhizosphere soils; when roots (5.5x10 5 log 10 DNA copies / 5ng total DNA), the viability and cell number of this isolate increased over time and remained stable even in the absence of roots (7.11x10 3 log 10 DNA copies / 5ng total DNA), the isolate could also maintain its colonization and activity. On the other hand, Rhodococcus strain RR09 colonized the rhizosphere as early as 2 weeks, but its population subsequently declined, with only 1.34×10 -2 log 10 DNA copies / 5ng total DNA, while in non-rhizosphere soil there are approximately 2.40×10 -1 log 10 DNA copies / 5ng total DNA. In addition, when the bacterial isolates were combined, the recolonization was not as successful as when they were introduced individually, but it was still possible to observe that the two bacteria colonized in the rhizosphere environment presented sufficient cell density at week 2. It seems that the colonization of Pantoea strain RR15 in the rhizosphere environment may last longer than RR09. In contrast to their activity in the rhizosphere environment, the two bacterial isolates showed a decrease in population in the non-rhizosphere soil, but Pantoea strain RR15 was able to maintain up to 6.7x10 even after week 8. 3 log 10 DNA copies / 5ng total DNA, while Rhodococcus strain RR09 was almost undetectable as early as 2 weeks ( Fig.14 ).

[0349] The effects of bacterial amendment of the rhizosphere environment on the composition of soil bacterial communities in potato cultivation soils were investigated using Illumina MiSeq technology and 16S rRNA gene amplicon sequences. In this study, a total of 5735 OTUs (28 phyla and 817 genera) detected in the samples were identified. The relative abundance of soil bacterial communities in untreated and treated soils showed that two bacterial phyla dominated the rhizosphere environment, with Proteobacteria accounting for 92-95% and Actinobacteria accounting for 27-42%. In addition, it was found that other phyla such as Acidobacteria (4-9%), Firmicutes (3-7%), Chloroflexi (1-3%), Bacteroidetes (1-5%), Verrumicrobia (1-2%) and Gemmatimonadetes (2-4%) were also included in the rhizosphere community. Fig.15 A). Notably, bacterial application promoted the presence of other bacterial communities such as Patescibacteries (0.09%) and Defferibacteries (0.06%). Among these bacterial treatments, RR15-treated and co-inoculated soils showed significant changes in bacterial composition, but RR09-treated and untreated soils did not show significant changes in phylum composition ( Fig.15 A). In particular, soil treated with RR15 promoted the populations of Proteobacteria (9.53%), Actinobacteria (4.22%), Acidobacteria (0.92%), Bacteroidetes (0.52%), Chloroflexi (0.37%), Gemmatimonadetes (0.37%), and Thermomicrobacteria (0.23%), while the combined bacterial inoculation promoted an increase of Firmicutes by approximately 0.73%. In addition, when the effects of bacterial changes between non-rhizosphere and rhizosphere samples and untreated samples were compared at the genus level ( Fig.15 B), 162 genera were found in common among all samples, of which 16 genera were shared between the control and non-rhizosphere samples, and 38 genera were shared between the control and rhizosphere samples.

[0350] Notably, only five bacterial genera were found in the non-rhizosphere soil, whereas 22 bacterial genera were found only in the rhizosphere environment, suggesting that the rhizosphere environment has a greater impact on bacterial application. On the other hand, when the different compositions of the non-rhizosphere soil communities were examined compared to the rhizosphere soil communities, it was apparent that they were significantly different, with the non-rhizosphere communities being dominated by the bacterial species Nocardia (11%), followed by 5% of Streptomyces and Sphingomonas communities, 4% of Mycobacterium, Nocardioides, Bacillus, and Gemmatomonas communities, 3% of Kribella, Thermobispora, Conexibacter, and Ramilibacter communities, and 2% of Rhodanobacter, Acidothermus, Pseudarthrobacter, and Streptomyces species. ter), Micromonospora, Pseudonocardia, Microbispora, Actinomadura, Devosia, Pseudolabrys, and Massilia communities, while the rhizosphere population contained 6% of Gemmatimonas, Bacillus, and Streptomyces, 4% of Thermobispora, and 1% of Bacillus. , Sphingomonas and Pseudo-bicapsid Axonema communities, 3% of Pantoea, Mycobacterium, Pseudo-Arthrobacter, Kribisola, Connexatus and Rhodococcus communities, and 2% of Soilobacter, Bryobacter, Nocardia, Thermus acidophilus, Micromonospora, Nocardia, Pseudonocardia, Madura Actinomyces, Solirubrobacter, Devossa and Haliangium communities. However, although the changes in the communities in the non-rhizosphere and rhizosphere environments were accompanied by the proliferation of various soil bacteria, it is noteworthy that the relative abundance of the introduced Pantoea strain RR15 inoculant was able to account for approximately 3% of the rhizosphere bacterial community and 0.14% of the non-rhizosphere bacterial community, while the Rhodococcus strain RR09 accounted for 0.02% of the rhizosphere community and 0.0003% of the non-rhizosphere community ( Fig.16 ).

[0351] Effects of bacterial inoculation on plant growth traits

[0352] The effect of single or inoculum application significantly improved the plant growth index relative to the control (P≤0.05) ( Fig.17 ). In the presence of bacteria, root development showed a significant effect, with roots treated with Pantoea strain RR15 showing a significant increase in root growth (average 35 ± 2.8 cm), followed by the co-inoculated group (average 32 ± 1.3) and the Rhodococcus strain RR09 treatment group (average 30 ± 2.1). This was in contrast to the control (untreated) group, which had an average root growth of 23 ± 0.9 cm.

[0353] In contrast to root growth, bacterial application had no significant effect on aerial length, with only slightly significant increases noted in the case of bacterial co-inoculation at 2 weeks of growth and inoculation with Pantoea strain RR15 at 2 and 8 weeks of growth. Other growth parameters such as fresh and dry weight of roots and root-to-shoot ratio were greatly affected by bacterial treatment. In the presence of bacteria, root weight of treated plants was approximately 1-2 times that of controls, with RR15 treatment performing at least 1-fold higher than the other bacterial applications. Nevertheless, all plants treated with isolates RR15 or RR09 and all plants co-inoculated with both bacteria showed a favorable response compared to the control ( Fig.17 ).

[0354] Discussion

[0355] A large number of studies have found that bacteria that settle in the rhizosphere can affect plant root secretions (Matilla MA et al., 2010, Environ. Microbiol. Rep., 2 (3): 381-388). Early studies have shown that various bacterial species have unique effects on the amount and composition of plant root secretions, and rhizosphere bacterial inoculation can quantitatively change root secretions (Fransson PMA and Johansson EM, 2010, FEMS Microbiol. Ecol., 71 (2): 186-189). In addition, rhizosphere bacterial inoculation can affect a large number of other soil bacteria in the rhizosphere, thereby making plants more adaptable to a series of abiotic and biotic stresses and promoting plant growth.

[0356] This work in the present study demonstrated that the application of specific bacterial isolates can alter the secretion profile of amino acids and low molecular weight secondary metabolites from potato roots and promote a shift in the microbial community while stimulating enhanced plant development. According to the findings of this study, the root exudates of the bacterial-treated plants were always higher than those of the untreated control plants. The quantitative changes in the exudate profiles produced by single and mixed bacterial inoculations showed a specific pattern of concentration gradient changes that could significantly increase or decrease. Moreover, when the ability of the bacterial inoculants was observed in degrading key compounds involved in the germination of dormant spores of the pathogen (glutamine and tyramine), it was found that the application of bacteria alone or in combination caused a significant decrease, with Pantoea strain RR15 showing the highest inhibitory effect on stimulant compounds. Other stimulants such as serine, nicotinamide, and aspartic acid decreased, while chemicals such as spermine and choline, which were identified as non-stimulatory for pathogen germination, increased significantly. The results of this study indicate that Pantoea strain RR15 is comparable to other Pantoea soil isolates reported to have higher degradation capabilities, such as the ability to decompose herbicides from agricultural runoff (Pileggi M et al., 2012, Chemosphere, 86(11): 1127-1132) and remove heavy metals from wastewater (Ozdemir G, 2004, Chemical Engineering Journal, 102(3): 249-253). On the other hand, other Pantoea isolates have been shown to produce compounds (such as glycolipid biosurfactants) that enable emulsification and subsequent biodegradation of harmful hydrocarbons (Vasileva-Tonkova E and Gesheva V, 2007, Curr. Microbiol., 54: 136-141). In order to understand the extent of bacterial survival over time in the rhizosphere environment, the data indicate that Pantoea strain RR15 survives longer in the soil. The results showed that the bacterial density of Pantoea strain RR15 was within the typical bacterial density range commonly found in the rhizosphere environment, which means that RR15 is able to effectively colonize the potato rhizosphere environment.

[0357] High-throughput sequencing results revealed the true extent of the impact of bacterial introduction on the reconstruction of the potato rhizosphere microbiome. The results of this study showed that the application of Pantoea strain RR15 and Rhodococcus strain RR09 affected the structure and composition of bacterial communities in both the rhizosphere and non-rhizosphere environments. Rhizosphere and non-rhizosphere samples presented relatively consistent microbial compositions, with the exception of Nocardia. Nocardia showed large population fluctuations between rhizosphere and non-rhizosphere communities, but other genera accounted for 5-6% of the entire community (such as Bacillus, Gemmatimonas, Streptomyces, Sphingomonas, and Mycobacterium), which represented an important part of the stable community. In particular, approximately 0.1-0.5% of other bacterial taxa were observed, indicating that live microorganisms were only present in the rhizosphere environment compared with non-rhizosphere and untreated samples.

[0358] The increase in amino acids and other organic compounds in the plants treated with Panfoea-RR15 may have attracted more specific microorganisms that stimulated the general microbial population and drove the increase observed in the rhizosphere substrate. The higher abundance of beneficial genera (e.g., Bacillus and Streptomyces, which are widely used as plant growth promoters and disease inhibitors in agriculture) in the soil treated with Pantoea strain RR15 strongly suggests that the Pantoea RR15 isolate plays an important role in genetically contributing to the beneficial assemblage of bacteria in the plant microbiome, thus favoring plant stress regulation and even growth. At the same time, all samples treated with the bacteria showed considerable increases in biometric parameters of potato development (length of roots and aerial parts, fresh mass, dry weight, and root-to-shoot ratio), indicating that the treated plants had better vigor and growth activity than the control. The application of Pantoea RR15 improved growth characteristics, especially those of the roots, compared to the other bacterial treatments.

[0359] in conclusion

[0360] This is the first study to investigate the secretion profile of potato roots in response to bacterial application. Overall, the chemical changes observed in the rhizosphere environment, especially the degradation of compounds associated with germination of P. solani dormant spores and zoospore chemotaxis, may reduce the number of zoospores released and their successful attraction to potato roots, thereby reducing disease. In addition, Pantoea strain RR15 is able to act as a bioinoculant and therefore may provide benefits in terms of increased bioactivity, resulting in a set of potentially inhibitory chemicals and other microbial communities that may help control P. solani infections.

[0361] Example 3

[0362] A metabolomics approach to elucidate the role of Pantoea strain RR15 in disease and metabolic shift following infection with Powdery Scab

[0363] In this study, a targeted metabolomics approach based on ultra-performance liquid chromatography and tandem mass spectrometry (UPLC-MS / MS) was used to investigate the metabolic changes associated with the colonization of the potato rhizosphere by Pantoea species RR15 following disease infection and to infer their roles in promoting plant growth.

[0364] Materials and Methods

[0365] Bacterial culture

[0366] As shown in Examples 1 and 2, Pantoea strain RR15 can successfully colonize potato roots and promote plant development. This strain was used in this study. 1 mL of bacterial suspension from a 50% glycerol inoculant stock was added to 100 mL of sterilized fresh Luria Bertani broth (NaCl 10 g L -1 , yeast extract 5g L -1 and tryptone 10 g L -1 ) in a 250 mL flask. The culture was incubated at 23°C and stirred at 150 rpm for approximately 24 hours until it reached an optical density (λ=600 nm) of 1.0. To prepare the cell suspension for inoculation, the culture medium was centrifuged at 3000 rpm for 10 minutes at room temperature to obtain a bacterial pellet, which was resuspended in 0.85% saline (adjusted to OD 600 =1.0). Lesions were excised from infected potato tubers, the excised material was air-dried at 25°C, then ground and sieved through a 35 μm mesh to prepare an inoculant powder (i.e., Pseudomonas aeruginosa inoculant), which was stored at 4°C for later use.

[0367] Plant material and inoculation

[0368] Tissue culture cuttings of susceptible potato cultivars (Solanum tuberosum cv. Iwa) and resistant potato cultivars (Solanum tuberosum cv. Gladiator) (Wilson CR et al., 2010, Phytopathology, 100(5):460-467) were micropropagated on potato proliferation (PM) medium (MS salts and vitamins, 30 g / L sucrose, 40 mg / L ascorbic acid, 500 mg / L casein hydrolysate and 0.8% agar (Sigma-Aldrich, St Louis, USA), pH adjusted to 5.8) under a 16-hour photoperiod using white fluorescent light (65 μmol / m2 / s) at 22°C. After 3 weeks, individual seedlings approximately 3 cm in height with 3 or 4 fully expanded leaves were uprooted and rinsed three times (10 minutes each) in sterile distilled water to remove any adhering medium. The roots of the seedlings were immersed in a broth culture of RR15 (roots treated with Pantoea species RR15) or sterile distilled water (untreated roots) and soaked for 5 hours at room temperature. The seedlings were transplanted into pots (17 cm×19 cm, with drainage holes at the bottom) filled with 2.5 L of field (ferrosol) and potting mix soil (a 1:1:8 mixture of peat, coarse sand and pine bark compost), half of which had 500 mg of powdered potato powdery scab (Sss) inoculant (+Sss) evenly distributed throughout the soil, and the other half was not inoculated (no Sss); and then placed in a greenhouse environment maintained at a temperature of 16 to 22±2°C and a 16-hour light / 8-hour dark photoperiod. The seedlings were irrigated every other day to maintain moist soil conditions. The experiment was divided into two groups, each for a variety treated or untreated with Pantoea species strain RR15. Each group included four treatments: (1) control (no RR15 or Sss); (2) RR15 treatment in the absence of Sss; (3) RR15 treatment in the presence of Sss; (4) no RR15 treatment in the presence of Sss; each sample contained four biological replicates, each with a pot containing a single plant; samples were destructively harvested at three time periods after bacterial treatment: 4, 12, and 21 weeks for exudate analysis, bacterial recovery, disease assessment, and plant growth parameters.

[0369] Recovery of Pantoea strain RR15

[0370] At each sampling cycle, the roots and soil were separated before further processing. Soil debris was removed from the roots by vigorous shaking. Rhizosphere soil was then obtained from the roots by placing the entire root in a 50 mL plastic conical tube containing 25 mL 0.1 M sterile phosphate buffer (7.1 g Na2HPO4 and 4.4 g NaH2PO4H2O added to 25 ml deionized water, pH 7.0), and then the plastic conical tube was centrifuged at 13000 g for 5 minutes, the roots were removed, and the resulting soil suspension was centrifuged again at 4000 x g for 15 minutes. The resulting soil sediment was used as rhizosphere soil and stored at -20 ° C until genomic DNA was extracted (Liu H et al., 2021, New Phytol., 229 (5): 2873-2885). Genomic DNA (gDNA) was extracted from 250 mg of rhizosphere soil fraction using dNeasyPower Soil Pro Kit (Qiagen, USA) as recommended by the manufacturer. Use Soil DNA concentration was determined using a 2.0 fluorometer (Life technologies, Darmstadt, Germany). DNA samples were stored at −20°C until further evaluation. The samples were lysed in a 1% PBS solution containing 2 μL template DNA, 0.5 μL each of 10 mM primers and probes, 10 μL 1X SensiFAST TMThe bacterial inoculant in the rhizosphere was quantified by qPCR amplification using the designed P1 / P2 specific primers RR15-2f (5'-ACGGCCGCAAGGTTAAA-3') (SEQ ID NO: 3) and RR15-2r (5'-GCTGGATGTCAAGAGTAGGTAAG-3') (SEQ ID NO: 4) and probe RR15-2 prb (5'-ACAAGCGGTGGAGCATGTGGTTTA-3') (SEQ ID NO: 5) in a total reaction volume of 20 μL using the Probe No-ROX Kit (Bioline Meridian BioScience, USA) and 5 μL sterile DNA-free water. Amplification was performed with the Rotor-Gene Q system (Qiagen, Hilden, Germany) under the following thermal cycling conditions: one cycle of initial denaturation at 95°C for 30 seconds, followed by 40 amplifications (10 seconds at 95°C, 20 seconds at 59°C, and 20 seconds at 72°C). Each sample received three biological and technical replicates, and the marine bacterium Pseudoaltemoranas prydzensis was used as an internal reference to normalize qPCR data for accurate quantification (Bowman JP, 1998, supra). A 10-fold serial dilution of the gBIock fragment containing the target DNA PCR fragment of the bacterial 16S rRNA gene (range 10 per reaction) was used. 8 -10 2 The standard curve was established using PCR amplification (1000 copies). The qPCR run efficiency was calculated to be 99%, with an R2 value higher than 0.99%. The calibration curve was used to calculate the copy number of the target gene, and all data were processed using the Rotor-Gene Q software program (Qiagen, Hilden, Germany).

[0371] Secretion sampling and UPLC-MS / MS

[0372] Root exudate samples were obtained from each of the 72 potato plants in the pot study. Exudates were collected simply by pouring sterile water slowly over the entire soil surface of the plant-soil system until 100 mL of exudate was collected from underneath the pot ( Fig.18). The collected exudates were centrifuged at 7000xg for 5 minutes in a 50mL Falcon centrifuge tube. The supernatant was collected and syringe filtered using a 0.22μm filter (Merck Millipore), and all samples were immediately frozen and stored at -20°C (Williams A et al., 2021, supra). Exudate analysis was performed on frozen root exudates after thawing, and 1mL of each exudate was placed in an HPLC glass vial. Root exudate extracts were quantified using ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS).

[0373] Potato metabolites were examined over a concentration range of 20 to 500 ug / mL using a Waters Acquity H-Class UPLC system (Waters, Millford, MA). Chromatographic analysis was performed using two tandem UPLC columns: an Acquity BEH C18 column (2.1×100 mm×1.7 mm) and an Acquity HSS PFP column (2.1×100 mm×1.7 mm). Solvent A (1.0% v / v acetic acid) and solvent B (acetonitrile) were used in the mobile phase. The gradient program started with a 2-minute isocratic step of 100% mobile phase A, followed by 70% mobile phase B in 4 minutes. 70% mobile phase B was maintained for 4 minutes, followed by 90% mobile phase B in 1 minute and maintained for 2 minutes. Afterwards, the conditions were reset to the original ratio and re-equilibrated for 3 minutes. Between injections, the injection device was subjected to two weak and strong solvent wash cycles. The injection volume was 10 μL.

[0374] Metabolites were identified using multiple reaction monitoring (MRM) and an electrospray ionization source in both positive and negative ion modes. The electrospray parameters were as follows: capillary voltage, 2.5 kV; cone temperature and desolvation temperature, 150 °C and 400 °C, respectively; desolvation gas flow, 950 L / h; and cone flow, 100 L / h. Standard compounds were used to optimize the cone voltage and collision energy for each analyte. The expected [M+H]+ or [MH] molecules and product ions were detected at recognized retention indices, confirming the identification of the metabolites. For each analyte, the MRM transition responses were averaged and analyzed using MassLynx TM Peaks were identified and quantified using ANALYZER(R) software (Waters Corporation, Milford, MA,).

[0375] Quantification was performed using analysis of matrix-matched external calibration standards ranging from 20 to 5000 ug / mL (organic compounds) and 20 to 400 ug / L (amino acids). The external calibration standards were adjusted to account for native analyte concentrations in the matrix. Separate analysis and quantitative measurements of glutamine and tyramine were performed using the same UPLC-MS / MS configuration and different UPLC gradient algorithms. The gradient program started with a 1-minute isocratic step at 100% A, followed by a step to 70% mobile phase B over 4 minutes and then held for 2 minutes. Afterwards, conditions were reset to their original ratios and re-equilibrated for 3 minutes. Similarly, the MRM transition responses were averaged and analyzed using MassLynx TM The software locates and measures peaks to quantify glutamine and tyramine.

[0376] Determination of biomass parameters and root diseases

[0377] In order to measure yield-related characteristics, 12 sample plants fully matured were randomly harvested from RR15 treated and untreated pots. Harvested at 4, 12 and 21 weeks after inoculation. The length (cm) and fresh weight (g) of the root and the aboveground part were measured, and the tuber yield (g) was determined. The root gall formation of each plant was graded, wherein the root was cleaned and the visual scoring standard from low to high (corresponding to a score of 0 to 4, wherein 0=no gall, 1=1-2 galls; 2=3-10 galls (diameter <2mm); 3=≥10 galls (diameter>2mm); 4=taproot with galls (diameter>4mm)) was evaluated (van deGraaf P et aL, 2007, Plant Pathology, 56 (6): 1005-1013). The chlorophyll content was estimated using a SPAD-502 (Konica Minolta Sensing) portable chlorophyll meter. SPAD measurements were taken at the center of the second apical fully developed leaf. For each replicate, five readings per leaf were averaged to produce a single observation (Kiana-Pouya A and Rasouli F, 2014, Photosynthetica, 52(2):288-300).

[0378] Statistical analysis

[0379] Morphological traits and bacterial recovery were statistically analyzed by using univariate analysis of variance (ANOVA) as two-tailed completely randomized blocks to compare uninoculated control plants with plants treated with RR15 at different sampling periods. ANOVA was performed with Tukey post hoc test, where differences between means were considered significant at p<0.05. Metabolite abundance was compared using R package MetaboAnalystR version 3.0 (Xia J et al., 2009, Nucleic Acids Res., 37: webserver issue W652-660), and data were normalized using logarithmic transformation and then mean-centered. Fold change (FC) analysis supervised by t-test (p<0.05) (plotted on a log2 scale) was used to compare the absolute value changes of up-regulated / down-regulated metabolites between groups, and heat maps were used to display the differences in metabolite abundance between treatments and their biological replicates.

[0380] result

[0381] Enrichment of Pantoea RR15 in the root environment in the presence or absence of pathogens

[0382] Quantitative polymerase chain reaction (qPCR) was used to detect and assess the abundance of Pantoea RR15 in soil ( Fig.19 The results showed that RR15 was abundant around potato roots (up to 3.99x10 6 log 10 DNA copies / 5ng total DNA) and was also detectable in the roots of Sss-infected plants (up to 2.9x10 6 log 10 DNA copies / 5ng total DNA). When the bacteria were present alone or in combination with Sss, the accumulation of Pantoea RR15 in the rhizosphere was significantly different (p<0.05) between susceptible potato cultivars (Iwa) and resistant potato cultivars (Gladiator) as observed in the later stages of crop growth (12-21 weeks). Notably, in the resistant cultivar, the density of Pantoea RR15 was observed to increase steadily starting at 4 weeks (2.65x10 6 log 10 DNA copies / 5ng total DNA) and continued up to 12 weeks (4x10 6 log 10 DNA copies / 5ng total DNA), and then gradually decreased to 3.15x10 6 log 10DNA copies / 5ng total DNA. Meanwhile, in the presence of Sss, the RR15 population decreased moderately, with DNA levels decreasing from 2.32x10 6 log 10 DNA copies / 5ng total DNA began to decrease continuously to 1.65x10 after 12 and 21 weeks, respectively. 6 log 10 DNA copies / 5ng total DNA and 1.09x10 6 log 10 DNA copies / 5ng total DNA.

[0383] On the other hand, when Pantoea RR15 was delivered alone to susceptible cultivars in the rhizosphere, the abundance of Pantoea RR15 was relatively high at the beginning of week 4 (up to 2.56 x 10 6 log 10 DNA copies / 5ng total DNA) and continued to increase until 12 weeks, when the DNA level was 3.07x10 6 log 10 DNA copies / 5ng total DNA, but then dropped sharply to 1.17x10 6 log 10 DNA copies / 5ng total DNA. A similar downward trend was observed in the presence of Sss, where the number of copies of DNA at the beginning of the 4th week was 2.39x10 6 log 10 DNA copies / 5ng total DNA, and then continued to decline until it was detected at about 1.09x10 6 log 10 DNA copies / 5 ng total DNA. Overall, it can be assumed that Pantoea RR15 reaches a maximum capacity for rhizosphere colonization at approximately 12 weeks and then gradually declines. In addition, substantial differences in bacterial recruitment were identified between cultivars, with Pantoea RR15 colonizing more efficiently in resistant cultivars than in susceptible cultivars.

[0384] Degradation of Sss-stimulating compounds by Pantoea RR15 in the rhizosphere

[0385] To evaluate the degradation of Sss stimulants (glutamine and tyramine) by microbe-plant interactions, Pantoea RR15 was introduced into the roots of potato plants to which the bacteria were applied alone or together with the pathogen (Sss) ( Fig. 20). Notably, the levels of glutamine and tyramine in potato exudates were consistently different. A greater amount of glutamine was released compared to tyramine. More glutamine and tyramine were generally present in susceptible cultivars, where the average estimated concentrations were 2.9±0.8mg / mL and 1.5±2.6mg / mL, respectively; whereas resistant cultivars presented negligible levels, where glutamine averaged only about 0.9±2.8mg / mL and tyramine was 0.3±0.9mg / mL. Inoculation of RR15 alone significantly reduced the amount of glutamine and tyramine in the rhizosphere, as evidenced in both the exudates of susceptible and resistant cultivars. Similar responses were observed when RR15 was inoculated simultaneously with the pathogen. Furthermore, the levels of glutamine and tyramine from the resistant cultivars were below the detection limit, while the decrease in the levels of glutamine and tyramine from the susceptible cultivars varied. Plants treated with RR15 had reductions of up to 0.8 mg / mL in glutamine and up to 0.4 mg / mL in tyramine, while RR15 in the presence of the pathogen had reductions of 1.9 mg / mL and 0.2 mg / mL in glutamine and tyramine, respectively. Root exudates from plants not treated with bacteria had comparable levels of glutamine (1.9 to 4.2 mg / mL) and tyramine (0.4 to 2.7 mg / mL), while plants infected with the pathogen had significantly higher levels of glutamine (2.8 to 4.8 mg / mL) and tyramine (0.9 to 2.8 mg / mL).

[0386] Shaping of secondary metabolite composition by Pantoea RR15

[0387] To investigate the potential role and impact of Pantoea RR15 on potato root exudates, an established MRM-based targeted metabolomics technique was employed. The results showed that the levels of some metabolites changed significantly between treated and untreated plants. The metabolic composition of RR15-treated plants revealed highly variable fluctuations in the root exudate metabolome (including when RR15 was co-inoculated with the pathogen), as shown by heat map cluster analysis of the metabolites ( Fig.21 ).

[0388] According to the findings, amino acids (proline, serine, and aspartic acid) and organic compounds (nicotinamide) reported to be associated with Sss activation were abundant in the exudates of untreated plants and decreased in the exudates of RR15-treated plants and even when RR15 was introduced together with Sss. In contrast, spermine and choline, reported to be inhibitors of Sss zoospore chemotaxis, were enhanced after the application of RR15. Interestingly, plants exposed to Sss alone presented changes in amino acids and organic compounds that were different from the RR15-treated plant controls. It was evident that low molecular weight organic compounds (LMWOs) such as aspartic acid, serine, nicotinamide, citrulline, and citric acid, which are believed to have stimulatory effects on Sss zoospore release, were highly abundant in Sss-infected potatoes, whereas non-irritant compounds such as choline and spermine were not detectable. Notably, the overall changes in irritant and non-irritant substances were very pronounced when RR15 was introduced ( Fig.21 ).

[0389] like Fig. 22 As shown, the metabolite composition of potato root exudates differed between resistant and susceptible cultivars. Organic compounds (lactic acid (log2 FC = -5.2), malic acid (log2 FC = -8.2), citric acid (log2 FC = -5.5), gallic acid (log2 FC = -1.2) and glucose C6 (log2 FC = -2.2)) were down-regulated in resistant cultivars, as were amino acids (tyrosine (log2 FC = -3.2), aspartic acid (log2 FC = -3.4), isoleucine (log2 FC = -3.7), valine (log2 FC = -3.4), lysine (log2 FC = -3.6), histidine (log2 FC = -3.7), leucine (log2 FC = -3.6) and threonine (log2 FC = -4.8)). On the other hand, susceptible cultivars showed fewer metabolite changes, with a decrease in amino acids (histidine (log2 FC = -3.6), methionine (log2 FC = -3.52), and arginine (log2 FC = -4.8)), and an increase in leucine (log2 FC = 2.1), phenylalanine (log2 FC = 1.2), and glucose C6 (log2 FC = 1.8). Notably, the major differential metabolites identified between resistant and susceptible cultivars showed a greater accumulation of non-stimulatory metabolites spermine (log2 FC = 2.98) and choline (log2 FC = 1.62) compared to the susceptible cultivar (measured levels were log2 FC = -2.2 and log2 FC = -1.4, respectively).

[0390] Pantoea RR15 promotes plant development

[0391] The bacterial strain Pantoea RR15 was evaluated for its growth promoting effect and biocontrol activity against Sss under greenhouse conditions. Fig.23 ). At 21 weeks after treatment, the results showed that inoculation of potatoes with strain Pantoea RR15 was most effective in promoting growth, with a significant (p<0.05) effect on strengthening the root system. In disease-free plants treated with RR15, the roots (average 40.5-51.2 cm / plant) and aerial parts (average 38.9-40.5 cm / plant) increased significantly by 13% and 11.5%, respectively. Infected plants treated with RR15 showed an increase of 0.7% in the roots (average 35.9-45.4 cm / plant) and 10.2% in the aerial parts (average 34.2-44.2 cm / plant) ( Fig.23 A). Notably, the growth-promoting effects of Pantoea RR15 on root and aerial part development were more pronounced in disease-free plants, but this effect was also observed in Sss-infected plants treated with RR15. In addition, the total dry weight of RR15-treated plants increased by 17.8% over the untreated control and by 31.4% over the pathogen-only treatment; however, no significant differences in dry mass accumulation were observed between Sss-infected plants treated with RR15 and the untreated control. ( Fig.23 B).

[0392] Screening of tuber development showed that RR15 treatment increased fresh tuber yield, especially in resistant cultivars, while having minimal effects on susceptible cultivars ( Fig.24 ). The average fresh tuber weight of RR15-treated resistant potatoes was 80.6 g / plant, compared with 51.1 g / plant for RR15-treated susceptible potatoes; however, the bacteria-treated plants produced more tubers than the untreated controls, with an average tuber weight of 71.8 g / plant for resistant plants and 45.5 g / plant for susceptible plants ( Fig.23 C).

[0393] Healthy plants (both resistant plants (36.7 μmol m -2 / leaf area) or susceptible plants (31.8 μmol m -2 / leaf area)) was higher than that of the resistant cultivar after infection (25.3 μmol m -2 / leaf area) and susceptible cultivars (20.5 μmol m -2 / leaf area) high ( Fig.23D). In addition, the results showed that the total chlorophyll content was consistently higher in the resistant cultivars compared to the susceptible cultivars, and that the resistant cultivars were significantly higher in the resistant cultivars, regardless of bacterial treatment, even after inoculation with RR15 (Res_gladiator = 27.4 μmol m -2 / leaf area, and Sus_lwa=26μmol m -2 / leaf area) or RR15 bound to pathogens (Res_gladiator = 25.3 μmol m -2 / leaf area, and Sus_lwa=23.9μmol m -2 / leaf area), the estimated chlorophyll yield in the resistant cultivars was also higher than that in the susceptible cultivars.

[0394] In addition, the biocontrol activity of Pantoea RR15 could be detected. Throughout the pot experiment, no disease symptoms were detected in the plants treated with RR15. The most severe infection occurred in the plants provided with Sss alone. However, the plants infected with Sss and provided with RR15 developed more roots (32.6-35.9 cm / plant) and aboveground parts (32.6-35.9 cm / plant) than when the pathogen was applied alone (aerial parts = 29.6-30.5 cm / plant; roots = 28.9-38.9 cm / plant) ( Fig.23 A). In addition, RR15 pretreatment reduced root gall formation, suggesting that it may have a role in infection prevention, as the number of galls assessed in infected potato seedlings inoculated with RR15 was lower than that assessed in infected potato seedlings not treated with RR15 ( Fig.23 E). It is worth emphasizing that in the absence of bacterial treatment, disease symptoms (such as tuber lesions and root rot) were clearly and extensively detected in infected plants. Disease symptoms were significantly more pronounced in susceptible cultivars than in resistant cultivars; however, the lower root rot degradation in infected resistant cultivars suggests that PantoeaRR15 plays an important role in mitigating the impact of the disease ( Fig.25 and Fig.26 ).

[0395] Discussion

[0396] Metabolomics is becoming increasingly important as a tool to effectively distinguish the origin of metabolites and study plant-microbe interactions. The presence of plant pathogens, beneficial microorganisms, and host plants is likely to produce changes in their respective metabolomes due to the input of exogenous compounds from all community members. In this study, the colonization of the introduced bacteria on the roots, an important stage in the formation of plant-microbe interactions, was examined. In addition, metabolomic analysis was performed to evaluate the changes in the metabolic status of potato secretion due to bacterial colonization in the rhizosphere environment and to determine whether it improves plant viability and growth while also protecting the potato from invasion by plant pathogens.

[0397] The results of the study showed that the colonization efficiency of strain Pantoea RR15 in the root environment was consistent and robust in both resistant and susceptible cultivars 21 weeks after inoculation. The growth dynamics of Pantoea RR15 in the rhizosphere of both cultivars was constant, resulting in a DNA level of 2.6x10 6 -4x10 6 log 10 DNA copies / 5ng total DNA stable population, even in the presence of pathogens (1x10 6 -3x10 6 log 10 DNA copies / 5ng total DNA). In addition, according to the resistant cultivars (from 4x10 6 to 3.2x10 6 log 10 DNA copies / 5ng total DNA) and susceptible cultivars (from 3.1x10 6 to 1.2x10 6 log 10 The gradual decrease in bacterial population over time observed in the Pantoea RR15 counts assessed by 10 DNA copies / 5 ng total DNA) confirmed similar observations to the colonization pattern of strain Pantoea SWg2 reported by Xie J et al. (2017, Biological Control, 113:9-17), indicating that SWg2 counts in roots increased to 10 in 3 DPI. 8 CFU g -1 , then slowly drops to 10 in 28DPI 3 CFU g -1. As described in this study, the successful colonization of Pantoea RR15 in the potato root habitat may have led to motility characteristics that potentially facilitate the rapid attachment process, as previously observed by Wheatley RM and Poole PS (2018, FEMS Microbiol. Rev., 42(4): 448-461). Wheatley RM and Poole PS demonstrated that the root attachment process of Pantoea is driven by pili and attachment proteins (as in plant-colonizing Pseudomonas, which may be combined with or respond to chemical signals from the plant). Similarly, among Pantoea species, isolate YR343 (Bible AN et al., 2016, Frontiers in Microbiol., 7: Article 491) has been shown to have a variety of characteristics that enhance its ability to survive and colonize the rhizosphere, including swimming and swarming motility.

[0398] As shown in this study, the effect of Pantoea RR15 treatment in promoting plant development in resistant and susceptible cultivars was verified by visible root improvement and significant increase in plant biomass. The extent of the plant growth promotion effect of Pantoea RR15 reported in this study is consistent with the situation that Pantoea is considered to have a series of diverse plant growth promotion traits (including indole-3-acetic acid production and phosphorus dissolution). Phosphorus is one of the most essential mineral elements for seedling growth, but it is often included in the soil in an insoluble form (such as calcium phosphate), making it unavailable to plants (Rodriguez H et aL, 2006, Plant and Soil, 287 (1-2): 15-21). Some plant growth promoting microorganisms (as demonstrated in most Pantoea isolates) can dissolve mineral phosphates and promote plant absorption of phosphates, thereby promoting plant development (Zaidi S et al., 2006, Chemosphere, 64: 991-997).

[0399] in conclusion

[0400] Recent advances in metabolomics were employed to investigate changes in root exudate patterns induced by treatment of plants with Pantoea RR15. Overall, the metabolic profiles in potato were diverse and altered in quite different ways following RR15 inoculation. Given that the mechanisms behind these changes in belowground chemical signals are still unclear, the findings suggest that microbial inoculations may alter the exudate profiles of healthy and diseased plants. To our knowledge, there is currently no information available on the metabolic responses of microbial inoculations with potato and powdery scab. These findings contribute to our understanding of the role of PantoeaRR15 in supporting the activity of various biostimulants, especially in plant growth regulation. We therefore speculate that one of the processes behind Pantoea RR15-mediated plant growth enhancement is the modulation of the composition of root exudates. From a practical perspective, the findings may help develop innovative ways to address crop tolerance to soil-borne disease infections.

[0401] Example 4

[0402] Field trials of bacterial inoculants to boost plant growth and increase yield

[0403] Materials and Methods

[0404] Production of inoculants

[0405] Prepare the inoculant of bacterial strain (RR15) 1 week before use. Cultivate bacterial strain RR15 overnight at 25 ℃ in 200mL LB broth in 2L flask on orbital shaker. Centrifuge (3000rpm) to concentrate cells for bacterial culture, and add 100mL of concentrated bacterial suspension to 50mL of sterile 15% glycerol and 50mL of sterile 1% xanthan gum. Add 5g of 2% bacterial peptone. Then, mix the bacterial mixture with sterilized vermiculite (250g) and spread into a thin layer on a sterile tray in a laminar flow cabinet to air-dry overnight. Before use, the air-dried inoculant is stored in a polypropylene bag.

[0406] Preparation and trial settlement of seed tubers

[0407] Certified (disease-free) seed tubers of the brown-skinned Burbank potato cultivar were used. Approximately 100 tender stems (approximately 50 g each) cut from the seed tubers were coated with inoculants. For the control, 100 tender stems remained untreated. Seed tubers were planted in a randomized block design in the field of the Forthside Vegetable Research Institute (Tasmania, Australia). Treated tubers and control tubers were planted in five replicate plots, each plot comprising two rows of 10 tubers. The soil type was a soil (red ferrosol) specific to the region. Typical commercial fertilizers and irrigation measures were used in the test.

[0408] Trial harvest and scoring

[0409] Plots were harvested approximately 6 months after planting. All tubers from five plants were harvested per plot. Tubers were counted and weighed individually. The distribution of tubers within the commercially acceptable size and weight range was calculated.

[0410] result

[0411] Potato plants emerged earlier from the treated plots than from the control plots, and the plants appeared stronger and more vigorous in the early stages of their growth. As the plants matured, the differences in leaf development were less obvious. At harvest, no disease was found on any tubers from the control or treated plots. On average, the tubers from the treated plots were significantly larger. The evaluation of tuber number and weight is summarized in Table 4 below.

[0412] Table 4

[0413]

[0414] The count mean shows that, on average, the control plot has more tuber quantity than the treated plot. The average weight of each tuber in the treated plot is larger. The total weight of the tubers in the treated plot (9.9 kg) is larger than the total weight of the tubers in the control plot (8.7 kg), and seems to be consistent with an average increase of 12.3% (between representative tubers). The marketable tuber weight (not including all tubers less than 75g) shows that the tuber quantity between the control and the treatment is suitable, and the tuber yield of the treated plot is higher, increasing by an average of 16.8%. The ideal weight is within the size grade range of 250-850g. The treated plot (3.8kg) has more quantity and yield than the control plot (2.3kg) within this grade, increasing by an average of 40.3%.

[0415] in conclusion

[0416] Potato seed tubers treated with a bacterial inoculant prepared in a vermiculite carrier (containing glycerol and xanthan gum as bacterial stabilizers) showed better emergence and early growth, which was reflected in higher tuber yields. Notably, tubers from treated plots were larger on average, and more tubers fell into the ideal size / weight category for sale.

[0417] Throughout the specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "comprising", should be understood to imply the inclusion of stated elements or integers or groups of elements or integers but not the exclusion of any other elements or integers or groups of elements or integers.

[0418] It should be noted that when a numerical range is expressed, it should be clearly understood that the range includes the upper and lower limits of the range and all values ​​or sub-ranges between the upper and lower limits, as if each value and sub-range were explicitly listed. Unless otherwise specified, the phrase "about X% to Y%" has the same meaning as "about X% to about Y%".

[0419] The term "approximately" as used in this specification means approximately or close to, and in the context of a numerical value or range described herein is intended to cover variations of + / - 10% or less, + / - 5% or less, + / - 1% or less, or + / - 0.1% or less of the numerical value or range described or claimed.

[0420] It should also be noted that as used herein, the singular forms "a," "an," and "the" include plural aspects unless the context dictates otherwise.

[0421] The subject headings used herein are for the convenience of the reader's reference only and should not be used to limit the subject matter of the entire disclosure or claims. The subject headings should not be used to interpret the scope of the claims or the limitations of the claims.

[0422] The description provided herein is related to several embodiments, which may have common characteristics and features. It should be understood that one or more features of an embodiment can be combined with one or more features of other embodiments. In addition, a single feature or feature combination of an embodiment can constitute another embodiment.

[0423] Unless otherwise specified herein or clearly contradicted by the context, all methods described herein can be performed in any suitable order. Unless otherwise required, the use of any and all examples or exemplary language (e.g., "such as") provided herein is only to better illustrate the exemplary embodiments, and does not limit the scope of the claimed invention. No language in the specification should be construed as indicating that any unclaimed element is essential.

[0424] It will be apparent to those skilled in the art that, although the present invention has been described in detail for the purpose of clarity and understanding, various modifications and variations may be made to the embodiments and methods described herein without departing from the scope of the inventive concepts disclosed in this specification.

[0425] It will be appreciated by those skilled in the art that the invention described herein may be easily modified and altered in addition to those specifically described. It should be understood that the present invention includes all such changes and modifications. The present invention also includes all steps, features, compositions and compounds mentioned or indicated in this specification, either individually or collectively, and any and all combinations of any two or more steps or features.

[0426] Finally, reference is made to standard textbooks of molecular biology that contain methods for practicing the basic techniques encompassed by the present invention, see for example "Green MR and Sambrook J, Molecular Cloning: A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press, 2012.".

Claims

1. An isolated bacterial strain RR15 of the genus Pantoea, deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015.

2. A culture of the bacterial strain according to claim 1.

3. A supernatant obtained from the culture according to claim 2.

4. A composition comprising the bacterial strain according to claim 1, the culture according to claim 2 and / or the supernatant according to claim 3.

5. The bacterial strain, culture, supernatant or composition according to any one of claims 1 to 4, wherein the bacterial strain is capable of promoting plant growth.

6. The bacterial strain, culture, supernatant or composition according to any one of claims 1 to 5, wherein the bacterial strain is capable of promoting plant root growth.

7. The bacterial strain, culture, supernatant or composition according to any one of claims 1 to 6, wherein the bacterial strain is capable of increasing the yield of plant tubers.

8. The bacterial strain, culture, supernatant or composition of claim 7, wherein tuber size and / or weight is increased.

9. The bacterial strain, culture, supernatant or composition according to any one of claims 5 to 8, wherein the plant belongs to the Solanaceae family.

10. The bacterial strain, culture, supernatant or composition of claim 9, wherein the plant is of the genus Solanum.

11. The bacterial strain, culture, supernatant or composition according to any one of claims 1 to 10, wherein the bacterial strain is capable of inhibiting plant root infection caused by pathogens.

12. The bacterial strain, culture, supernatant or composition according to any one of claims 1 to 11, wherein the bacterial strain is capable of inhibiting plant root diseases caused by pathogens.

13. The bacterial strain, culture, supernatant or composition of claim 11 or 12, wherein the pathogen is Pseudomonas aeruginosa.

14. The composition according to any one of claims 4 to 13, further comprising a biological agent.

15. The composition of claim 14, wherein the biological agent is a plant growth promoter.

16. The composition according to any one of claims 4 to 15, further comprising a bacterial stabilizer.

17. The composition of claim 16, wherein the bacterial stabilizer is xanthan gum.

18. A method for promoting plant growth, the method comprising: An effective amount of the bacterial strain, culture, supernatant and / or composition according to any one of claims 1 to 17 is applied to the plant or the soil in which the plant will or is growing.

19. A method for increasing plant tuber yield, the method comprising: An effective amount of the bacterial strain, culture, supernatant and / or composition according to any one of claims 1 to 17 is applied to the plant or the soil in which the plant will or is growing.

20. The method of claim 19, wherein tuber size and / or weight is increased.

21. A method for inhibiting plant root infection caused by pathogens, the method comprising: An effective amount of the bacterial strain, culture, supernatant and / or composition according to any one of claims 1 to 17 is applied to the plant or the soil in which the plant will or is growing.

22. A method for inhibiting plant root diseases caused by pathogens, the method comprising: An effective amount of the bacterial strain, culture, supernatant and / or composition according to any one of claims 1 to 17 is applied to the plant or the soil in which the plant will or is growing.

23. A composition comprising the isolated bacterial strain RR15 of the genus Pantoea, which was deposited with the Australian National Measurement Institute on June 9, 2022, with the deposit number V22 / 011015.

24. A composition comprising a culture of an isolated bacterial strain RR15 of the genus Pantoea, wherein the isolated bacterial strain RR15 was deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015.

25. A composition comprising the supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea, wherein the isolated bacterial strain RR15 was deposited with the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015.

26. A composition according to any one of claims 23 to 25, wherein the bacterial strain is capable of promoting plant growth.

27. A composition according to any one of claims 23 to 26, wherein the bacterial strain is capable of promoting plant root growth.

28. A composition according to any one of claims 23 to 27, wherein the bacterial strain is capable of increasing the yield of plant tubers.

29. A composition according to claim 28, wherein tuber size and / or weight is increased.

30. The composition according to any one of claims 26 to 29, wherein the plant belongs to the Solanaceae family.

31. The composition of claim 30, wherein the plant is of the genus Solanum.

32. A composition according to any one of claims 23 to 31, wherein the bacterial strain is capable of inhibiting plant root infection caused by a pathogen.

33. A composition according to any one of claims 23 to 32, wherein the bacterial strain is capable of inhibiting plant root diseases caused by pathogens.

34. A composition according to claim 32 or 33, wherein the pathogen is Pseudomonas aeruginosa.

35. The composition of any one of claims 23 to 34, further comprising a biologic agent.

36. The composition of claim 35, wherein the biological agent is a plant growth promoter.

37. The composition of any one of claims 23 to 36, further comprising a bacterial stabilizer.

38. The composition of claim 37, wherein the bacterial stabilizer is xanthan gum.

39. A composition according to any one of claims 23 to 38, for use in promoting plant growth, increasing plant tuber yield, inhibiting plant root infection caused by pathogens and / or inhibiting plant root diseases caused by pathogens.

40. A composition according to any one of claims 23 to 39, when used to promote plant growth, increase plant tuber yield, inhibit plant root infection caused by pathogens and / or inhibit plant root diseases caused by pathogens.

41. A method for promoting plant growth, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) a supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea, deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; or (iv) A composition comprising (i), (ii) and / or (iii).

42. A method for increasing plant tuber yield, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) a supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea, deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; or (iv) A composition comprising (i), (ii) and / or (iii).

43. The method of claim 42, wherein tuber size and / or weight is increased.

44. A method for inhibiting plant root infection caused by a pathogen, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) a supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea, deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; or (iv) A composition comprising (i), (ii) and / or (iii).

45. A method for inhibiting plant root diseases caused by pathogens, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) a supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea, deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; or (iv) A composition comprising (i), (ii) and / or (iii).

46. ​​A composition for promoting plant growth, increasing plant tuber yield, inhibiting pathogen infection of plant roots and / or inhibiting plant root diseases caused by pathogens, the composition comprising an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) The supernatant of the culture of the isolated bacterial strain RR15 of the genus Pantoea, wherein the isolated bacterial strain RR15 was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015.

47. A composition, when used to promote plant growth, increase plant tuber yield, inhibit pathogen infection of plant roots and / or inhibit plant root diseases caused by pathogens, comprising an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) The supernatant of the culture of the isolated bacterial strain RR15 of the genus Pantoea, wherein the isolated bacterial strain RR15 was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015.

48. A method for promoting plant growth, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) An isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; (ii) A culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or (iv) A composition comprising (i), (ii) and / or (iii).

49. A method for increasing plant tuber yield, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) An isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; (ii) A culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or (iv) A composition comprising (i), (ii) and / or (iii).

50. A method for inhibiting plant root infection caused by a pathogen, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) An isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; (ii) A culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or (iv) A composition comprising (i), (ii) and / or (iii).

51. A method for inhibiting plant root diseases caused by pathogens, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) An isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; (ii) A culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or (iv) A composition comprising (i), (ii) and / or (iii).

52. A composition comprising: (i) An isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; (ii) A culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or (iii) The supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10.

53. A method for reducing the level of one or more pathogen irritating compounds in the rhizosphere environment of a plant, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) The isolated bacterial strain RR15 of the genus Pantoea was deposited at the National Measurement Institute of Australia on June 9, 2022, with the deposit number V22 / 011015; (ii) a culture of an isolated bacterial strain RR15 of the genus Pantoea deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; and / or (iii) a supernatant of a culture of an isolated bacterial strain RR15 of the genus Pantoea, deposited with the National Measurement Institute of Australia on 9 June 2022 with accession number V22 / 011015; or (iv) A composition comprising (i), (ii) and / or (iii).

54. A method for reducing the level of one or more pathogen irritating compounds in the rhizosphere environment of a plant, the method comprising: Applying to the plant or to the soil in which the plant will or is growing an effective amount of: (i) An isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; (ii) A culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; and / or (iii) a supernatant of a culture of an isolated bacterial strain selected from one or more of RR15, RR09, RR08, RR17, RR12, RR01, RR04, RR14, RR07 and RR10; or (iv) A composition comprising (i), (ii) and / or (iii).

55. The method of claim 53 or 54, wherein the one or more pathogen stimulating compounds are selected from L-glutamine and tyramine.

Images