Combination of Curaxin with immune checkpoint inhibitors for treatment of cancer

Abstract

The present disclosure relates, in part, to curaxin compounds, or pharmaceutically acceptable salts thereof, combinations of curaxin compounds with immune checkpoint inhibitors, or pharmaceutically acceptable salts thereof, compositions comprising them, and methods of preventing or treating cancer by administering them.

Description

[0001] Reference to a sequence listing

[0002] This application includes a sequence listing submitted electronically as an XML file named 853003345SEQ, created on April 28, 2023, and 11,502 kilobytes in size. The sequence listing is incorporated herein by reference. Technical Field

[0003] The present disclosure relates in part to a curaxin compound or a pharmaceutically acceptable salt thereof. More specifically, the present disclosure relates to a combination of a curaxin compound or a pharmaceutically acceptable salt thereof with an immune checkpoint inhibitor, and a composition comprising the combination, and a method of treating cancer by administering the combination. Background Art

[0004] Although immune checkpoint blockade (ICB)-based therapies such as antibodies against programmed death (PD)-1 have revolutionized cancer treatment, the majority (70%-90%) of patients will not respond to these therapies or will eventually develop resistance to them (Topalian et al., N Engl J Med, 2012, 366, 2443-2454; Hodi et al., N Engl J Med, 2010, 363, 711-723; Lu et al., J Oncol Pharm Pract, 2015, 21, 451-467; and Yun et al., Cancer Med, 2016, 5, 1481-1491). An attractive approach is to stimulate unresponsive (so-called "cold") tumors and overcome ICB resistance by activating antiviral innate immune signaling pathways in the tumor microenvironment. An attractive way to stimulate unresponsive (so-called "cold") tumors and overcome ICB resistance is by activating antiviral innate immune signaling pathways within the tumor microenvironment (TME) (Patel et al., Immunity, 2018, 48, 417-433; and Corrales et al., Cell Res, 2017, 27, 96-108). Reawakening endogenous retroviral elements (EREs) has become a powerful means to stimulate innate immune signaling and elicit ICB responsiveness in cold tumors (Loo et al., Trends Cell Biol, 2019, 29, 31-43).EREs account for more than 50% of mammalian genomes, and their dysregulation leads to the production of double-stranded RNA (dsRNA) transcripts that engage cellular dsRNA sensors and trigger type I interferon (IFN) production, thereby eliciting a potent anti-tumor response (Liu et al., Nat Med, 2019, 25, 95-102; Ishizuka et al., Nature, 2019, 565, 43-48; Mehdipour et al., Nature, 2020, 588, 169-173; Gannon et al., Nat Commun, 2018, 9, 5450; Cuellar et al., J Cell Biol, 2017, 216, 3535-3549; Sheng et al., Cell, 2018, 174, 549-563e519; Chiappinelli et al., Cell, 2016, 164, 1073; Roulois et al., Cell, 2015, 162, 961-973; Goel et al., Nature, 2017, 548, 471-475; Canadas et al., Nat Med, 2018, 24, 1143-1150; Zhang et al., Cell, 2018, 175, 1244-1258e1226; and Bowling et al., Cell, 2021).

[0005] The enzyme adenosine deaminase RNA specific 1 (ADAR1) is the main repressor of the immune response activated by dsRNA derived from ERE (Heraud-Farlow et al., Curr Opin Hematol, 2019, 26, 241-248; and Eisenberg et al., Nat Rev Genet, 2018, 19, 473-490). ADAR1 binds dsRNA and reduces its ability to activate dsRNA sensors by introducing AI editing in its sequence (Heraud-Farlow et al., Curr Opin Hematol, 2019, 26, 241-248; Samuel et al., J Biol Chem, 2019, 294, 1710-1720; and George et al., J Biol Chem, 2016, 291, 6158-6168). dsRNA typically adopts a right-handed (A-RNA) conformation and is recognized by the dsRNA binding domain (dsRBD) of ADAR1, thereby preventing the host A-RNA sensors melanoma differentiation antigen-5 (MDA-5) and protein kinase dsRNA-dependent (PKR) from amplifying the immune response (Liu et al., Nat Med, 2019, 25, 95-102; Ishizuka et al., Nature, 2019, 565, 43-48; Mehdipour et al., Nature, 2020, 588, 169-173; Gannon et al. Nat Commun, 2018, 9, 5450; George et al., J Biol Chem, 2016, 291, 6158-6168; and Chung et al., Cell, 2018, 172, 811-824e814). When ADAR1 expression in tumors is eliminated, MDA-5 and PKR are activated, leading to type I IFN cytokine production, loss of tumor cell fitness, and significantly enhanced ICB responsiveness (Liu et al., Nat Med, 2019, 25, 95-102; Ishizuka et al., Nature, 2019, 565, 43-48; Mehdipour et al., Nature, 2020, 588, 169-173; Gannon et al., Nat Commun, 2018, 9, 5450; and Heraud-Farlow et al., Curr Opin Hematol, 2019, 26, 241-248). Summary of the invention

[0006] The present disclosure provides compounds of formula I:

[0007]

[0008] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each is independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; and n is 1, 2 or 3.

[0009] The present disclosure also provides compounds of formula II:

[0010]

[0011] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

[0012] The present disclosure also provides compounds of formula III:

[0013]

[0014] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

[0015] The present disclosure also provides a pharmaceutical composition comprising any one or more of a compound having Formula I, Formula II and Formula III or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor.

[0016] The present disclosure also provides a method of treating cancer in a subject, comprising administering to a subject in need thereof any one or more of a compound of Formula I, Formula II, and Formula III, or a pharmaceutically acceptable salt thereof, and an immune checkpoint inhibitor.

[0017] The present disclosure also provides the use of a compound having any one or more of Formula I, Formula II and Formula III or a pharmaceutically acceptable salt thereof, or a composition comprising a compound having any one or more of Formula I, Formula II and Formula III or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor in the preparation of a medicament for treating a subject having cancer.

[0018] The present disclosure also provides the use of a compound having any one or more of Formula I, Formula II and Formula III or a pharmaceutically acceptable salt thereof, or a composition comprising any one or more of a compound having Formula I, Formula II and Formula III or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor for treating a subject having cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 (Panel a) Depicts ADAR1 protein levels in MEFs after transfection of recombinant CRISPR / Cas9 protein and sgRNA targeting luciferase (ADAR WT) or murine Adar1 (hereafter ADAR KO) and exposure to IFNβ (100 ng / mL, 24 h).

[0020] Figure 1 (Panel b) depicts the detection of Z-RNA and A-RNA accumulation in ADAR WT or ADAR1 KO cells.

[0021] Figure 1 (Figure c) depicts Figure 1 (B) Quantification of fluorescence intensity of Z-RNA and A-RNA signals.

[0022] Figure 1 (Panel d) Depicts ADAR1 WT or KO MEFs fixed at day 7 after sgRNA transfection, exposed to the indicated nucleases, and stained for A-RNA and Z-RNA.

[0023] Figure 1 (Figure e) Depiction Figure 1 (C) Quantification of fluorescence intensity of Z-RNA and A-RNA signals.

[0024] Figure 1 (Fig. f) Depicts the time course of Z-RNA and A-RNA formation in ADAR1 KO MEFs after IFNβ exposure.

[0025] Figure 1 (Figure g) Describe Figure 1 (Fig. f) Quantification of fluorescence intensity of Z-RNA and A-RNA signals.

[0026] Figure 1 (Figure h) depicts the expression of Adar1 in the mitochondria after 48 h of exposure to IFNβ (100 ng / mL). - / - Z-RNA accumulation in immortalized MEFs derived from mice (KO) or mice carrying an editing-deficient point mutation (E861A).

[0027] Figure 1 (Figure i) Describing Figure 1 Quantification of fluorescence intensity of Z-RNA signal in (Fig. h). Unpaired Student's t-test, **p<0.005, ***p<0.0005.

[0028] Figure 1 (Panel j) Depicts the 3'UTR of the reverse mRNA containing a SINE, showing Z22 enrichment (blue peak), editing site (red bar), location of the SINE, and the location of the qPCR primers used in panel k.

[0029] Figure 1 (Panel k) depicts qPCR analysis of the indicated SINE-containing inverse mRNA 3'UTRs after immunoprecipitation with Z22 or control IgG antibodies from ADAR1 KO MEFs stimulated with or without IFNβ (100 ng / mL) for 48 h.

[0030] Figure 1(Fig. 1) depicts qPCR analysis of the indicated mRNAs containing GT repeats after immunoprecipitation with Z22 or control IgG antibodies from ADAR1 KO MEFs stimulated with or without IFNβ (100 ng / mL) for 48 h. Potential bipartite (dumbbell-shaped) Z-forming RNA structures (RNA folds) are shown on the right side of each figure, and putative Zα binding sites are outlined in pink boxes.

[0031] Figure 1 (Panel m) depicts CD spectra of synthetic dumbbell RNA (SEQ ID NO: 11) and control RNA (SEQ ID NO: 12) at 3 M NaCl. The RNA structure (RNA fold) is shown below the CD spectrum graph, and the putative Zα binding site is outlined in a pink box.

[0032] Figure 2 (a) Depicts the stable reconstitution of immortalized Zbp1 using an empty vector control (Vec) or FLAG-ZBP1 (ZBP1). - / - MEFs were subjected to CRISPR / Cas9-based control (ADAR WT) or ADAR1 ablation (ADAR KO) and monitored for growth over 12 days in the presence or absence of neutralizing anti-IFNβ antibodies (0.5 μg / mL).

[0033] Figure 2 (Panel b) depicts micrographs of ADAR1 WT or ADAR KO after treatment with IFNβ (100 ng / mL) for 48 h.

[0034] Figure 2 (C) depicts the measured IFNβ levels at 48 h after treatment. Figure 2 (Fig. b) Cell viability.

[0035] Figure 2 (D) depicts Zbp1 expressing FLAG-ZBP1 treated with the indicated cytokines (100 ng / mL). - / - MEFs were treated with either ADAR1 present (ADAT WT) or eliminated by CSISPR / Cas9 (ADAR KO), and cell viability was determined 48 h after treatment.

[0036] Figure 2 (Panel e) depicts cells treated with IFNβ or IFNγ (100 ng / mL) in the presence or absence of zVAD (50 mM) plus GSK'843 (5 mM). Figure 2 (Panel d) and examined for viability 48 h after exposure.

[0037] Figure 2(Fig. f) depicts a proximity ligation assay showing the interaction between ZBP1 and Z-RNA in IFN-treated cells when ADAR1 is eliminated. The nuclei are stained with DAPI (cyan) and outlined with white dashed lines. The selected areas in the left images are magnified on the right side of each image.

[0038] Figure 2 (Figure g) depicts the display Figure 2 (Panel f) Bar graph showing quantification of PLA purple dots per cell.

[0039] Figure 2 (Figure h) Depicts Zbp1 reconstituted with FLAG-ZBP1 or FLAG-ZBP1DZa - / - MEFs were depleted of ADAR1 expression, treated with or without IFNβ (100 ng / mL), and FLAG immunoprecipitates were subjected to RT-qPCR using primers against the 3'UTR of Eif2ak2 or Ddx58.

[0040] Figure 2 (Panel i) depicts that FLAG-ZBP1 MEFs expressing or lacking ADAR1 were exposed to IFNβ (100 ng / mL, 48 hours) and anti-FLAG immunoprecipitates from these cells were examined for RIPK3, MLKL and FLAG. Whole cell extracts (5% input) were examined for RIPK3, MLKL, FLAG and ADAR1 proteins in parallel.

[0041] Figure 2 (Panel j) depicts immunofluorescence staining of pMLKL (green) in ADAR1 KO MEFs treated with IFNβ (100 ng / mL). Cell nuclei were stained with DAPI (blue) and outlined with white dashed lines.

[0042] Figure 2 (Panel k) Line graph depicting the kinetics of pMLKL positivity and ice ball bar graph showing the localization of pMLKL signal. Following IFN exposure in ADAR1 KO MEFs, pMLKL was observed in the cytoplasm and translocated to the plasma membrane.

[0043] Figure 2 (FIG. 1) depicts a schematic diagram showing that ADAR1 inhibits endogenous A-RNA and Z-RNA, thereby preventing activation of the PKR / MDA-5 response downstream of A-RNA and ZBP1-driven necroptosis downstream of Z-RNA.

[0044] Figure 3 (Figure a) Depicts the structures of A-RNA, Z-RNA, B-DNA and Z-DNA.

[0045] Figure 3 (Panel b) depicts quantification of the fluorescence intensity of the Z-DNA signal after treatment of MEFs with equimolar (5 μM) amounts of the indicated compounds for 18 h.

[0046] Figure 3 (Figure c) depicts the chemical structure of CBL0137.

[0047] Figure 3 (Panel d) depicts MEFs fixed 12 hours after treatment with CBL0137 (5 μM) were exposed to the indicated nucleases for 45 minutes and then stained for Z-DNA staining.

[0048] Figure 3 (Figure e) Depiction Figure 3 (Panel d) Quantification of the fluorescence intensity of the Z-DNA signal.

[0049] Figure 3 (F) Depicts the proportion of EREs and other repetitive sequences in the mouse genome (left) compared with the distribution of the Z22-enriched peak after treatment with CBL0137 (right).

[0050] Figure 3 (Figure g) Depicts the genomic distribution of L1Md T and L1Md A elements in Z22 pull-down.

[0051] Figure 3 (Panel h) Depicts the position of the maximum Z-score for L1Md T and L1Md A bound by Z22 in panel j.

[0052] Figure 3 (Panel i) depicts modified DNA in the presence or absence of CBL0137

[0053] [d(Cm 8 CD spectra of mGCACGCG) / d(CGCGTGCG)]. Gray indicates CBL0137 alone; light blue indicates DNA alone; orange indicates 1 equivalent of CBL0137 added to DNA; red indicates 2 equivalents of CBL0137 added to DNA.

[0054] Figure 3 (Fig. j) depicts the expression of 8-trifluoromethyl-2′-deoxyguanosine Z-DNA (CGC F GCG)2 19 F NMR spectroscopy.

[0055] Figure 3 (Figure k) Two views depicting the molecular dynamics model of the CBL0137:Z-DNA interaction.

[0056] Figure 4(a) Depicts Zbp1 expressing Vec or FLAG-ZBP1 that were untreated or treated with CBL0137 (5 μM) for 18 h. - / - Micrographs of MEFs.

[0057] Figure 4 (Panel b) Depicts the kinetics of CBL0137-induced cell death in Vec and FLAG-ZBP1 MEFs.

[0058] Figure 4 (Panel c) depicts Vec and FLAG-ZBP1 MEFs treated with CBL0137 (5 μM) in the presence or absence of zVAD (50 mM) and GSK'843 (5 mM) and viability examined 18 hours after treatment.

[0059] Figure 4 (Panel d) Immunoblot analysis depicting MLKL and caspase 3 activation in Vec and FLAG-ZBP1 MEFs.

[0060] Figure 4 (Panel e) depicts FLAG-ZBP1 MEFs treated with CBL0137 (5 μM) for 12 hours and assessed by immunofluorescence staining for ZBP1 localization and the presence of Z-DNA. Nuclei were stained with DAPI (blue) and outlined with white dashed lines.

[0061] Figure 4 (Panel f) depicts quantification of cells showing co-localization of ZBP1 and Z-DNA in the nucleus.

[0062] Figure 4 (Panel g) Depicts the genomic distribution of Z-DNA and FLAG-ZBP1 enrichment peaks after treatment with CBL0137.

[0063] Figure 4 (Panel h) Depicts quantification of the overlap between peaks in panel g.

[0064] Figure 4 (Panel i) Depicts the percentage of repetitive sequences in each L1Base category that overlap with the peaks from panel g.

[0065] Figure 4 (Panel j) Enrichment plot depicting ORF1- and ORF2-intact L1Md A and L1Md T repeat sequences overlapping with the peaks from panel g.

[0066] Figure 4(Panel k) depicts DNA eluted from indicated antibody pull-downs from CBL0137 treated / untreated FLAG-ZBP1, FLAG-ZBP1ΔZα MEFs examined by qRT-PCR using L1Md A and T specific primers. Data were normalized to input.

[0067] Figure 4 (Fig. 1) depicts Vec and FLAG-ZBP1 MEFs were treated with CBL0137 (5 μM) and anti-FLAG immunoprecipitates were examined for RIPK3, MLKL and FLAG. Whole cell extracts (5% input) were examined for RIPK3, MLKL and FLAG proteins in parallel.

[0068] Figure 4 (Panel m) depicts immunofluorescence staining of pMLKL (green) in FLAG-ZBP1 MEFs treated with CBL0137 (5 μM). Cell nuclei were stained with DAPI (blue) and outlined with white dashed lines.

[0069] Figure 4 (Panel n) depicts a line graph indicating the kinetics of pMLKL positivity and a bar graph showing the localization of the pMLKL signal.

[0070] Figure 4 (Panel o) depicts 3D reconstruction of CBL0137 treated nuclei showing DNA (DAPI) protruding from gaps in the nuclear membrane (lamin B1) (top). Arrows indicate protruding areas. Kinetics of nuclear membrane disruption in CBL0137 treated Vec or FLAG-ZBP1 MEFs (bottom).

[0071] Figure 4 (Panel p) Depicts a proposed model for CBL0137-mediated nuclear necroptosis.

[0072] Figure 5 (Fig. a) Kaplan-Meier overall survival curves depicting ZBP1 expression categories in skin melanoma cases from TCGA. Red line = high expression (expression > 7th empirical quartile; Q3); blue line = low expression (expression < 25th empirical quartile; Q1); gray line = expression between the 25th and 75th empirical quartiles.

[0073] Figure 5 (Panel b) depicts the enrichment scores of immune and stromal cell populations in cutaneous melanoma cases (TCGA). The upper panel of the heat map shows the log2 normalized gene expression values ​​of Zbp1, Ripk3, and Mlk1.

[0074] Figure 5(Fig. c) Violin plots depicting the expression distribution of Zbp1, Ripk3, and Mlkl in different cell clusters from scRNA-Seq analysis by Ishikuza et al. (Ishizuka et al., Nature, 2019, 565, 43-48). The width of the violin represents the cell density expressed in each population.

[0075] Figure 5 (Panel d) depicts immunofluorescence staining of fibroblasts (green), Z-DNA (red) in B16F10 melanoma sections from CBL0137-treated / untreated WT mice at 10 days post-inoculation showing infiltration of fibroblasts and infiltrated fibroblasts containing Z-DNA.

[0076] Figure 5 (Figure e) Depiction Figure 5 (Panel d) Quantification of fibroblast infiltration.

[0077] Figure 5 (Figure f) depicts Figure 5 (Panel d) Quantification of infiltrating fibroblasts containing Z-DNA.

[0078] Figure 5 (Figure g) depicts WT or Zbp1 - / - Tumors in mice injected with vehicle or CBL0137 were stained for PDGFRa (green) or pMLKL (red). Nuclei were stained with DAPI (blue).

[0079] Figure 5 (Figure h) Describe Figure 5 (G) Quantification of fibroblasts containing pMLKL.

[0080] Figure 5 (Fig. i) Depicts subcutaneous B16F10 or YUMM1.7 melanoma models established in C57BL / 6 mice. For the B16F10 model, tumors with similar volumes (50-100 mm 3 ) received the indicated treatments. For the YUMM1.7 model, mice with similar tumor volumes (100-150 mm 3 ) received the indicated treatments. Treatments were given every 2 days for a total of 4 doses.

[0081] Figure 5 (J) Depicts cells from WT or zbp1 treated with the indicated treatments 11 days after inoculation. - / - CD8 in B16F10 melanoma sections of mice + T cells (red), CD4 +Immunofluorescence staining of T (green) shows the influx of T cells.

[0082] Figure 5 (Figure k) depicts Figure 5 G in CD8 + Quantification of T cells.

[0083] Figure 5 (Figure 1) depicts syngeneic B16F10 tumor-bearing WT or zbp1 treated with vehicle plus control IgG or anti-PD-1 antibody or a combination of CBL0137 and control IgG or anti-PD-1 antibody. - / - Individual tumor growth curves of mice.

[0084] Figure 5 (Panel m) Depicts individual tumor growth curves for syngeneic B16F10 tumor-bearing WT mice treated with vehicle plus control IgG or anti-PD-1 antibody or a combination of CBL0137 and control IgG or anti-PD-1 antibody. The p-values ​​(log-rank test) indicate strong evidence against the null hypothesis that the risk of death is similar for the 3 categories.

[0085] Figure 6 (Panel a) Depicts the time course of Z-RNA and A-RNA formation in ADAR1 WT and ADAR1 KO MEFs.

[0086] Figure 6 (Panel b) depicts quantification of the fluorescence intensity of the Z-RNA and A-RNA signals in panel a.

[0087] Figure 6 (Panel c) Depicts the origin of sequenced RNA fragments in Z22RIP-seq of ADAR1 WT cells with or without IFNβ (100 ng / ml) treatment.

[0088] Figure 6 (Panel d) Depicts the editing index of Z22 pull-down in ADAR1 WT and KO cells before and after IFNβ treatment (100 ng / mL).

[0089] Figure 6 (E) Depicts the distribution of repetitive sequences showing non-stochastic editing levels (editing index > 0.5%, average coverage per adenosine > 10) in ADAR1-WT Z22 pull-downs after IFNβ treatment.

[0090] Figure 7 (Panel a) Schematic diagram depicting ZBP1 and its mutants.

[0091] Figure 7 (B) depicts the cell viability of ZBP1 and its mutants in a measured 48 hours after IFNβ treatment.

[0092] Figure 7 (C) Depicts the ZBP1 reconstituted with FLAG-ZBP1 or FLAG-ZBP1ΔZα - / - MEFs were ablated for ADAR1 expression, treated with or without IFNβ (100 ng / mL), and FLAG or control were expressed using primers targeting the 3′UTR of Xrn1, Tapbp, Slfn5, or Agl.

[0093] (IgG) Immunoprecipitates were subjected to RT-qPCR.

[0094] Figure 7 (Panel d) Lamin B1 (green) staining depicting nuclear membrane integrity of ADAR1 WT or ADAR1 KO MEFs treated with IFNβ (100 ng / mL) 48 hours after treatment.

[0095] Figure 7 (Panel e) Depicts the kinetics of nuclear envelope disruption in ADAR1 WT or ADAR1 KO MEFs after IFNβ (100 ng / mL) treatment. Unpaired Student's t-test, *p<0.05, **p<0.005. Scale bar in panel d represents 10 μm.

[0096] Figure 8 (a) Depicts the expression of Zbp1 stably reconstituted with empty vector (Vec), FLAG-ZBP1 or its mutants. - / - Kinetics of CBL0137-induced cell death in MEFs.

[0097] Figure 8 (B) Depicts Zbp1 reconstituted with empty vector (Vec), FLAG-ZBP1, or FLAG-ZBP1 mutants after CBL0137 treatment. - / - Immunoblot analysis of MLKL activation in MEFs.

[0098] Figure 8 (Panel c) depicts the distribution of the FLAG enrichment peak after treatment with CBL0137 (5 μM) for 14 h.

[0099] Figure 8 (Panel d) depicts a flow chart showing the algorithm used to construct the enrichment plots for L1Md A and L1Md T repeat sequences.

[0100] Fig. 9 (Panel a) depicts primary MEF, A549, HT-29 or HeLa cells treated with CBL0137 (5 μM) for 12 hours and stained for Z-DNA.

[0101] Fig. 9(Panel b) depicts quantification of the fluorescence intensity of the Z-DNA signal in panel a.

[0102] Fig. 9 (Panel c) Depicts the kinetics of CBL0137-induced cell death in HT-29 cells reconstituted with empty vector (Vec) or FLAG-hZBP1. DETAILED DESCRIPTION

[0103] Unless defined otherwise, all technical and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed embodiments belong.

[0104] As used herein, the terms "a" or "an" mean "at least one" or "one or more" unless the context clearly indicates otherwise.

[0105] As used herein, the term "about" means that the listed values ​​are approximate and that small variations will not significantly affect the practice of the disclosed embodiments. Where numerical values ​​are used, unless the context indicates otherwise, "about" means that the numerical value may vary by ±10% and remain within the scope of the disclosed embodiments.

[0106] As used herein, the term "alkenyl" means a straight or branched alkyl group having 2 to 20 carbon atoms and having one or more carbon-carbon double bonds. In some embodiments, the alkenyl group has 2 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, 2 to 4 carbon atoms, 3 to 10 carbon atoms, 3 to 8 carbon atoms, 3 to 6 carbon atoms, or 3 or 4 carbon atoms. Examples of alkenyl groups include, but are not limited to, vinyl, 1-propenyl, 2-methyl-1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, etc.

[0107] As used herein, the term "alkoxy" means a straight or branched-O-alkyl group having 1 to 20 carbon atoms. In some embodiments, the alkoxy group has 1 to 10 carbon atoms, 1 to 8 carbon atoms, 1 to 6 carbon atoms, 1 to 4 carbon atoms, 2 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, tert-butoxy, and the like.

[0108] As used herein, the term "alkyl" means a straight or branched saturated hydrocarbon group. In some embodiments, the alkyl group has 1 to 20 carbon atoms, 2 to 20 carbon atoms, 1 to 10 carbon atoms, 2 to 10 carbon atoms, 1 to 8 carbon atoms, 2 to 8 carbon atoms, 1 to 6 carbon atoms, 2 to 6 carbon atoms, 1 to 4 carbon atoms, 2 to 4 carbon atoms, 1 to 3 carbon atoms, or 2 or 3 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl (Me), ethyl (Et), propyl (e.g., n-propyl and isopropyl), butyl (e.g., n-butyl, tert-butyl, isobutyl), pentyl (e.g., n-pentyl, isopentyl, neopentyl), hexyl, isohexyl, heptyl, octyl, nonyl, 4,4-dimethylpentyl, 2,2,4-trimethylpentyl, decyl, undecyl, dodecyl, 2-methyl-1-propyl, 2-methyl-2-propyl, 2-methyl-1-butyl, 3-methyl-1-butyl, 2-methyl-3-butyl, 2-methyl-1-pentyl, 2,2-dimethyl-1-propyl, 3-

[0109] Methyl-1-pentyl, 4-methyl-1-pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl, 3,3-dimethyl-1-butyl, 2-ethyl-1-butyl and the like.

[0110] As used herein, the term "alkylamino" means an amino group substituted by an alkyl group. In some embodiments, the alkyl group is a lower alkyl group having 1 to 6 carbon atoms. Alkylamino groups include, but are not limited to, -NHCH2CH3, -NH(CH2)2CH3, -NH(CH2)3CH3, -NH(CH2)4CH3, and -NH(CH2)5CH3, etc.

[0111] As used herein, the term "alkylthio" means an -S-alkyl group having 1 to 6 carbon atoms. Alkylthio includes, but is not limited to, -SCH2CH3, -S(CH2)2CH3, -S(CH2)3CH3, -S(CH2)4CH3, and -S(CH2)5CH3, etc.

[0112] As used herein, the term "amino" refers to -NH2.

[0113] As used herein, the term "aminoalkoxy" refers to an alkoxy group substituted by an amino group. Examples of aminoalkoxy groups include, but are not limited to, -OCH2NH2, -OCH2CH2NH2, -O(CH2)3NH2, -O(CH2)4NH2, and the like.

[0114] As used herein, the term "aryl" means an aromatic hydrocarbon that is monocyclic, bicyclic or polycyclic (e.g., having 2, 3 or 4 fused rings). In some embodiments, the aryl group has 6 to 20 carbon atoms or 6 to 10 carbon atoms. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl and tetrahydronaphthyl, etc.

[0115] As used herein, the term "carrier" means a diluent, adjuvant, or excipient with which the compound is administered in a composition.

[0116] As used herein, the term "compound" refers to all stereoisomers, tautomers, isotopes, and polymorphs of the compounds described herein.

[0117] As used herein, the terms "comprising" (and any form of comprising, such as "comprise," "comprises," and "comprised"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "including"), and "comprising" are used interchangeably.

[0118] The terms “includes” and “include” or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and include the options following the term and do not exclude additional unrecited elements or method steps.

[0119] As used herein, the term "cyano" refers to -CN.

[0120] As used herein, the term "cycloalkyl" means a non-aromatic cyclic hydrocarbon, including cyclized alkyl, alkenyl and alkynyl groups with up to 20 ring-forming carbon atoms.Cycloalkyl has 3 to 15 ring-forming carbon atoms, 3 to 10 ring-forming carbon atoms, 3 to 8 ring-forming carbon atoms, 3 to 6 ring-forming carbon atoms, 4 to 6 ring-forming carbon atoms, 3 to 5 ring-forming carbon atoms or 5 or 6 ring-forming carbon atoms.The ring-forming carbon atoms of cycloalkyl can be optionally substituted by oxo or sulfide ion groups.Cycloalkyl includes but is not limited to monocyclic or polycyclic systems, such as condensed ring systems, bridged ring systems and spirocyclic systems.In some embodiments, polycyclic systems include 2, 3 or 4 condensed rings. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, norpinyl, norcarbyl, adamantyl, etc. The cycloalkyl group may also have one or more aromatic rings fused (having a common bond) to the cycloalkyl ring, such as benzo or thienyl derivatives of pentane, pentene, hexane, etc. (e.g., 2,3-dihydro-1H-inden-1-yl or 1H-inden-2(3H)-on-1-yl).

[0121] As used herein, the term "halo" refers to a halogen group and includes, but is not limited to, fluoro, chloro, bromo, and iodo.

[0122] As used herein, the term "heteroaryl" means an aromatic heterocycle having up to 20 ring atoms (e.g., C) and having at least one heteroatom ring member (ring atom) such as sulfur, oxygen, or nitrogen. In some embodiments, the heteroaryl has at least one or more heteroatom ring atoms, each of which is independently sulfur, oxygen, or nitrogen. In some embodiments, the heteroaryl has 3 to 20 ring atoms, 3 to 10 ring atoms, 3 to 6 ring atoms, or 3 to 5 ring atoms. In some embodiments, the heteroaryl contains 2 to 14 carbon atoms, 2 to 7 carbon atoms, or 5 or 6 carbon atoms. In some embodiments, the heteroaryl has 1 to 4 carbon atoms.

[0123] Heteroatoms, 1 to 3 heteroatoms or 1 or 2 heteroatoms. Heteroaryl includes monocyclic and polycyclic (e.g., with 2, 3 or 4 fused rings) systems. Examples of heteroaryl include, but are not limited to, pyridyl, pyrimidyl, pyrazinyl, pyridazinyl, pyridyl (including 2-aminopyridine), triazine, furyl, quinolyl, isoquinolyl, thienyl, imidazolyl, thiazolyl, indolyl (such as indol-3-yl), pyrrolyl, oxazolyl, benzofuranyl, benzothienyl, pyrazolyl, benzothiazolyl, isoxazolyl, triazolyl (including 1,2,4-triazole, 1,2,3-triazole and 5-amino-1,2,4-triazole), tetrazolyl, indazolyl, isothiazolyl, 1,2,4-thiadiazolyl, benzothienyl, purinyl, carbazolyl, isoxazolyl, benzimidazolyl, Indolyl, pyranyl, pyrazolyl, triazolyl, oxadiazole (including 1,2,3-oxadiazole, 1,2,4-oxadiazole, 1,2,5-oxadiazole, 3-amino-1,2,4-oxadiazole, 1,3,4-oxadiazole), thianthrenyl, indolizinyl, isoindolyl, isobenzofuranyl, pyrrolyl, benzoxazolyl, xanthenyl, 2H-pyrrolyl, 3H-indolyl, 4H-quinolizinyl, phthalazinyl, acridinyl, naphthyridinyl, quinazolinyl, phenanthridinyl, perimidinyl, phenanthrolinyl, phenazinyl, isothiazolyl, phenothiazinyl, isoxazolyl, furazanyl, phenoxazinyl, etc.

[0124] As used herein, the term "hydroxy" or "hydroxyl" refers to an -OH group.

[0125] As used herein, the term "subject" means any animal described herein.

[0126] As used herein, the phrase "in need thereof" means that a "subject" has been identified as being in need of a particular method, prevention, or treatment. In some embodiments, identification can be performed by any diagnostic means. In any of the methods, preventions, and treatments described herein, a "subject" may be in need thereof. In some embodiments, a "subject" is in an environment where a particular disease, disorder, or condition is prevalent or is about to travel to the environment or has traveled to the environment.

[0127] As used herein, the term "integer" means a numerical value that is an integer. For example, "an integer from 1 to 5" means 1, 2, 3, 4 or 5.

[0128] As used herein, the term "nitro" means -NO2.

[0129] As used herein, the phrase "pharmaceutically acceptable" means a compound, material, composition

[0130] In some embodiments, the term "pharmaceutically acceptable" means approved by the regulatory agency of the federal government or state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals and more particularly in humans. In some embodiments, pharmaceutically acceptable compounds, materials, compositions and / or dosage forms will not produce a lasting adverse effect on the overall health of the subject or the subject being treated. However, it should be recognized that the transient effects of such as slight stimulation or "tingling" sensation in the case of drug administration are common, and the presence of such transient effects is not inconsistent with the composition, preparation or composition (e.g., excipient) discussed.

[0131] As used herein, the phrase "pharmaceutically acceptable salt" includes, but is not limited to, salts of acidic or basic groups. Compounds that are basic in nature are capable of forming a variety of salts with various inorganic and organic acids. Acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those acids that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including, but not limited to, sulfates, thiosulfates, citrates, maleates, acetates, oxalates, hydrochlorides, hydrobromides, hydroiodides, nitrates, sulfates, bisulfates, bisulfites, phosphates, acid phosphates, isonicotinates, borates, acetates, lactates, salicylates, citrates, acid citrates, tartrates, oleates, tannins. The invention relates to the pharmaceutically acceptable salts of the present invention. The pharmaceutically acceptable salts of the present invention are hydroxy-4-(2-hydroxy-3-naphthoate) and 4-(2-hydroxy-3-naphthoate). The pharmaceutically acceptable salts of the present invention are hydroxy- ... Salts also include quaternary ammonium salts of the compounds described herein, wherein the compounds have one or more tertiary amine moieties.

[0132] As used herein, the terms "treat," "treated," or "treating" mean both therapeutic treatment and prophylactic or preventative measures, wherein the goal is to prevent or slow down (mitigate) an unwanted physiological disorder, condition, or disease or to obtain a beneficial or desired clinical result. For purposes herein, a beneficial or desired clinical result includes, but is not limited to, alleviation of symptoms; reduction in the extent of the disorder, condition, or disease; stabilization of the state of the disorder, condition, or disease (i.e., not worsening); delay in the onset or slowing of the progression of the disorder, condition, or disease; improvement or alleviation (whether partial or total), whether detectable or undetectable) of the disorder, condition, or disease state; improvement in at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or amelioration of the disorder, condition, or disease. Treatment includes inducing a clinically significant response, optionally without excessive levels of side effects. Treatment also includes prolonged survival compared to the expected survival if not receiving treatment.

[0133] At various places herein, substituents of compounds may be disclosed in groups or in ranges. It is expressly intended that the disclosure include each and every individual subcombination of the members of such groups and ranges. For example, the term "C 1-6 "Alkyl" is expressly intended to disclose individually methyl, ethyl, propyl, C4 alkyl, C5 alkyl, and C6 alkyl.

[0134] For compounds in which a variable appears more than once, each variable can be a different moiety selected from the Markush group that provides options for the variable. For example, when a structure is described as having two R groups present simultaneously on the same compound, the two R groups can represent different moieties selected from the Markush group defined for R. In another example, when a structure is described as having two R groups present simultaneously on the same compound, the two R groups can represent different moieties selected from the Markush group defined for R. When specifying optional multiple substituents "R" in the form of , it is understood that the substituent "R" can appear "x" times at any one or more positions on the ring, and "R" can be a different moiety at each occurrence. In addition, in the above examples, where the variable "Y" will generally include one or more hydrogens, such as when "Y" is CH2, NH, etc., any H can be replaced by a substituent.

[0135] It should be understood that, for the sake of clarity, certain features of the present disclosure described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for the sake of brevity, various features of the present disclosure described in the context of a single embodiment may also be provided separately or in any suitable sub-combination.

[0136] Suitable compounds described herein may also include tautomeric forms. Tautomeric forms are produced by the exchange of a single bond with an adjacent double bond and the concomitant migration of a proton. Tautomeric forms include proton transfer tautomers, which are isomeric protonation states with the same empirical formula and total charge. Examples of proton transfer tautomers include, but are not limited to, keto-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, amide-imidic acid pairs, enamine-imine pairs, and cyclic forms, wherein protons may occupy two or more positions of a heterocyclic system, including but not limited to 1H- and 3H-imidazoles; 1H-, 2H- and 4H-1,2,4-triazoles; 1H- and 2H-isoindoles; and 1H- and 2H-pyrazoles. Tautomeric forms may be in equilibrium or spatially locked into one form by appropriate substitution.

[0137] The compounds described herein also include hydrates and solvates, as well as anhydrous and unsolvated forms.

[0138] The compounds described herein may also include all isotopes of atoms present in the intermediates or final compounds. Isotopes include those atoms having the same atomic number but different mass numbers. For example, isotopes of hydrogen include tritium and deuterium. Carbon ( 12 C) can be used at any location 13 C or 14 C substitution. Nitrogen ( 14 N) can be 15 N substitution. Oxygen ( 16 O) can be in any position 17 O or 18 O substitution. Sulfur ( 32 S) can be 33 S. 34 S or 36 S substitution. Chloro ( 35 Cl) can be 37 Cl replacement. Bromine ( 79 Br) can be 81 Br replacement.

[0139] In some embodiments, the compound or its salt is substantially separated. Partial separation may include, for example, a composition rich in any one or more compounds described herein. Substantially separating may include a composition containing at least about 50% by weight, at least about 60% by weight, at least about 70% by weight, at least about 80% by weight, at least about 90% by weight, at least about 95% by weight, at least about 97% by weight, or at least about 99% by weight of any one or more compounds described herein or their salts. Methods for separating compounds and their salts are conventional in the art.

[0140] While the disclosed compounds are suitable in their present form, functional groups may be incorporated into the compounds with the expectation of similar results. In particular, thioamides and thioesters are expected to have very similar properties. The distance between the aromatic rings may affect the geometric pattern of the compound and may be varied by incorporating aliphatic chains of varying lengths, which may be optionally

[0141] Substitution may comprise amino acids, dicarboxylic acids or diamines. The distance and relative orientation between monomers in the compound can also be changed by replacing amide bonds with substitutes having extra atoms. Therefore, replacing carbonyl with dicarbonyl changes the distance between monomers and the dicarbonyl unit adopts the reverse arrangement of two carbonyl moieties and changes the periodicity of the compound. Pyromellitic anhydride represents another substitute of simple amide linkages, which can change the conformation and physical properties of the compound. Modern solid phase organic chemistry methods (E.Atherton and RCSheppard, Solid Phase Peptide Synthesis APractical Approach IRL Press Oxford 1989) now allow the synthesis of uniformly dispersed compounds with molecular weights approaching 5,000 daltons. Other substitution patterns are equally effective.

[0142] The compounds described herein also include derivatives known as prodrugs, which can be prepared by modifying functional groups present in the compound in a manner that allows the modification to be cleaved into the parent compound in conventional manipulation or in vivo. Examples of prodrugs include compounds as described herein, which contain one or more molecular moieties of hydroxyl, amino, sulfhydryl or carboxyl groups attached to the compound, and cleave in vivo to form free hydroxyl, amino, sulfhydryl or carboxyl groups, respectively, when administered to a patient. Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups in the compounds described herein. The preparation and use of prodrugs are discussed in T. Higuchi et al., "Pro-drugs as Novel Delivery Systems," ACS Symposium Series No. 14 and Bioreversible Carriers in Drug Design, edited by Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incorporated herein by reference in their entirety.

[0143] Compounds containing amine functional groups can also form N-oxides. Compounds containing amine functional groups mentioned herein also include N-oxides. In the case where the compound contains several amine functional groups, one or more nitrogen atoms can be oxidized to form N-oxides. Examples of N-oxides include N-oxides of nitrogen atoms of tertiary amines or nitrogen-containing heterocycles. N-oxides can be formed by treating the corresponding amine with an oxidant such as hydrogen peroxide or a peracid (e.g., peroxycarboxylic acid) (see Advanced Organic Chemistry, Jerry March, 4th edition, Wiley Interscience).

[0144] Previous studies on CBL0137 have focused on its ability to inhibit the FACT histone chaperone complex, activate p53, and block NF-κB in tumor cells. The present disclosure describes a new function of CBL0137 on cells of the tumor mass (both tumor cells and non-malignant cells of the tumor microenvironment). This function is the induction of ZBP1-dependent necroptosis, which has not been shown or even envisioned before. As described herein, CBL0137 activates the Z-DNA sensor ZBP1 by inducing Z-DNA in cells of the tumor mass. ZBP1 activated in this way then activates necroptosis, which is an effective immunogenic form of cell death. It is this necroptosis that drives the responsiveness of immunotherapy, because eliminating necroptosis eliminates the synergy with checkpoint blockade.

[0145] The present disclosure provides compounds of formula I

[0146]

[0147] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each is independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; and n is 1, 2 or 3.

[0148] In some embodiments, R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl. In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl.

[0149] In some embodiments, R3, R4, R5, R6, R7, R8, R9 and R 10 Each is independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio. In some embodiments, R3, R4, R5, R6, R7, R8, R9, and R 10 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, and substituted or unsubstituted amine. In some embodiments, R3, R4, R5, R6, R7, R8, R9, and R 10 Each is independently selected from the group consisting of hydrogen, halogen, hydroxyl, substituted or unsubstituted alkyl, -C(=O)alkyl, and substituted or unsubstituted alkenyl. In some embodiments, both R5 and R8 are -C(=O)alkyl, such as -C(=O)methyl.

[0150] In some embodiments, n is 2 or 3.

[0151] In some embodiments, R1 and R2 are each independently selected from the group consisting of: hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl; R3, R4, R5, R6, R7, R8, R9, and R 10 Each is independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; and n is 1, 2 or 3.

[0152] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7, R8, R9 and R 10Each is independently selected from the group consisting of hydrogen, halogen, hydroxy, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, and substituted or unsubstituted amine; and n is 2 or 3.

[0153] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7, R8, R9 and R 10 Each independently selected from the following

[0154] The group consisting of: hydrogen, halogen, hydroxy, substituted or unsubstituted alkyl, -C(=O)alkyl, and substituted or unsubstituted alkenyl; and n is 2 or 3.

[0155] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each is independently selected from the group consisting of hydrogen, hydroxy, substituted or unsubstituted alkyl, and -C(=O)alkyl; and n is 2 or 3.

[0156] In some embodiments, the compound is:

[0157]

[0158] The present disclosure also provides compounds of formula II:

[0159]

[0160] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

[0161] In some embodiments, R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl. In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl.

[0162] In some embodiments, R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, -C (= O) alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio. In some embodiments, R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, -C (= O) alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy and substituted or unsubstituted amine. In some embodiments, R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, substituted or unsubstituted alkyl, -C(=O)alkyl and substituted or unsubstituted alkenyl. In some embodiments, R5 is -C(=O)alkyl, such as -C(=O)methyl.

[0163] In some embodiments, X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen. In some embodiments, X is unsubstituted carbon or substituted nitrogen.

[0164] In some embodiments, n is 2 or 3.

[0165] In some embodiments, R1 and R2 are each independently selected from the group consisting of: hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl; R3, R4, R5, R6, R7, and R8 are each independently selected from the group consisting of: hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted

[0166] substituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen.

[0167] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, and substituted or unsubstituted amine; X is unsubstituted carbon or substituted nitrogen; and n is 2 or 3.

[0168] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, substituted or unsubstituted alkyl, -C(=O)alkyl, and substituted or unsubstituted alkenyl; X is unsubstituted carbon or substituted nitrogen; and n is 2 or 3.

[0169] The present disclosure also provides compounds having Formula III:

[0170]

[0171] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

[0172] In some embodiments, R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl. In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl.

[0173] In some embodiments, R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio. In some embodiments, R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy and substituted or unsubstituted amine. In some embodiments, R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, and substituted or unsubstituted alkyl.

[0174] In some embodiments, X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen. In some embodiments, X is substituted or unsubstituted carbon.

[0175] In some embodiments, n is 2 or 3.

[0176] In some embodiments, R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl; R3, R4, R5, and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen.

[0177] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen,

[0178] wherein X is substituted or unsubstituted carbon; and n is 2 or 3.

[0179] In some embodiments, R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl and substituted or unsubstituted alkyl; X is substituted or unsubstituted carbon; and n is 2 or 3.

[0180] The present disclosure also provides a pharmaceutical composition comprising any one or more of the compounds of Formula I, Formula II and Formula III described herein or pharmaceutically acceptable salts thereof and a pharmaceutically acceptable carrier.

[0181] In any of these embodiments, the pharmaceutical composition further comprises an immune checkpoint inhibitor.

[0182] In any of these embodiments, the immune checkpoint inhibitor is selected from the group consisting of an A2AR inhibitor, a B7-H3 inhibitor, a B7-H4 inhibitor, a BTLA inhibitor, a CTLA-4 inhibitor, an IDO inhibitor, a KIR inhibitor, a LAG3 inhibitor, a NOX2 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, a TIM-3 inhibitor, a VISTA inhibitor, and a SIGLEC7 inhibitor, or any combination thereof.

[0183] In any of these embodiments, the immune checkpoint inhibitor is selected from the group consisting of a BTLA inhibitor, a CTLA-4 inhibitor, an IDO inhibitor, a KIR inhibitor, a LAG3 inhibitor, a NOX2 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, a TIM-3 inhibitor, a VISTA inhibitor, and a SIGLEC7 inhibitor, or any combination thereof.

[0184] In any of these embodiments, the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a LAG3 inhibitor, a NOX2 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, a TIM-3 inhibitor, a VISTA inhibitor, and a SIGLEC7 inhibitor, or any combination thereof.

[0185] In any of these embodiments, the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a LAG3 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, and a VISTA inhibitor, or any combination thereof.

[0186] In any of these embodiments, the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a LAG3 inhibitor, a PD-1 inhibitor, and a VISTA inhibitor, or any combination thereof.

[0187] In any of these embodiments, the immune checkpoint inhibitor is a PD-1 inhibitor selected from the group consisting of pembrolizumab, nivolumab, cemiplizumab, JTX-4014, spartalizumab, carrelizumab, sintilimab, tislelizumab, toripalizumab, dotalimumab, INCMGA00012, AMP-224, and AMP-514.

[0188] In any of these embodiments, the immune checkpoint inhibitor is a CTLA-4 inhibitor selected from the group consisting of ipilimumab and tremelimumab.

[0189] In any of these embodiments, the immune checkpoint inhibitor is a LAG3 inhibitor. In some embodiments, the checkpoint inhibitor is a VISTA inhibitor.

[0190] The pharmaceutical compositions described herein can be administered to a subject in need thereof by any route of administration, including but not limited to oral, sublingual, buccal, rectal, intranasal, inhalation, eye drops, ear drops, epidural, intracerebral, intracerebroventricular, intrathecal, epidermal or transdermal, subcutaneous, intradermal, intravenous, intraarterial, intraosseous infusion, intramuscular, intracardiac, intraperitoneal, intravesical infusion, and intravitreal. In some embodiments, administration is oral, sublingual, buccal, rectal, intranasal, inhalation, eye drops, or ear drops.

[0191] In some embodiments, the carrier is a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, but are not limited to, aqueous vehicles such as water, alcohols (e.g., ethanol or ethylene glycol), saline solutions, dextrose solutions, and balanced salt solutions, and non-aqueous vehicles such as alcohols and oils, including oils of plant or plant origin such as olive oil, cottonseed oil, corn oil, rapeseed oil, sesame oil, and other non-toxic oils. The composition may also include one or more pharmaceutically acceptable excipients.

[0192] The pharmaceutical composition may be formulated for administration to a subject in any suitable dosage form.

[0193] It can be formulated for oral, buccal, nasal, transdermal, parenteral, injection, intravenous, subcutaneous, intramuscular, rectal or vaginal administration. The composition can be formulated in a suitable controlled release vehicle with an adjuvant, or as a depot preparation.

[0194] Preparations for parenteral administration include, but are not limited to, sterile solutions ready for injection, sterile dry soluble products ready for combination with a solvent just before use (including but not limited to subcutaneous tablets), sterile suspensions ready for injection, sterile dry insoluble products ready for combination with a vehicle just before use, and sterile emulsions.

[0195] Solid dosage forms include, but are not limited to, tablets, pills, powders, bulk powders, capsules, granules and combinations thereof. Solid dosage forms can be prepared as compressed, chewable lozenges and tablets, which can be enteric coated, sugar coated or film coated. Solid dosage forms can be hard or wrapped in soft gelatin, and granules and powders can be provided in non-effervescent or effervescent forms. Solid dosage forms can be prepared for dissolving or being suspended in a liquid or semi-liquid vehicle before administration. Solid dosage forms can be prepared for immediate release, controlled release or any combination thereof. Controlled release includes, but is not limited to, delayed release, sustained release, timed pulse release and position-specific pulse release and combinations thereof.

[0196] Liquid dosage forms include, but are not limited to, aqueous solutions, emulsions, suspensions, solutions and / or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules. Aqueous solutions include, but are not limited to, elixirs and syrups. Emulsions can be oil-in-water emulsions or water-in-oil emulsions.

[0197] The pharmaceutically acceptable excipients used in solid dosage forms include, but are not limited to, coating agents, adhesives, lubricants, diluents, disintegrants, colorants, flavorings, preservatives, sweeteners and wetting agents. Enteric coated tablets resist the effects of gastric acid due to their enteric coatings and dissolve or disintegrate in neutral or alkaline intestinal tracts. Other examples of coatings include, but are not limited to, sugar coatings and polymer coatings. Sweeteners can be used to form chewable tablets and lozenges. The pharmaceutically acceptable excipients used in liquid dosage forms include, but are not limited to, solvents, suspending agents, dispersants, emulsifiers, surfactants, emollients, colorants, flavorings, preservatives and sweeteners.

[0198] Suitable examples of binders include, but are not limited to, glucose solution, acacia gum, gelatin solution, sucrose and starch paste. Suitable examples of lubricants include, but are not limited to, talc, starch,

[0199] Magnesium stearate or calcium stearate, lycopodium powder and stearic acid. Suitable examples of diluents include but are not limited to lactose, sucrose, starch, kaolin, salt, mannitol and dicalcium phosphate. Suitable examples of disintegrants include but are not limited to corn starch, potato starch, bentonite, methylcellulose, agar and carboxymethyl cellulose. Suitable examples of emulsifiers include but are not limited to gelatin, gum arabic, tragacanth, bentonite and surfactants such as polyoxyethylene sorbitan monooleate. Suitable examples of suspending agents include but are not limited to sodium carboxymethyl cellulose, pectin, tragacanth, magnesium aluminum silicate (veegum) and gum arabic.

[0200] Suitable examples of coloring agents include, but are not limited to, any water-soluble FD and C dyes approved for certification, mixtures thereof, and water-insoluble FD and D dyes suspended on alumina hydrates. Suitable examples of sweeteners include, but are not limited to, glucose, sucrose, fructose, lactose, mannitol, and artificial sweeteners such as saccharin, aspartame, sucralose, acesulfame potassium, and other artificial sweeteners. Suitable examples of flavoring agents include, but are not limited to, synthetic flavorings and natural flavorings extracted from plants such as fruits and mint, and synthetic blends of compounds that produce pleasant sensations. Suitable examples of wetting agents include, but are not limited to, propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate, and polyoxyethylene lauryl ether. Suitable examples of enteric coatings include, but are not limited to, fatty acids, fats, waxes, shellac, ammoniated shellac, and cellulose acetate phthalate. Suitable examples of film coatings include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000, and cellulose acetate phthalate. Suitable examples of preservatives include, but are not limited to, glycerin, methyl and propylparaben, ethylparaben, butylparaben, isobutylparaben, isopropylparaben, benzylparaben, citrates, benzoic acid, sodium benzoate, and alcohol.

[0201] Suitable examples of elixirs include, but are not limited to, clear, sweetened hydroalcoholic preparations. Pharmaceutically acceptable carriers used in elixirs include solvents. Suitable examples of syrups include, but are not limited to, concentrated aqueous solutions of sugars (e.g., sucrose), and may contain preservatives. Emulsions are two-phase systems in which one liquid is dispersed throughout another liquid.

[0202] The pharmaceutically acceptable carrier used in the emulsion may also include an emulsifier and a preservative. The suspension may use a pharmaceutically acceptable suspending agent and a preservative. The pharmaceutically acceptable substances used in the non-effervescent granules to be reconstituted into a liquid oral dosage form include, but are not limited to, diluents, sweeteners, and wetting agents. The pharmaceutically acceptable substances used in the effervescent granules to be reconstituted into a liquid oral dosage form include, but are not limited to, organic acids and a source of carbon dioxide. The source of carbon dioxide includes, but is not limited to, sodium bicarbonate and sodium carbonate. Colorants and flavoring agents may be used in all such dosage forms.

[0203] Additional excipients that may be included in any dosage form include, but are not limited to, antimicrobial agents, isotonic agents, buffering agents, antioxidants, local anesthetics, sequestering or chelating agents, analgesics, antiemetics, and other agents used to enhance selected properties of the formulation.

[0204] In some embodiments, the ratio of the compound of formula I to the checkpoint inhibitor in the pharmaceutical composition is about 0.01:1 to about 100:1 w / w. In some embodiments, the ratio of the compound of formula II to the checkpoint inhibitor in the pharmaceutical composition is about 0.01:1 to about 100:1 w / w. In some embodiments, the ratio of the compound of formula III to the checkpoint inhibitor in the pharmaceutical composition is about 0.01:1 to about 100:1 w / w.

[0205] The present disclosure also provides a method for treating cancer in a subject, the method comprising administering a compound of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof or a composition comprising the same and an immune checkpoint inhibitor to a subject in need. Any of the compounds of Formula I, Formula II or Formula III described herein may be used. Any of the immune checkpoint inhibitors described herein may be used. The composition for treating a subject may include: i) a combination of a compound of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor; ii) a compound of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof; or iii) an immune checkpoint inhibitor. In some embodiments, separate compositions ii) and iii) may be administered to the subject.

[0206] In any of these embodiments, the cancer is selected from the group consisting of melanoma, bladder cancer, kidney cancer, colon cancer, head and neck cancer, stomach cancer, lung cancer, and pancreatic cancer. In some embodiments, the cancer is melanoma. In some embodiments, the cancer is bladder cancer. In some embodiments, the cancer is kidney cancer. In some embodiments, the kidney cancer is renal cell carcinoma. In some embodiments, the cancer is colon cancer. In some embodiments, the colon cancer is an MSI-hi tumor. In some embodiments, the cancer is head and neck cancer. In some embodiments,

[0207] The cancer is gastric cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the pancreatic cancer is pancreatic adenocarcinoma.

[0208] In some embodiments, the compound of Formula I, Formula II, or Formula III is administered before the immune checkpoint inhibitor. In some embodiments, the compound of Formula I, Formula II, or Formula III is administered after the immune checkpoint inhibitor. In some embodiments, the compound of Formula I, Formula II, or Formula III is administered in the same composition as the immune checkpoint inhibitor.

[0209] The amount of the compound with formula I, formula II or formula III to be administered can be a therapeutically effective amount. The dosage to be administered may depend on the characteristics of the subject being treated, for example, the specific animal being treated, age, body weight, health status, the type (if any) of simultaneous treatment and the frequency of treatment, and depends on the nature and extent of the cancer, and can be easily determined by those skilled in the art (for example, clinicians). The selection of a specific dosage regimen can be selected or adjusted or titrated by a clinician according to methods known to clinicians to obtain the desired clinical response. In addition, in vitro or in vivo determinations can be optionally used to help identify the optimal dose range. The precise dosage to be used in the composition may also depend on the route of administration, and should be determined according to the judgment of the practitioner and the situation of each patient.

[0210] The composition can be prepared to provide about 0.05 mg to about 500 mg of a compound of Formula I, Formula II or Formula III, or a pharmaceutically acceptable salt thereof. In some embodiments, the composition may include about 1 mg to about 200 mg, about 10 mg to about 200 mg, about 10 mg to about 100 mg, about 50 mg to about 100 mg, about 20 mg to about 400 mg, about 100 mg to about 300 mg, or about 50 mg to about 250 mg of a compound of Formula I, Formula II or Formula III, or an isomer, tautomer or solvate thereof, or a pharmaceutically acceptable salt thereof.

[0211] Suitable dosage ranges for oral administration include, but are not limited to, about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, about 0.01 mg / kg body weight to about 70 mg / kg body weight, about 0.1 mg / kg body weight to about 50 mg / kg body weight, 0.5 mg / kg body weight to about 20 mg / kg body weight, or about 1 mg / kg body weight to about 10 mg / kg body weight. In some embodiments, the oral dosage is about 5 mg / kg body weight.

[0212] Suitable dosage ranges for intravenous administration include, but are not limited to, about 0.01 mg / kg body

[0213] The dosage may be about 500 mg / kg body weight, about 0.1 mg / kg body weight to about 100 mg / kg body weight, about 1 mg / kg body weight to about 50 mg / kg body weight, or about 10 mg / kg body weight to about 35 mg / kg body weight.

[0214] Suitable dosage ranges for other routes of administration can be calculated based on the aforementioned dosage known to those skilled in the art. For example, the recommended dose for intradermal, intramuscular, intraperitoneal, subcutaneous, epidural, sublingual, intracerebral, transdermal or inhaled is about 0.001mg / kg body weight to about 200mg / kg body weight, about 0.01mg / kg body weight to about 100mg / kg body weight, about 0.1mg / kg body weight to about 50mg / kg body weight or about 1mg / kg body weight to about 20mg / kg body weight. Effective dose can be inferred from the dose-response curve derived from in vitro or animal model test systems. Such animal models and systems are well known in the art.

[0215] In some embodiments, the amount of the compound administered to the subject is about 0.1 mg to about 500 mg, about 1 mg to about 250 mg, about 5 mg to about 400 mg, about 10 mg to about 250 mg, about 20 mg to about 200 mg, or about 40 mg to about 100 mg. In some embodiments, the amount of the compound administered to the subject is about 0.1 mg to about 500 mg. In some embodiments, the amount of the compound administered to the subject is about 1 mg to about 250 mg. In some embodiments, the amount of the compound administered to the subject is about 5 mg to about 400 mg. In some embodiments, the amount of the compound administered to the subject is about 10 mg to about 250 mg. In some embodiments, the amount of the compound administered to the subject is about 20 mg to about 200 mg. In some embodiments, the amount of the compound administered to the subject is about 40 mg to about 100 mg.

[0216] The present disclosure also provides the use of a compound having any one or more of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof, or a composition comprising a compound having any one or more of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor in the preparation of a medicament for treating a subject having cancer.

[0217] The present disclosure also provides the use of a compound having any one or more of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof, or a composition comprising any one or more of a compound having Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor for treating a subject having cancer.

[0218] The present disclosure also provides a method for identifying a compound that induces necroptosis. The method includes contacting a cell lacking adenosine deaminase RNA specific 1 (ADAR1) polypeptide with a compound. An increase in cell death indicates that the compound induces necroptosis. In some embodiments, the cell is a mouse embryonic fibroblast (MEF) from an Adar-deficient mouse. In some embodiments, the cell is an ADAR1 knockout cell, in which Adar is eliminated by CRISPR-based or similar methods. In some embodiments, the cell comprises a functional Z-form nucleic acid binding protein 1 (ZBP1) polypeptide.

[0219] The present disclosure also provides a method for identifying a compound that induces Z-DNA formation in vitro. The method comprises incorporating an internal guanosine nucleoside (m 8 In some embodiments, the oligonucleotide is an octamer.

[0220] The present disclosure also provides a method for identifying a compound that induces Z-DNA formation in a cell. The method includes contacting living cultured cells with a compound and detecting Z-DNA formation. An increase in intracellular Z-DNA formation indicates that the compound induces Z-DNA formation. In some embodiments, the cell is a cell line. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a MEF from an Adar-deficient mouse. In some embodiments, the cell is an ADAR1 knockout cell, in which Adar is eliminated by CRISPR-based or similar methods. In some embodiments, the cell comprises a functional Z-form nucleic acid binding protein 1 (ZBP1) polypeptide. An increase in cell death indicates that the compound induces ZBP1-dependent necroptosis.

[0221] In any of the embodiments described herein, the Z-DNA is detected by immunodetection such as immunoprecipitation or immunofluorescence. In some embodiments, immunodetection can be performed by antibodies that specifically bind to the Z-form of DNA. In some embodiments, by 19 F NMR or circular dichroism to detect Z-DNA.

[0222] In order to make the subject matter disclosed herein more effectively understood, examples are provided below. It should be understood that these examples are for illustrative purposes only and should not be interpreted as limiting the claimed subject matter in any way.

[0223] Example

[0224] Example 1: General Method

[0225] Mouse

[0226] Female wild-type C57BL / 6 mice aged six to eight weeks were obtained from the Jackson Laboratory. Purchased mice were acclimated to the housing conditions of the Fox Chase Cancer Center for one week prior to all experiments. All experimental mice were housed under specific pathogen-free conditions, and all in vivo experiments were performed in accordance with protocols approved by the Animal Use and Care Committee of the Fox Chase Cancer Center.

[0227] Cell lines

[0228] Primary and immortalized MEF B16-F10 (ATCC, CRL-6475), YUMMER 1.7 cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum and 1× penicillin and streptomycin. YUMMER 1.7 cells were cultured in DMEM / F12 supplemented with 10% fetal bovine serum, 1× penicillin and streptomycin, and 1× non-essential amino acids. MEFs were maintained in DMEM supplemented with 15% FBS, 1 mM sodium pyruvate, 1× GlutaMAX, and 1% penicillin / streptomycin. All cells were cultured at 37°C, 5% CO2.

[0229] Immunofluorescence microscopy

[0230] For immunofluorescence staining of cultured cells, cells were plated on 8-well slides (EMD Millipore) and allowed to adhere for at least 24 hours before use in experiments. After treatment, cells were fixed with freshly prepared 4% (w / v) paraformaldehyde, permeabilized in 0.5% (v / v) Triton X-100, and stained with MAXblock. TMThe slides were blocked with blocking medium (Active Motif) and incubated with the primary antibody overnight at 4°C. After washing three times in PBS, the slides were incubated with fluorophore-conjugated secondary antibodies for 1 hour at room temperature. After washing three more times in PBS, the slides were mounted in ProLong Gold antifade reagent (Thermo Fisher Scientific) and imaged by confocal microscopy on a Leica SP8 instrument. For immunofluorescence staining of tumor cryosections, frozen tumor sections were cut at 50 μm in a cryostat microtome. The sections were permeabilized with 0.5% (v / v) Triton X-100 in PBS and stained with MAXblock TM The slides were blocked with blocking medium (Active Motif) and incubated with the primary antibody at 4°C overnight. After washing three times in PBS, the slides were incubated with a fluorophore-conjugated secondary antibody at room temperature for 1 hour. After washing three more times in PBS, the slides were fixed in ProLong Gold antifading reagent (Thermo Fisher Scientific) and imaged by confocal microscopy on a Leica SP8 instrument. Fluorescence intensity was quantified using Leica LAS X software. When necessary, RNase A (1 mg / mL) or DNase I (25 U / mL) was used for 1 hour at 37°C before incubation with the primary antibody. The primary antibodies used for immunofluorescence studies were: Z-NA (Z22, AbsoluteAntibody), A-RNA (9D5, Millipore), phosphorylated mouse MLKL (Catalog No. 37333, Cell Signaling), FLAG (Catalog No. A00187, GenScript), lamin B1 (ab16048, Abcam), PDGFRa (Catalog No. 14-1401-82, Thermo Fisher Scientific), CD3 (eBioscience), and CD8 (ebioscience).

[0231] ADAR1 gene deletion by CRISPR / Cas9

[0232] Immortalized Zbp1 cells were stably reconstituted with FLAG-ZBP1 MEFs. - / -The cells were transiently transfected with TrueGuide synthetic sgRNA (ThermoFisher Scientific, CRISPR162007_SGM) and TrueCut Cas9 protein (ThermoFisher Scientific, A36499) against mouse Adar1 by Lipofecta mine CRISPRMAXCas9 transfection reagent (ThermoFisher Scientific, CMAX00008). Two days later, cells were harvested and ADAR1 protein levels were examined by Western blotting.

[0233] Duolink Proximity Ligation In Situ Assay

[0234] Cells were fixed with freshly prepared 4% (w / v) paraformaldehyde for 10 min, permeabilized in 0.5% (v / v) Triton X-100 for 15 min, and cultured according to the manufacturer's instructions (Sigma-Aldrich, Duolink TM Duolink in situ assays were performed using the In Situ Red Start Kit (mouse / rabbit).

[0235] RNA immunoprecipitation (RIP)-seq

[0236] Immortalized Zbp1 by wild-type Adar1 or knockout Adar1 stably reconstituted with FLAG-ZBP1 - / - MEFs were treated with / without IFNβ for 72 h and then harvested. RNA immunoprecipitation (RIP) assays were performed using the Magna RIP RNA Binding Protein Immunoprecipitation Kit (Millipore) according to the manufacturer's instructions. Briefly, cell pellets were lysed in RIP lysis buffer and then incubated overnight at 4°C with RIP buffer containing magnetic beads conjugated to Z-RNA or isotype control antibodies. Samples were then incubated with proteinase K and the immunoprecipitated RNA was recovered by phenol: chloroform: isoamyl alcohol. Paired-end RNA sequencing was performed by Novogene.

[0237] Chromatin immunoprecipitation (ChIP)-seq

[0238] Immortalized Zbp1 - / -MEFs were treated with / without CBL0137 and then harvested. ChIP was performed using the EZ-Magna ChIP HiSens Chromatin Immunoprecipitation Kit (Millipore) according to the manufacturer's instructions. In brief, cells were cross-linked by 1% formaldehyde. The nuclei were isolated by nuclear isolation buffer. The cross-linked DNA was sheared to a length of 200-500 base pairs by ultrasonic treatment. Then, the sheared DNA was immunoprecipitated overnight at 4°C using anti-Z-DNA, FLAG or isotype control antibodies. Finally, paired end 150 DNA sequencing was performed by Novogene.

[0239] Quantitative PCR

[0240] RNA from RIP was reverse transcribed into cDNA using SuperScript IV VILO master mix (Thermo Fisher Scientific). cDNA or DNA from ChIP was used as template and quantitative PCR was performed using SYBR Green (Thermo Fisher Scientific). Primers are listed below:

[0241] Eif2ak2-forward: AGCTCCAAATAACCAAGATAC (SEQ ID NO: 1);

[0242] Eif2ak2-reverse: CTCTGCTCTACACTCTATCTCC (SEQ ID NO: 2);

[0243] Ddx58-forward: GAATGCACTCTGTAGTCCAG (SEQ ID NO: 3);

[0244] Ddx58-reverse: ATAAATGAAAGTCAGCTCTCAG (SEQ ID NO: 4);

[0245] Ifih1-forward: GGAATGCCCATGAGGTATTG (SEQ ID NO: 5);

[0246] Ifih1-reverse: AGCTTGCCACATTGCATTG (SEQ ID NO: 6);

[0247] L1Md A-forward: ACATAGGGAAGCAGGCTACCC (SEQ ID NO: 7);

[0248] L1Md A-reverse: GGCAAGACTCTGCTGGCAAGG (SEQ ID NO: 8);

[0249] L1Md G-forward: AAGCACAGAGGCGCTGAGGCAG (SEQ ID NO: 9);

[0250] L1Md G-reverse: GACTAATTTCCTAAGTTCGGC (SEQ ID NO: 10).

[0251] Immunoprecipitation and immunoblotting

[0252] Immortalized Zbp1 stably reconstituted with FLAG-tagged WT or empty vector - / - MEFs were lysed in IP lysis buffer (Thermo Fisher Scientific, catalog number 87787) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific, catalog number 78444). Cell lysates were incubated on ice for 10 minutes and briefly sonicated to shear chromatin, then clarified by high-speed centrifugation (20,000 g, 10 minutes) at 4°C. After saving 5% of the total cell lysate for input, the extracts were immunoprecipitated using anti-FLAG M2 affinity gel according to the manufacturer's instructions (Sigma, catalog number FLAGIPT1). The resin was eluted with 3xFLAG peptide and the lysate was purified as previously described. 61 The supernatants were subjected to immunoblot analysis. Primary antibodies were used at the following dilutions: ADAR1 (1:1000), phosphorylated murine MLKL (1:2000), total MLKL (1:2000), RIPK3 (1:2000), FLAG (1:2000), GAPDH (1:4000).

[0253] TCGA data analysis.

[0254] RSEM normalized gene expression of melanoma (TCGA-SKCM) (PMID: 26091043) was obtained from the Broad Institute Firehose pipeline (data version 2016_01_28). The data were log2 normalized (RSEM expression value +1) and divided into 3 categories based on quartiles, where cases with expression >7th empirical quartile (Q3) were classified as high expressers, and cases with expression <25th empirical quartile (Q4) were classified as low expressers.

[0255] Cases in the test quartile (Q1) were classified as low expressers, while cases between these two ranges were classified as unchanged expression categories. The survival curves for these categories were compared with the log-rank test, and these calculations were done using the R 'survival' package (Therneau, TM and Grambsch, PM Modeling Survival Data: Extending the Cox Model (Springer-Verlag, 2010)).

[0256] Analysis of tumor infiltrating cell populations

[0257] Microenvironment Cell Population Counter Analysis (PMID: 27765066) was used to estimate tumor infiltrating populations. Log2 transformed data were used as input. Heatmaps were drawn using the pheatmap package available in Bioconductor (https: / / cran.r-project.org / web / packages / pheatmap / index.html). All calculations were done in the R programming environment.

[0258] scRNA-Seq data analysis.

[0259] scRNA-seq data from the study of Ishizuka et al. (GSE110746) were used. The data were analyzed as described in Gabitova-Cornell et al. (PMID: 32976774). In brief, the data were analyzed using the Cell Ranger analysis process (v1.2). The Seurat package (PMID: 25867923) was used for all downstream analyses and violin plots. Clusters were classified based on the study of Ishizuka et al.

[0260] Mouse melanoma model

[0261] The mice were anesthetized, the hair was shaved at the injection site, and 5 × 10 5 B16-F10 cells and 2×10 6 YUMM1.7 cells. Tumors were measured every two days, each time they were palpable with a caliper. Tumor volume was calculated using the volume formula: 0.5 × D × d 2 , where D is the longer diameter and d is the shorter diameter. When the average tumor size for B16F10 tumors is 50-100 mm 3 or 100-150 mm for YUMM1.7 tumors 3Treatment was started at 1:10 pm. 50 μl of CBL0137 or vehicle was delivered by intratumoral injection, and 200 μg of anti-PD-1 antibody (Bio X cell, clone RMP1.14) or isotype control IgG (Bio X cell, clone 2A3) was delivered by intraperitoneal injection. Treatment was performed every two days for a total of 4 doses. When the tumor reached the endpoint (tumor volume greater than or equal to 2000 mm for B16F10 3 , or for

[0262] YUMM1.7 Tumor volume greater than or equal to 1000mm 3 ) or at the time of ulceration / bleeding, mice were euthanized. Survival analysis reflected this endpoint.

[0263] statistics.

[0264] Statistical significance was determined by using an unpaired Student's t-test for comparisons between two groups or a two-way ANOVA followed by Tukey's test for comparisons between multiple (>2) groups. P values ​​of 0.05 or less were considered significant. Graphs were generated using GraphPad Prism 6.0 software.

[0265] Example 2: ADAR1 loss triggers Z-RNA accumulation

[0266] To test whether ADAR1 suppresses endogenous Z-RNA production, we eliminated Adar1 expression in immortalized wild-type (WT) mouse embryonic fibroblasts (MEFs) by CRISPR / Cas9 and confirmed that these cells lost basal expression of ADAR1 p110 and p150 isoforms, as well as type I IFN-induced expression of the ADAR1 p150 isoform (see Figure 1 , Figure a). We next cultured control ADAR1 WT and ADAR1-deficient (ADAR1 KO) MEFs for 10 days, fixed the cells in formaldehyde at regular intervals, and examined them for the presence of Z-RNA by an immunofluorescence-based assay using an antibody originally raised against Z-DNA (clone Z22), but which we and others have found to also detect Z-RNA in vitro (Hardin et al., Biochemistry, 1987, 26, 5191-5199) and in cells (Zhang et al., Cell, 2020, 180, 1115-1129e1113). Cells lacking ADAR1 exhibited a predominantly nuclear signal when stained with the Z22 antibody, which was detectable on day 4 after ADAR1 elimination and increased in intensity over 10 days. In contrast, similarly cultured control MEFs expressing wild-type ADAR1 produced no detectable signal (see Figure 1 , Figure b and Figure c and Figure 6 , panels a and b). The signal generated by the Z22 antibody in ADAR1-deficient cells was sensitive to RNase A but not to DNase 1, strongly suggesting that it arises from accumulation of endogenous Z-RNA (see Figure 1 , panels d and e). Notably, ADAR1-deficient cells also showed robust accumulation of A-RNA, with induction kinetics roughly paralleling those of Z-RNA (see Figure 1 , Figures b, c, d and e; and Figure 6 , Figures a and b). Taken together, these results suggest that ADAR1, in addition to quenching cellular A-RNA,

[0267] It also prevents the accumulation of endogenous Z-RNA.

[0268] Type I IFNs (such as IFNβ) stimulate ERE transcription and dsRNA induction in other contexts (Liu et al., Nat Med, 2019, 25, 95-102; Canadas et al., Nat Med, 2018, 24, 1143-1150; and Chuong et al., Science, 2016, 351, 1083-1087), suggesting that these cytokines may also enhance Z-RNA levels in ADAR1-deficient cells. In fact, we found that exposing ADAR1 KO MEFs to IFNβ strongly stimulated the production of Z-RNA and A-RNA within 48 hours of treatment (see Figure 1 , Figures f and g). By stably reconstructing Adar1 with a Zα domain deletion (ΔZα), - / - MEFs from ADAR1 editing null (E861A) knock-in mice (see Figure 6 , Figure c), treating these cells with IFNβ and then examining Z-RNA accumulation, we found that ADAR1 represses endogenous Z-RNA in a manner that requires both the Zα domain and editing activity (see Figure 1 , Figure h and Figure i).

[0269] To identify endogenous Z-RNAs that are inhibited by ADAR1, we used the Z22 antibody to immunoprecipitate Z-RNAs from ADAR1 WT or ADAR1 KO MEFs after IFNβ treatment and sequenced these RNAs. We then evaluated the editing in these RNA sequences by calculating their editing index (Bazak et al., Nucleic Acids Res, 2014, 42, 6876-6884), which is a robust, normalized, and quantitative measure of A→I modifications. In the absence of IFNβ treatment, Z22-associated RNAs showed an editing index of approximately 0.1% (see Figure 6 , Figure c), which occurs more frequently than other transitions or transversions (which were found to be approximately 0.06% in our dataset). Since ADAR1 p150 levels are normally very low in unstimulated MEFs, and since RNA from both ADAR1 WT and ADAR1 KO exhibited similar base editing indices (see Figure 6 , Figure c), the low basal editing level may be caused by the activity of ADAR2. However, RNA in Z22 pull-downs from IFNβ-exposed ADAR1WT MEFs showed a significantly increased editing index compared to untreated ADAR1WT cells or IFNβ-treated ADAR1KO MEFs (see Figure 6 , Figure c); this increase in editing index can therefore be attributed to IFN-induced expression of the ADAR1 p150 isoform, its binding to Z-RNAs via the Zα domain (which ADAR1 p110 and ADAR2 lack), and subsequent editing of these Z-RNAs. Most of the ADAR1-edited RNAs pulled down by the Z22 antibody were SINEs and simple repeats, and a significant portion of these were found in ISG-encoding mRNA transcripts (see Figure 6 , Figure d). There was no significant enrichment of any intronic RNA (see Figure 6 , Figure e). When we examined the locations of ADAR1 p150 editing in the mRNA sequences in the Z22 pull-down, we found that editing occurred primarily in their 3′UTRs (see Figure 6 , Figure f). Interestingly, the 3'UTRs of ISG mRNAs are disproportionately targeted for editing by ADAR1 p150. We selected three ISG mRNAs with high editing indices (Xrn1, Tapbp, Z) and found that these transcripts have inverted SINEs in their 3'UTRs, with A→G editing clustered near these SINEs (see Figure 1 , Fig. j). Each of these 3'UTRs was robustly pulled down from ADAR1 KO lysates by Z22 in an IFN-dependent manner, but not by control IgG (see Figure 1, Figure h). Therefore, 3'UTRs containing reverse SINEs represent a class of endogenous Z-RNAs inhibited by ADAR1. It is worth noting that these elements also form A-RNAs after ADAR1 loss (Ishizuka et al., Nature, 2019, 565, 43-48). Interestingly, only a small portion of Z22-enriched mRNAs have SINEs in their 3'UTRs. However, many 3'UTRs that do not contain SINEs are rich in Z-prone GT repeats (Nichols et al., Nature Communications, 2021, 12, 793). For example, ISG mRNAs encoding dsRNA sensors PKR (Eif2ak2), RIG-I (Ddx58), and MDA-5 (Ifih1) all lack reverse SINEs but contain segments rich in GT repeats. We confirmed by qRT-PCR that each of these 3'UTRs was also specifically pulled down by the Z22 antibody in the absence of ADAR1 and that IFN treatment increased the abundance of these RNAs in the Z22 pull-down (see Figure 1 , Figure 1). Inspection of these GT-rich sequences without non-SINE 3′UTRs suggests that they may be able to fold into a dumbbell shape with multiple putative 4-base-pair core Zα binding sites within the longer dsRNA duplex (see Figure 1 , Figure 1). To test whether this dumbbell-shaped sequence could readily form Z-RNA, we synthesized a consensus dumbbell containing the potential Z-forming and Zα-binding core features observed in Z22-rich 3′UTR sequences (see Figure 1 , Figure m), and examined their ability to form Z-RNA in vitro. We found that dumbbell RNA was able to form Z-RNA in vitro, but control RNA was not, although Z formation required high salt concentrations (see Figure 1 , Figure n). The high salt requirement for Z-RNA formation by in vitro synthesized Z-biased RNA is not unexpected, as additional determinants in the 3'UTR of endogenous RNAs stabilize these dumbbell-shaped structures in the Z conformation in cells. Furthermore, binding to the Zα domain stabilizes Z-biased RNA in the Z conformation, and as shown (see Figure 2 , Figure h), the 3'UTRs of Eif2ak2, Ddx58, and Ifih1 were readily pulled down by FLAG-ZBP1 from ADAR1 KOMEF (but not the Zα mutant of ZBP1). Taken together, these results demonstrate that both inverted SINEs and SINE-independent GT-rich 'fold-back' sequences within the 3'UTRs of mRNAs (particularly ISGmRNAs) form Z-RNAs in cells and are substrates for ADAR1.

[0270] Example 3: ADAR1 loss activates ZBP1-driven necroptosis

[0271] We noted that MEFs in which ADAR1 was acutely ablated by CRISPR / Cas9 began to die 7 days after ADAR1 loss, approximately 3 days after the first observation of Z-RNA accumulation (see Figure 6 , Figure a), suggesting that loss of ADAR1 induces Z-RNA-triggered ZBP1-dependent cell death. To explore this possibility, we generated immortalized Zbp1 cells stably expressing FLAG-tagged wild-type murine ZBP1 or an empty vector control. - / - MEFs, in which ADAR1 was eliminated, were observed over a 12-day period. Loss of ADAR1 in FLAG-ZBP1-reconstituted MEFs resulted in growth arrest by day 6, followed by a progressive IFN-dependent loss of viability between days 7 and 12. In contrast, Zbp1 carrying an empty vector - / - MEFs underwent growth arrest by day 7 but remained viable for the duration of the study (see Figure 2 , Figure a). Exposure of ADAR1 KO cells to recombinant IFNβ triggered ZBP1-dependent cell death within 48 h of treatment (see Figure 2 , panels b and c). Among the panel of inflammatory cytokines tested, only IFNβ and IFNγ, but not IL-1α, TNFα, or TRAIL, induced ZBP1-dependent cell death in ADAR1-deficient MEFs (see Figure 2 IFN-activated cell death was rescued by the combination of the pan-caspase blocker zVAD and the RIPK3 kinase inhibitor GSK'843 (R3i), demonstrating that death was a combination of apoptosis and necroptosis (see Figure 2 , Figure e), as we have previously shown with IAV (Zhang et al., Cell, 2020, 180, 1115-1129e1113). Cells reconstituted with a ZBP1 mutant lacking its Zα2 domain do not die from IFNβ after ADAR1 ablation, indicating that ZBP1 senses endogenous Z-RNA released by ADAR1 loss to activate cell death (see Figure 7 , Figure a). Consistently, we found that stimulation of ADAR1 KO cells with IFNβ resulted in colocalization of FLAG-ZBP1 with nuclear Z-RNA (see Figure 2 , panels f and g). Examination of ZBP1-associated RNAs from IFNβ-treated ADAR1 KO cells by RT-qPCR revealed that FLAG-ZBP1 (but not the Zα deletion mutant [FLAG-ΔZα]) bound to the 3′UTRs of all Z-RNAs identified in the Z22 pull-down (see Figure 2, Figure h and Figure 7 , Figures a, b, and c). Therefore, the Z-RNA sequence within the 3'UTR of ISG mRNA is the true ligand for ZBP1 activation in ADAR1-deficient cells (see Figure 2 , Figure h). Upon activation, ZBP1 complexes with RIPK3 and MLKL and induces phosphorylation of MLKL in IFN-treated ADAR1 KO cells (see Figure 2 , Figure i). In accordance with the role of the RIP homology interaction motif (RHIM) in ZBP1 in nucleating RIPK3, the RHIM mutant of ZBP1 failed to induce cell death (see Figure 7 , Figure d and e). Phosphorylated MLKL was first observed in the nucleus and then migrated to the cytoplasm and plasma membrane (see Figure 2 , panels j and k). Notably, MLKL activation was associated with detectable nuclear envelope disruption in approximately 30% of immortalized MEFs 48 h after IFNβ treatment (see Figure 7 , panel d). Ruptures were first observed in ADAR1 KO FLAG-ZBP1 MEFs approximately 24 h after IFNβ exposure, shortly before loss of viability (see Figure 7 , Figure e). Taken together, these findings suggest that endogenous Z-RNA associates with and activates ZBP1 in the absence of ADAR1. Thus, ZBP1-driven necroptosis is a hitherto unrecognized branch of the innate immune response to endogenous dsRNA.

[0272] Example 4: CBL0137 induces Z-DNA formation in mammalian genomic DNA

[0273] There is currently no clinically feasible small molecule strategy to block ADAR1, and Z-RNA is difficult to produce by synthetic means (Hardin et al., Biochemistry, 1987, 26, 5191-5199; and Balasubramaniyam et al., Molecules, 2018, 23, 2572-2579). However, Z-RNA has almost the same structure as Z-DNA (see Figure 3, Figure a). Like ADAR1, ZBP1 binds both Z-RNA and Z-DNA equally well in vitro (Brown et al., Proc Natl Acad. Sci. USA, 2000, 97, 13532-13536; and Kim et al., Proc. Natl. Acad. Sci. USA, 2011, 108, 6921-6926). Importantly, Z-DNA can be generated in eukaryotic cells by negative supercoiling or epigenetic modification of genomic DNA (Haniford et al., Nature, 1983, 302, 632-634; Peck et al., Proc. Natl. Acad. Sci. USA, 1982, 79, 4560-4564; and Herbert et al., J. Biol. Chem., 1996, 271, 11595-11598). Based on the reasoning that agents capable of generating Z-DNA in cells would directly activate ZBP1 without the need for synthetic Z-RNA (or Z-DNA) or ADAR1 inhibitors, we performed an elaborate screen for small molecule inducers of Z-DNA formation, focusing on compounds known to intercalate into DNA, affect DNA topology, or alter chromatin structure and dynamics. Through this screen, we identified CBL0137, a second-generation curaxin family member, as a potent inducer of Z-DNA in mammalian cells (see Figure 3 , Figure b and Figure c). CBL0137 is best characterized as an inhibitor of the histone chaperone FACT (Chang et al., J Cancer Metastasis Treat, 2019, 5), but also directly associates with DNA (Safina et al., Nucleic Acids Res, 2017, 45, 1925-1945). By immunoprecipitating and sequencing Z-DNA from CBL0137-treated MEFs, we found that CBL0137 induced Z-DNA formation in hundreds of sites in the mouse genome, most of which were localized to long interspersed nuclear elements LINE1 retroviral DNA. Specifically, compared with its frequency within the mouse genome (see Figure 3 , f, left), LINE1 elements encoding full-length L1Md A and L1Md T were highly enriched in the Z22 pull-down in CBL0137-treated cells (see Figure 3 , Figure f, right). In cells treated with CBL0137, L1Md A and L1Md T that formed Z-DNA were mainly located between genes, and ice balls were rarely observed within exons (see Figure 3 , Figure g). L1Md A and L1Md T account for less than 12% of all repetitive elements (see Figure 3, Figure f), but account for about 59% of the full-length transposons in mice (Sookdeo et al., Mob DNA, 2013, 4, 3). When examining the sequences of these two L1 elements, we noticed that their 5'UTRs contained GC-rich sequences and were predicted by our DeepZ algorithm (Beknazarov et al., Sci Rep, 2020, 10, 19134) to be prone to Z-DNA formation (see Figure 3 , Figure h). As shown (see Figure 4 , Figure j), the Z22 binding peak is also within the 5'UTR of these L1 elements, located approximately 450 bp from their 5' end, indicating that CBL0137 can trigger Z-DNA formation by inducing the B→Z conversion of Z-biased B-DNA. To directly test whether CBL0137 can convert Z-biased B-DNA to Z-DNA in vitro, we synthesized GC-rich B-DNA octamers and incorporated internal guanosine nucleosides (m 8 Gm) 2'-O-methyl-8-methyl modification. The introduction of a methyl group at the C8 position strongly promoted the B→Z transition (Bao et al., CurrProtoc, 2021, 1, e28). In the absence of CBL0137, m 8 The Gm dsDNA octamer was in the B conformation when examined by circular dichroism, but flipped to the Z conformation upon addition of an equimolar (1:1) amount of CBL0137 (see Figure 3 , Figure i). This effect was even more pronounced at a higher ratio of CBL0137 to B-DNA (2:1) (see Figure 3 , Figure i). 19 F NMR confirmed the formation of CBL0137:Z-DNA complex (see Figure 3 , Fig. j). Consistent with these observations, molecular dynamics simulations of the putative CBL0137:Z-DNA complex showed that two stacked CBL0137 molecules could be accommodated in the minor groove of Z-DNA (see Figure 3 , Figure k), indicating that CBL0137 can 'lock' dsDNA in the Z conformation after the B→Z transition.

[0274] In addition to localizing to Z-prone B-DNA sequences and flipping them to Z-DNA, CBL0137 may also induce B→Z transitions in cells by displacing FACT or other proteins from histone linker regions directly or by embedding in B-DNA, thereby leading to topological stress and Z-DNA formation. Our results support this possibility, as the DNA sequences in the Z22 pull-down are also enriched in epigenetic marks (H2A.Z) associated with FACT activity (Jeronimo et al., Mol Cell, 2015, 58, 1113-1123). Interestingly, CBL0137 induced the loss of PML bodies, which are usually associated with the inhibition of L1 elements (Denli et al., Cell, 2015, 163, 583-593) (see Figure 8 , Figure c), suggesting that Z-DNA formation may also originate from L1 transcription; these possibilities warrant further exploration.

[0275] Example 5: CBL0137 effectively triggers ZBP1-dependent necroptosis

[0276] We found that 5 μM CBL0137 induced robust ZBP1-dependent cell death in approximately 90% of MEFs within 24 h (see Figure 4 , panels a and b). CBL0137-induced cell death requires the Zα domain and RHIM of ZBP1 (see Figure 8 , Figure a), and was blocked by the combination of zVAD and the RIPK3 inhibitor GSK'872 (see Figure 4 , c), suggesting that it is a combination of apoptosis and necroptosis, similar to what we have observed in other contexts of ZBP1 activation, such as upon loss of ADAR1 (see Figure 2 , Figure e) and after IAV infection (Zhang et al., Cell, 2020, 180, 1115-1129e1113). ZBP1-induced cell death leads to MLKL phosphorylation and caspase-3 cleavage (see Figure 4 , Figure d). CBL0137 also induced ZBP1-independent caspase activity in MEFs (see Figure 4, Figure d), which manifests as apoptosis between 18 and 24 hours after treatment, which may explain its tumoricidal effect in tumor-derived cell lines, most of which are RIPK3-deficient (Somers et al., Int J Cancer, 2020, 146, 1902-1916; Gasparian et al., Science translational medicine, 2011, 3, 95ra74; Carter et al., Science translational medicine, 2015, 7, 312ra176; and Koo et al., Cell Res, 2015, 25, 707-725). CBL0137 triggers ZBP1 translocation to the nucleus (see Figure 4 , Figure e)

[0277] And it colocalized with Z-DNA in most treated cells (see Figure 4 , Figure f).

[0278] We next treated immortalized Zbp1 expressing FLAG-ZBP1 with CBL0137 - / - MEFs were cultured for 14 hours, FLAG-ZBP1 was immunoprecipitated from these cells, and the eluted DNA was subjected to ChIP-Seq. ZBP1-bound DNA was mapped to numerous sites throughout the mouse genome (see Figure 4 , Figure g, blue peak - probably not necessary). Most of the fragments bound by ZBP1 (see Figure 4 , Figure g, purple bars - probably not essential) overlap with those sites detected by ChIP-seq after CBL0137 exposure using the Z-DNA-specific Z22 antibody (see Figure 4 , Figure g, magenta peak - probably not essential). The majority (58%) of overlapping peaks bound by both Z22 and ZBP1 were full-length LINE1 elements (see Figure 4 , Figures h and i). Figure 3 , Figure h), most of these ZBP1-bound sequences were localized to the 5'UTR of the L1 Md A and Md T elements (see Figure 4 , Figure J and Figure 8 , Figure b), confirming that these sequences are prone to Z-DNA formation. We verified by RT-qPCR that both the Z22 antibody and FLAG-ZBP1 (but not the isotype control antibody (IgG) or FLAG-ΔZα) bound to the 5'UTR of the L1 Md A and Md T elements after CBL0137 treatment (see Figure 3 , Figure k). Therefore, CBL0137 triggers the association between ZBP1, RIPK3 and MLKL (see Figure 4 , Figure i), leading to the activation of MLKL, which was first observed in the nucleus (see Figure 4 , Figure m), and then observed in the cytoplasm (see Figure 4 , Figure n). ZBP1-dependent nuclear envelope disruption (see Figure 4 , Figure o) leading to nuclear necroptosis (see Figure 4 , Figure p).

[0279] Example 6: CBL0137 reverses ICB resistance by inducing ZBP1-triggered necroptosis in fibroblasts of the TME

[0280] CBL0137 induces Z-DNA formation in all mammalian cell lines tested, including human cell lines (see Fig. 9 , panels a and b), and induces robust ZBP1-dependent cell death in human cells (see Fig. 9 , Figure c), suggesting that this compound could be used as a potential ZBP1 agonist in a variety of human cancers. To apply our findings to cancer immunotherapy, we first analyzed solid tumors in The Cancer Genome Atlas (TCGA) and found that Zbp1 expression levels were highly correlated with better survival outcomes in malignant melanoma, a tumor type in which ICB shows promise but in which treatment resistance is a major problem (Refs. 50, 51) (see Figure 5 , Figure a). Complete necroptosis

[0281] Tumors with this mechanism showed significantly higher levels of infiltrating monocytes, cDCs, and CD8 + T cells, suggesting that activation of ZBP1-dependent necroptosis in tumors has the potential to trigger beneficial adaptive immune responses in melanoma (see Figure 5 , Figure b). Unfortunately, the majority (about 60%) of tumors have low expression of necroptosis genes or do not express any detectable degree of necroptosis machinery, similar to what is seen in most human tumor-derived cell lines (Koo et al., Cell Res, 2015, 25, 707-725; and He et al., Cell, 2009, 137, 1100-1111). These tumors also proportionally lack immune cells (see Figure 3 , panel b). Nevertheless, all melanomas showed significant fibroblastic infiltration (see Figure 3 , Fig. b), and analysis of scRNA-Seq data from an ICB-refractory murine melanoma (B16-F10) revealed that tumor-infiltrating fibroblasts express necroptotic machinery (see Figure 5, Figure c). These observations allowed us to hypothesize that inducing necroptosis by triggering ZBP1 activation in TME stromal cells, such as cancer-associated fibroblasts, would induce an effective antitumor response and enhance ICB therapy. Moreover, this novel approach would have important clinical implications as it would not require cancer cells to be necroptotic. To test this hypothesis, we generated B16-F10 melanoma xenografts in wild-type C57Bl / 6 mice and injected CBL0137 into these xenografts. We then assessed Z-DNA formation 16 h after injection and necroptosis activation 24 h after injection. We found that CBL0137 induced substantial Z-DNA formation in cells surrounding the injection site, including fibroblasts of the TME, as determined by co-staining of tumor sections for Z-DNA and the fibroblast marker PDGFRα (see Figure 3). Figure 5 Quantification of these results showed that CBL0137 induced Z-DNA formation in >60% of TME fibroblasts without altering the number of these cells (see Figure 5 , Figure e). pMLKL is directed against wild-type or Zbp1 - / - Staining of sections of CBL0137-treated B16-F10 tumors generated in mice showed that CBL0137 activated necroptosis in the majority (approximately 70%) of TME fibroblasts. Importantly, necroptosis was dependent on host expression of ZBP1.

[0282] To examine whether CBL0137-induced necroptosis in TME fibroblasts could reverse ICB anergy in a mouse model, we performed 3-fold reverse transcriptase inhibitory cell death in wild-type or Zbp1 - / - We then treated the mice with four cycles of CBL0137 or vehicle control (intralesional) combined with anti-PD-1 antibody or isotype control antibody (systemic,

[0283] These mice were treated with a combination of Figure 5 We found that the combination of CBL0137 and anti-PD-1 antibody (but not either agent alone) induced CD3 + CD8 + T cells are recruited to the tumor (see Figure 3 , Figures j and k). T cell influx into tumors was observed only in wild-type animals but not in Zbp1 - / - This was not observed in mice (see Figure 3, Figures j and k), demonstrating that ZBP1-dependent necroptosis is responsible for their recruitment. Consistent with these observations, anti-PD-1 antibodies were able to induce significant regression of B16-F10 tumors when combined with CBL0137, but only in wild-type mice, whereas in Zbp1 - / - In mice, it is not induced (see Figure 5 , Figure i). We next tested the effect of CBL0137 on the anti-PD-1 anti-tumor response on YUMM 1.7 xenografts. This model is considered more clinically relevant than the B16-F10 model because YUMM 1.7 cells are obtained from UV-induced mouse melanomas and because they partially respond to anti-PD-1 monotherapy (Wang et al., Pigment Cell Melanoma Res, 2017, 30, 428-435), similar to human melanoma (Weiss et al., Clin Cancer Res, 2019, 25, 5191-5201; and Ribas et al., Science, 2018, 359, 1350-1355). In these xenografts, we found that anti-PD-1 antibody treatment itself was able to induce regression of a considerable portion (4 / 9) of tumors (see Figure 5 , Figure m). Although CBL0137 alone resulted in slower tumor growth compared with vehicle control, the combination of CBL0137 with anti-PD-1 antibody induced complete or near-complete tumor regression in all (9 / 9) treated mice. Together, these encouraging results demonstrate that CBL0137 drives CD8 + T cells are recruited into tumors and strongly enhance ICB responses in vivo.

[0284] Example 7: Discussion

[0285] ADAR1 has been shown to negatively regulate type I interferon response by editing A-RNA in ERE and inhibiting further activation of MDA-5 and PKR. We now prove that ADAR1 also inhibits Z-RNA formation and ZBP1-dependent necroptosis by preventing the accumulation of mRNA transcripts forming Z-RNA. Such Z-forming sequences are enriched in the 3′UTR of ISG mRNA containing reverse SINE or GT-rich segments that can fold into Z-prone dumbbells. This work expands the range of sequences known to form Z-DNA and Z-RNA in cells (we call it 'flipons') (Herbert et al., R Soc Open Sci, 2020, 7, 200222).

[0286] There are currently no clinically feasible ADAR1 inhibitors or ZBP1 agonists. We report here a small molecule approach that bypasses the need for ADAR1 inhibition and directly activates ZBP1 by forcing endogenous flipping to form Z-DNA. By doing so, we induce a robust anti-tumor response that overcomes ICB anergy. The strategy uses drug CBL0137 to drive Z-DNA formation in vivo. DNA weaponized in this way bypasses ADAR1-dependent immune silencing in tumor cells to activate ZBP1-dependent 'nuclear necroptosis' in tumor matrix fibroblasts. We have previously demonstrated (Zhang et al., Cell, 2020, 180, 1115-1129e1113) that this nuclear necroptosis has significantly higher immunogenicity than conventional (i.e., cytoplasm-induced) necroptosis because it causes a large amount of DAMPs (such as HMGB-1, IL-33, and in fact DNA itself) to be released from the nucleus. CBL0137 was able to reverse ICB nonresponsiveness in a refractory model of malignant melanoma as well as in a clinically relevant model of this malignancy. Both results demonstrate the potential of CBL0137 to synergize with ICB therapy. Importantly, CBL0137 exhibited these effects by activating ZBP1 in fibroblasts of the TME but not in tumor cells themselves, suggesting that it would have therapeutic benefit even when cancer cells are not necroptotic. Previous studies examining loss of ADAR1 (Ishizuka et al., Nature, 2019, 565, 43-48; and Chung et al., Cell, 2018, 172, 811-824e814) may have failed to identify ZBP1-driven necroptosis as part of the immunogenic arsenal released by ERE activation because many tumor-derived cell lines, including those used in those studies, do not express RIPK3 (Geserick et al., Cell Death Dis, 2015, 6, e1884; and Morgan et al., BMB reports, 2015, 48, 303-312).

[0287] It is worth noting that CBL0137 has been used in human Phase 1b clinical trials without significant systemic toxicity, which may be because the basic ZBP1 levels in many normal cell types are low or absent (references). However, ZBP1 expression is strongly induced by IFN, and the TME of many tumors often shows chronic IFN characteristics (Nirschl et al., Cell, 2017, 170, 127-141e115; and Benci et al., Cell, 2016, 167, 1540-1554e1512). The tumor-specific production of IFN can selectively induce ZBP1 expression in cells of the TME, providing an unexpected therapeutic window for intralesional and systemic administration of CBL0137 in clinical settings. Since genes encoding MLKL, MDA-5, and PKR are also IFN-inducible, elevated tonic IFN signaling in the TME may actually represent a potential vulnerability that can be exploited not only by CBL0137, but also by future ADAR1 inhibitors (which would increase the immunostimulatory responses elicited by A- and Z-form dsRNAs) and ZBP1-activating viruses, such as the HSV-1-based oncolytic talimogene laherparepvec (T-vec) (Liu et al., Nat Med, 2019, 25, 95-102; Guo et al., Cell Death Dis, 2018, 9, 816; and Ribas et al., Cell, 2017, 170, 1109-1119.e1110).

[0288] In addition to those modifications described herein, various modifications of the described subject matter will also be apparent to those skilled in the art from the above description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in this application (including but not limited to magazine articles, U.S. patents and non-U.S. patents, patent application publications, international patent application publications, gene bank accession numbers, etc.) is incorporated herein by reference in its entirety.

Claims

1. A method of treating cancer in a subject, the method comprising administering to the subject in need thereof a compound of any one of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof and a checkpoint inhibitor, wherein: The compound of formula I comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and n is 1, 2, or 3; The compound of formula II comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3; and The compound of formula III comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

2. The method of claim 1, wherein the compound has Formula I: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and n is 1, 2, or 3.

3. The method of claim 2, wherein R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl.

4. The method of claim 2, wherein R1 and R2 are each independently hydrogen or a substituted or unsubstituted alkyl group.

5. The method of any one of claims 2 to 4, wherein R3, R4, R5, R6, R7, R8, R9 and R 10 Each is independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio.

6. The method of any one of claims 2 to 4, wherein R3, R4, R5, R6, R7, R8, R9 and R 10 Each is independently selected from the group consisting of hydrogen, halogen, hydroxy, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, and substituted or unsubstituted amine.

7. The method of any one of claims 2 to 4, wherein R3, R4, R5, R6, R7, R8, R9 and R 10 Each is independently selected from the group consisting of hydrogen, halogen, hydroxy, substituted or unsubstituted alkyl, -C(=O)alkyl, and substituted or unsubstituted alkenyl.

8. The method of any one of claims 2 to 7, wherein n is 2 or 3.

9. The method of claim 2, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl; R3, R4, R5, R6, R7, R8, R9 and R 10 each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and n is 1, 2, or 3.

10. The method of claim 2, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7, R8, R9 and R 10 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, and substituted or unsubstituted amine; and n is 2 or 3.

11. The method of claim 2, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7, R8, R9 and R 10 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, substituted or unsubstituted alkyl, -C(=O)alkyl, and substituted or unsubstituted alkenyl; and n is 2 or 3.

12. The method of claim 2, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7, R8, R9 and R 10 are each independently selected from the group consisting of hydrogen, hydroxy, substituted or unsubstituted alkyl, and -C(=O)alkyl; and n is 2 or 3.

13. The method of any one of claims 3 to 12, wherein the compound is:

14. The method of claim 1, wherein the compound has Formula II: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

15. The method of claim 14, wherein R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl.

16. The method of claim 14, wherein R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl.

17. The method of any one of claims 14 to 16, wherein R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio.

18. The method of any one of claims 14 to 16, wherein R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy and substituted or unsubstituted amine.

19. The method of any one of claims 14 to 16, wherein R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, substituted or unsubstituted alkyl, -C(=O)alkyl and substituted or unsubstituted alkenyl.

20. The method of any one of claims 14 to 19, wherein X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen.

21. The method of any one of claims 14 to 19, wherein X is unsubstituted carbon or substituted nitrogen.

22. The method of any one of claims 14 to 21, wherein n is 2 or 3.

23. The method of claim 14, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; and X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen.

24. The method of claim 14, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy and substituted or unsubstituted amine; X is unsubstituted carbon or substituted nitrogen; and n is 2 or 3.

25. The method of claim 14, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, substituted or unsubstituted alkyl, -C(=O)alkyl and substituted or unsubstituted alkenyl; X is unsubstituted carbon or substituted nitrogen; and n is 2 or 3.

26. The method of claim 1, wherein the compound has Formula III: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

27. The method of claim 26, wherein R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl.

28. The method of claim 26, wherein R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl.

29. The method of any one of claims 26 to 28, wherein R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio.

30. The method of any one of claims 26 to 28, wherein R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy and substituted or unsubstituted amine.

31. The method of any one of claims 26 to 28, wherein R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl and substituted or unsubstituted alkyl.

32. The method of any one of claims 26 to 31, wherein X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen.

33. The method of any one of claims 26 to 31, wherein X is substituted or unsubstituted carbon.

34. The method of any one of claims 26 to 33, wherein n is 2 or 3.

35. The method of claim 26, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, and substituted or unsubstituted aryl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and X is substituted or unsubstituted carbon, or substituted or unsubstituted nitrogen.

36. The method of claim 26, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy and substituted or unsubstituted amine; X is substituted or unsubstituted carbon; and n is 2 or 3.

37. The method of claim 26, wherein: R1 and R2 are each independently hydrogen or substituted or unsubstituted alkyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl and substituted or unsubstituted alkyl; X is substituted or unsubstituted carbon; and n is 2 or 3.

38. The method of any one of claims 1 to 37, wherein the checkpoint inhibitor is selected from the group consisting of: an A2AR inhibitor, a B7-H3 inhibitor, a B7-H4 inhibitor, a BTLA inhibitor, a CTLA-4 inhibitor, an IDO inhibitor, a KIR inhibitor, a LAG3 inhibitor, a NOX2 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, a TIM-3 inhibitor, a VISTA inhibitor, and a SIGLEC7 inhibitor, or any thereof combination.

39. The method of claim 38, wherein the checkpoint inhibitor is selected from the group consisting of a BTLA inhibitor, a CTLA-4 inhibitor, an IDO inhibitor, a KIR inhibitor, a LAG3 inhibitor, a NOX2 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, a TIM-3 inhibitor, a VISTA inhibitor, and a SIGLEC7 inhibitor, or any combination thereof.

40. The method of claim 38, wherein the checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a LAG3 inhibitor, a NOX2 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, a TIM-3 inhibitor, a VISTA inhibitor, and a SIGLEC7 inhibitor, or any combination thereof.

41. The method of claim 38, wherein the checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a LAG3 inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, and a VISTA inhibitor, or any combination thereof.

42. The method of claim 38, wherein the checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a LAG3 inhibitor, a PD-1 inhibitor, and a VISTA inhibitor, or any combination thereof.

43. The method of any one of claims 38 to 42, wherein the checkpoint inhibitor is a PD-1 inhibitor selected from the group consisting of pembrolizumab, nivolumab, cemiplizumab, JTX-4014, spartalizumab, carrelizumab, sintilimab, tislelizumab, toripalizumab, dotalimumab, INCMGA00012, AMP-224, and AMP-514.

44. The method of any one of claims 38 to 42, wherein the checkpoint inhibitor is a CTLA-4 inhibitor selected from the group consisting of ipilimumab and tremelimumab.

45. The method of any one of claims 38 to 42, wherein the checkpoint inhibitor is a LAG3 inhibitor.

46. ​​The method of any one of claims 38 to 42, wherein the checkpoint inhibitor is a VISTA inhibitor.

47. The method of any one of claims 1 to 46, wherein the cancer is selected from the group consisting of melanoma, bladder cancer, kidney cancer, colon cancer, head and neck cancer, stomach cancer, lung cancer, and pancreatic cancer.

48. The method of any one of claims 1 to 47, wherein the compound of Formula I, Formula II, or Formula III is administered prior to the check point inhibitor.

49. The method of any one of claims 1 to 47, wherein the compound of Formula I, Formula II, or Formula III is administered after the check point inhibitor.

50. The method of any one of claims 1 to 47, wherein the compound of Formula I, Formula II, or Formula III is administered in the same composition as the check point inhibitor.

51. Use of a compound of any one of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof and a checkpoint inhibitor in the manufacture of a medicament for treating cancer, wherein: The compound of formula I comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and n is 1, 2, or 3; The compound of formula II comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3; and The compound of formula III comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

52. Use of a compound of any one of Formula I, Formula II or Formula III or a pharmaceutically acceptable salt thereof and a checkpoint inhibitor for treating cancer, wherein: The compound of formula I comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7, R8, R9 and R 10 each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy, and substituted or unsubstituted alkylthio; and n is 1, 2, or 3; The compound of formula II comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5, R6, R7 and R8 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, -C(=O)alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3; and The compound of formula III comprises: or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are each independently selected from the group consisting of hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted sulfonyl; R3, R4, R5 and R6 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, cyano, nitro, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkoxy, substituted or unsubstituted amine, substituted or unsubstituted alkylamino, substituted or unsubstituted aminoalkoxy and substituted or unsubstituted alkylthio; X is substituted or unsubstituted carbon, substituted or unsubstituted nitrogen, or oxygen; and n is 1, 2, or 3.

53. A method of identifying a compound that induces necroptosis, the method comprising contacting a cell lacking an adenosine deaminase RNA-specific 1 (ADAR1) polypeptide with the compound, wherein an increase in cell death indicates that the compound induces necroptosis.

54. The method of claim 53, wherein the cells are murine embryonic fibroblasts (MEFs).

55. The method of claim 53 or claim 54, wherein the cell is an ADAR1 knockout cell.

56. The method of any one of claims 53 to 55, wherein the cell comprises a functional Z-form nucleic acid binding protein 1 (ZBP1) polypeptide.

57. A method for identifying a compound that induces Z-DNA formation in vitro, the method comprising incorporating an internal guanosine nucleoside (m 8 Gm) is contacted with the compound, wherein an increase in Z-DNA formation indicates that the compound induces Z-DNA formation.

58. The method of claim 575, wherein the oligonucleotide is an octamer.

59. A method of identifying a compound that induces Z-DNA formation in a cell, the method comprising contacting a living cultured cell with the compound, wherein an increase in Z-DNA formation in the cell indicates that the compound induces Z-DNA formation.

60. The method of claim 59, wherein the Z-DNA is detected by immunoprecipitation or immunofluorescence.

61. The method of claim 59, wherein 19 F NMR or circular dichroism to detect Z-DNA.

62. The method of any one of claims 59 to 61, wherein the cells comprise a functional Z-form nucleic acid binding protein 1 (ZBP1) polypeptide, and wherein an increase in cell death indicates that the compound induces ZBP1-dependent necroptosis.

Images