Method for improving secretion of antibacterial peptide by bombyx mori and application thereof

Abstract

The application discloses a method for improving secretion of antibacterial peptide of Bombyx mori and application thereof, and first proposes application of genes as a regulation target or a regulation marker in improving secretion of antibacterial peptide Gloverin of Bombyx mori, and the application can effectively improve expression of antibacterial peptide Gloverin of Bombyx mori and prolong death time of Bombyx mori infected with nucleopolyhedrovirus by injecting RNAi interference fragments of 7 genes into first-day fifth-instar larvae of Bombyx mori after 6 hours, which provides a new thought for improving expression of antibacterial peptide by taking the like as a molecular target, is favorable for in-depth understanding of a mechanism of Bombyx mori against pathogenic agents, provides a reference for research on Bombyx mori against viruses, and provides a valuable reference for in-depth research on the role of 7 in immune response of Bombyx mori.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for increasing the secretion of antimicrobial peptides in silkworms and its application. Background Technology

[0002] The silkworm, belonging to the order Lepidoptera, is an insect of significant economic importance and plays a vital role in agricultural economic development, especially for the silk industry, where it has extremely high economic value. However, frequent silkworm diseases cause serious economic losses to the sericulture industry, making silkworm disease prevention and control a crucial aspect of sericulture production.

[0003] Antimicrobial peptides (AMPs) are a class of small, immunomodulatory polypeptides widely distributed in organisms, capable of defending against invading bacteria, fungi, viruses, or parasites. They play a crucial defensive role in insect immunity. When pathogens or parasites breach the insect's first line of defense, certain tissues or cells synthesize AMPs through a humoral immune response, which are then rapidly secreted and released into the bloodstream, exerting a broad-spectrum killing effect on the invading pathogens. Therefore, effectively increasing the expression level of AMPs in silkworms plays a vital role in pathogen control. Gloverin is an inducible antimicrobial insect protein that inhibits the synthesis of important outer membrane proteins, thereby forming a permeable outer membrane. Antimicrobial peptides Gloverins exhibit antimicrobial activity against various types of microorganisms (including Escherichia coli, Gram-positive bacteria, fungi, and viruses), and are expressed from eggs to adults. Attactin primarily exhibits antimicrobial activity against Gram-negative bacteria.

[0004] most It can induce the upregulation of antimicrobial peptide expression. Simultaneously, overexpression... It can significantly improve the expression level of antimicrobial peptides, but using RNAi technology to target key peptides... Methods for inducing high AMP secretion rates in silkworms by knocking down AMP levels are currently rarely reported. Furthermore, there are few reports on methods for controlling AMP secretion in silkworms. 7. No research has been reported on the induction of antimicrobial peptides. Summary of the Invention

[0005] Purpose of the invention: To address the problems existing in the prior art, this invention provides a new method for enhancing the secretion of antimicrobial peptides in silkworms and its applications. This invention is the first to discover... The application of 7 genes as regulatory targets in enhancing the secretion of antimicrobial peptides in silkworms after viral infection. This invention utilizes target genes... Interference or effective knockdown can significantly increase the expression of antimicrobial peptides Attactin and Gloverin in silkworms, and significantly prolong the death time of silkworms infected with nucleopolyhedrovirus.

[0006] Technical solution: In order to achieve the above objectives, the present invention... The application of 7 genes as regulatory targets or regulatory markers in enhancing the secretion of the antimicrobial peptide Gloverin in silkworms. The sequences of the 7 genes are shown in SEQ ID NO.1.

[0007] The application mentioned here is to enhance the expression of the antimicrobial peptide Gloverin in silkworms.

[0008] Among them, the 7. Genes include gene sequences that are more than 90% homologous to their DNA sequences and have the same function.

[0009] This invention 7 genes or targeted The application of inhibitors or interferons of the 7 gene-encoded protein in enhancing the secretion of the antimicrobial peptide Gloverin in silkworms.

[0010] The inhibitor or interferon is used to increase the expression of the antimicrobial peptide Gloverin in silkworms.

[0011] Wherein, the inhibitor or interferon includes specific knockout. Gene editing reagents for 7 genes, specific interference 7. Interfering molecules and specific inhibitors of gene expression 7. Small molecule compounds that express proteins specific to genes, or those that are specific to them. 7. Gene-expressed protein / bound antibody or ligand.

[0012] Preferably, the interfering agent is dsRNA, the sequence of which is shown in SEQ ID NO.2.

[0013] The interfering agent is dsRNA, which includes interfering primers with the sequences: TAATACGACTCACTATAGGGATTGGGTCGGTTCAGTTCAG and TAATACGACTCACTATAGGGTACGGAAGCTGTGTCGAGTG.

[0014] The method for increasing the secretion of antimicrobial peptides in silkworms as described in this invention involves improving the secretion of antimicrobial peptides within the silkworm host. Knockdown increased the expression of the antimicrobial peptide Gloverin in silkworms.

[0015] Among them, injecting into the host body 7 genes dsRNA, then BmNPV is infected, inducing a large amount of secretion of the antimicrobial peptide Gloverin.

[0016] The method for increasing the secretion of the antimicrobial peptide Gloverin in silkworms, as described in this invention, is applied to prolonging the death time of silkworms infected with nucleopolyhedrovirus.

[0017] Furthermore, the present invention described The application of 7 genes as regulatory targets or regulatory markers in enhancing the secretion of the antimicrobial peptide Attactin in silkworms. The sequences of the 7 genes are shown in SEQ ID NO.1.

[0018] The application mentioned here is to increase the expression of the antimicrobial peptide Attactin in silkworms.

[0019] Among them, the 7. Genes include gene sequences that are more than 90% homologous to their DNA sequences and have the same function.

[0020] This invention 7 genes or targeted The application of inhibitors or interferons of gene-encoded proteins in enhancing the secretion of the antimicrobial peptide Attactin in silkworms.

[0021] The inhibitor or interferon is used to increase the expression of the antimicrobial peptide Attactin in silkworms.

[0022] Wherein, the inhibitor or interferon includes specific knockout. Gene editing reagents for 7 genes, specific interference 7. Interfering molecules and specific inhibitors of gene expression 7. Small molecule compounds that express proteins specific to genes, or those that are specific to them. 7. Gene-expressed protein / bound antibody or ligand.

[0023] Preferably, the interfering agent is dsRNA, the sequence of which is shown in SEQ ID NO.2.

[0024] The interfering agent is dsRNA, which includes interfering primers with the sequences: TAATACGACTCACTATAGGGATTGGGTCGGTTCAGTTCAG and TAATACGACTCACTATAGGGTACGGAAGCTGTGTCGAGTG.

[0025] The method for increasing the secretion of antimicrobial peptides in silkworms as described in this invention involves using the silkworm host... After knockdown, the expression of the antimicrobial peptide Attactin in silkworms was increased.

[0026] Among them, injecting into the host body The dsRNA of the 7 genes was then used to infect silkworms with nucleopolyhedrovirus, inducing the secretion of large amounts of the antimicrobial peptide Attactin.

[0027] The method for increasing the secretion of the antimicrobial peptide Attactin by silkworms, as described in this invention, is applied to prolonging the death time of silkworms infected with nucleopolyhedrovirus.

[0028] The existing technology does not disclose the silkworm. 7. Related reports on the induction of antimicrobial peptide expression. This invention is the first to utilize RNAi technology to induce the expression of antimicrobial peptides in silkworms. 7. Knockdown induced a large expression of AMPs in silkworms, especially Attactin and Gloverin. Simultaneously, it interfered with the expression of AMPs in silkworms. Gene expression significantly prolongs the mortality time of silkworms infected with nucleopolyhedrovirus.

[0029] This invention provides A new application for 7 is the use of RNAi technology to target genes. 7. Effective knockdown: dsRNA is injected into the first day of the fifth instar silkworm, and 6 hours later, the silkworm is infected with silkworm nucleopolyhedrovirus. After 24 hours, AMPs secretion can be significantly induced. This method is simple and easy to operate, low in cost, and significantly improves efficiency.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0031] This invention is the first to discover interference or knockout. The present invention utilizes 7 genes as regulatory targets or regulatory markers to enhance the secretion of antimicrobial peptides Attactin and Gloverin in silkworms. Interference or effective knockdown can significantly increase the expression of antimicrobial peptides Attactin and Gloverin in silkworms, and significantly prolong the death time of silkworms infected with nucleopolyhedrovirus.

[0032] This invention is the first to discover a A new use for 7 genes: using RNAi technology to target genes 7. Effective knockdown: Six hours after injection into fifth-instar silkworms, continued infection with silkworm nucleopolyhedrovirus (AMPV) significantly increased AMP secretion rate after 24 hours. This method is simple, easy to perform, low-cost, and significantly improves efficiency. This invention effectively enhances AMP secretion efficiency in silkworms, providing a new approach to increasing protein expression through RNAi interference. It also contributes to a deeper understanding of the silkworm's antiviral mechanisms and provides a reference for silkworm antiviral research. 7. The role of silkworm immune response provides valuable insights. Attached Figure Description

[0033] Figure 1 To utilize the dsRNA described in this invention to inject fifth-instar silkworms, collect silkworm blood, extract RNA, and perform RT-qPCR to test interference efficiency: (A) In vitro synthesis of targeted... dsRNA of type 7 (ds-BmSpz7) and the control group ds-egfp were injected into first-day fifth-instar silkworm larvae. Serum samples were collected 4 hours later, and RNA was extracted for RT-qPCR to verify the interference efficiency. (B) Interference 7.6 hours after injection, silkworm nucleopolyhedrovirus was administered. Serum samples were collected 24 hours later, and RNA was extracted. AMP expression levels were analyzed by RT-qPCR and statistical analysis was performed. When RNAi technology was used to knock down... The expression of 7 and the significant increase in AMP secretion rate 24 h after BmNPV infection indicate interference. The secretion rate of AMPs increased significantly after 7 days.

[0034] Figure 2 To utilize the ds-BmSpz7 injection method described in this invention for fifth-instar silkworms, 10 μl of Ds-BmSpz7 (1 μg / μl) was injected into 50 fifth-instar silkworm larvae on day 1 using a microsyringe, with 10 μl injected per larva. The control group was injected with ds-egfp (10 μl, 1 μg / μl). Six hours later, silkworm nucleopolyhedrovirus (2.3 × 10⁷ TCID₅₀ / mL 10 μl) was injected into each larva. Fresh mulberry leaves, sprayed with a penicillin-streptomycin antibiotic dilution (1:100) and dried, were added to the feed daily. After 4 days, silkworm disease began to appear, and mortality was counted. The survival rate of silkworms after dsRNA interference was compared. The results showed that compared with the control group (ds-egfp), Knockdown significantly delayed the death time of silkworms infected with nucleopolyhedrovirus (8 hours). Detailed Implementation

[0035] The present invention will be further illustrated below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention. Those skilled in the art will understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention. The scope of the invention is defined by the claims and their equivalents.

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent companies.

[0037] Example 1: Based on the NCBI sequence (GeneID: 101738945), a pair of ds-BmSpz7 interference primers (ds-BmSpz7 F and ds-BmSpz7 R in Table 1) were designed. Using cDNA extracted from silkworm ovary cells (preserved by the College of Biotechnology, Jiangsu University of Science and Technology) as a template, double-stranded dsRNA was synthesized to knock down the silkworm. 7. Expression of the gene; at the same time, ds-egfp interference primers (ds-egfp F and ds-egfp R in Table 1) were designed to express the egfp gene in plasmid pIZ / V5-eGFP-TMD (preserved and provided by the School of Biotechnology, Jiangsu University of Science and Technology, Hao B, Liu L, Liu N, Sun L, Fan F, Huang J. The Bombyx mori Nucleopolyhedrovirus GP64 Retains the Transmembrane Helix of Signal Peptide to Contribute to Secretion across the Cytomembrane. Microbiol Spectr. 2022 Aug31; 10(4):e0191322.doi:10.1128 / spectrum.01913-22.Epub 2022 Aug 8. PMID:35938817; PMCID:PMC9430547.) were used as templates to synthesize double-stranded dsRNA as controls.

[0038] At the same time, a detection system was designed. 7. Knockdown expression efficiency qPCR primers (BmSpz7QF and BmSpz7 QR in Table 1) and internal control primers (GAPDH QF and GAPDH QR).

[0039] To detect changes in AMP expression levels in silkworm cells, three AMP qPCR primers were designed: primers for detecting the expression of the antimicrobial peptide attacin (BmAttacin QF and BmAttacin QR in Table 1), primers for Gloverin (BmGloverin QF and BmGloverin QR in Table 1), and primers for Moricin (BmMoricin QF and BmMoricin QR in Table 1).

[0040] Table 1. Target gene sequences for RNAi and qPCR primer sequences

[0041]

[0042] dsRNA was synthesized using the T7 RNAi in vitro transcription kit (Takara, Nanjing), yielding a 495bp dsRNA for subsequent interference experiments.

[0043] Specific synthesis process:

[0044] (1) dsRNA primer synthesis

[0045] The primer sequences designed in Table 1 were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis and later use.

[0046] (2) Preparation of double-stranded dsRNA

[0047] First, the synthesized ds-BmSpz7 F and ds-BmSpz7 R primers were dissolved in sterile ddH2O and then prepared into a 100 pmol / μL solution.

[0048] Next, the Oligo DNA annealing reaction solution was prepared. The specific configuration of the system used was as follows:

[0049]

[0050] Reaction conditions: Denaturation: 98℃, 10 sec; Annealing: 62℃, 15 sec; Extension: 72℃, 10 sec.

[0051] (3) In vitro transcription reaction

[0052] The reaction solution for in vitro RNA transcription is prepared as follows:

[0053]

[0054] After ensuring the above solution is thoroughly mixed, centrifuge gently, then collect the transcription reaction solution at the bottom of the reaction tube and place it in a 42°C constant temperature water bath for 4 hours to ensure the reaction is complete.

[0055] (4) Nuclease treatment

[0056] During the experiment, the RNase T1 provided in the kit (original concentration 100 U / μL) needs to be diluted to the target concentration of 4 U / μL using RNase T1 Dilution Buffer. After the in vitro transcription reaction is complete, precisely add 1 μL of 4 U / μL RNase T1 solution to the reaction tube, and simultaneously add 5 U / μL of RNase-free DNase I. After ensuring that the mixture is fully homogeneous, place the system in a water bath at 37°C for 2 hours for reaction treatment.

[0057] (5) Purification of dsRNA

[0058] Add an equal volume of water-saturated acidic phenol / chloroform / isoamyl alcohol mixture (ratio 25:24:1) to the above reaction solution, mix thoroughly, and centrifuge at 10,000 rpm for 5 min at room temperature. Transfer the supernatant to a new EP tube, add the same volume of 5M ammonium acetate (pH 5.6) and four times the volume of 99.5% ethanol, and centrifuge at 15,000 rpm for 5 min at 25°C. Remove the supernatant, place the EP tube in a ventilated place to dry, and add 20 μL of RNase ddH2O to the tube to dissolve the precipitate.

[0059] (6) Take 1 μL of the synthesized dsRNA (ds-BmSpz7) and measure its concentration using a NanoDrop micro spectrophotometer.

[0060] The synthesized dsRNA (ds-BmSpz7) sequence is as follows:

[0061] ATTGGGTCGGTTCAGTTCAGTGTCGGCAATACAATTTCGAACAACAAT

[0062] TCACTTATAGTCGAAATGCCACCGGGATGCAGAGGCGAAAAGATGTGTTT

[0063] TGAAAAATCTAAGGACTATCCAACCGATAAAATCAATAGCCTATTAAATA

[0064] GCACGGGTTGGGGAATAGCCGACGCGATCAGGGTGGTCGGTCATCGACA

[0065] AGGTAGCTTCGTAGAAATCTGCAAATCTAAGATACTGCCACCTACACAGG

[0066] TGTACGAAATTGAAGACGAGAACGGCATCATTCGGTTCGTTGTTCAAGAT

[0067] GAGAAGTTTAAGCAAATCGTGAACGTCATTAAGTGCAGTGACGAAGGGA

[0068] ACATCACGAGGTCGTCTGATATATACGAAAGATCTTATTTCGCTTACGGA

[0069] GCATTGATAAGCTACAGCCTGACGTGTAGACAGGTAACAATTGATTTCAA

[0070] GTTCCTGGTGCTCAGTATAGACGGGCAATCACTCGACACAGCTTCCGTA

[0071] Note: The method for synthesizing ds-egfp is similar to that for synthesizing ds-BmSpz7, except that the template and primers are changed to pIZ / V5-egfp, ds-egfp F, and ds-egfp R.

[0072] Example 2

[0073] silkworm larvae Interference with 7 genes and viral infection

[0074] 1. Silkworms (P50 strain) were preserved and provided by the Key Laboratory of Silkworm Genetic Improvement, Ministry of Agriculture and Rural Affairs, and fed with ordinary mulberry leaves at 27℃. ds-BmSpz7 (10 μl, 1 μg / μl) synthesized in Example 1 was injected into 5th instar larvae on day 1 using a microsyringe. The control group was injected with ds-egfp (10 μl, 1 μg / μl). Serum was collected 6 hours later, and the interference efficiency was detected by qPCR.

[0075] 2. Silkworms (P50 strain) were preserved and provided by the Key Laboratory of Silkworm Genetic Improvement, Ministry of Agriculture and Rural Affairs, and fed with ordinary mulberry leaves at 27℃. ds-BmSpz7 (10 μl, 1 μg / μl) was injected into 5th instar larvae on day 1 using a microsyringe. The control group was injected with ds-egfp (10 μl, 1 μg / μl). Six hours later, silkworm nucleopolyhedrovirus (preserved and cultured by the Key Laboratory of Silkworm Genetic Improvement, Ministry of Agriculture and Rural Affairs) (2.3 × 10⁻⁶) was injected. 7 TCID 50 / mL, 10μl) of virus, serum was collected after 24 hours and AMP expression level was detected by qPCR.

[0076] 3. The steps for detecting interference efficiency are as follows:

[0077] (1) Collect silkworm hemolymph samples and extract RNA:

[0078] 1) Take an appropriate amount of silkworm blood into an EP tube, add 1 ml of RNAiso plus (Takara, Nanjing) lysis buffer and mix well.

[0079] 2) Then gently and thoroughly shake to ensure the mixture is homogeneous, and let it stand at room temperature for about 5 minutes.

[0080] 3) Pre-cool the refrigerated centrifuge to 4°C, add 200 μl of chloroform, mix thoroughly, let stand at room temperature for about 5 minutes, and then centrifuge at 12000 rpm for 5 minutes.

[0081] 4) Transfer the supernatant to a new ep cyclophosphamide tube, add 1 mL of isopropanol, and gently shake to ensure mixing. Then, incubate at room temperature for 10 minutes to allow RNA precipitation. Subsequently, centrifuge at 12,000 rpm for 15 minutes.

[0082] 5) Aspirate the supernatant and add 2 volumes of 75% ethanol solution (prepared with DEPC water) to the EP tube. Gently resuspend the RNA precipitate with a pipette. Then centrifuge at 7500 rpm for 5 min.

[0083] 6) Discard the supernatant and place the EP tube in a ventilated area to dry for 5 minutes. Dissolve the RNA precipitate in the EP tube with 20 μl of RNase-free H2O, mix well, take 1 μl to determine the RNA concentration, and then take 5 μl, add 6× Loading Buffer, and detect the quality of the extracted RNA sample by 1% agarose gel electrophoresis.

[0084] (2) RNA reverse transcription:

[0085] according to III RT SuperMix for qPCR (+gDNA wiper) Reverse Transcription Kit Instructions: Take 1 μg of RNA sample for reverse transcription.

[0086] 1) Removal of genomic DNA

[0087] Prepare a genome removal premix in an RNase-free PCR tube (Table 2), mix gently, and heat in a 42°C water bath for 2 min.

[0088] Table 2. Genomics Removal Premix

[0089]

[0090] 2) Preparation of reverse transcription reaction premix

[0091] Add 4 μl of 5×HiScript III qRT SuperMix to the premixed solution after the first step reaction and gently mix by pipetting.

[0092] 3) Perform reverse transcription reaction

[0093] The prepared reverse transcription reaction premix was placed in a PCR instrument, and the reaction conditions were: 37℃ for 15 min, 85℃ for 5 s. The concentration of the solution after the reaction was determined using a NanoDrop spectrophotometer.

[0094] (3) Quantitative Real-Time PCR (qPCR) reaction

[0095] The samples were used with GAPDH as an internal control. The quantitative primers used in this experiment for qPCR are shown in Table 1. GAPDH (ID: EU141495.1) was used as the internal control gene, and 2... -ΔΔCt The method is used to calculate the relative expression level of genes.

[0096] 1) Prepare a fixed-volume reaction premix in an eight-tube qPCR tube (Table 3).

[0097] Table 3 Quantitative Reaction Premix

[0098]

[0099]

[0100] 2) Perform qPCR reaction under the following conditions, as shown in Table 4.

[0101] Table 4 Quantitative Reaction Conditions

[0102]

[0103] (4) Statistical Analysis

[0104] The experiment was repeated three times for the sample and three times for the technique. Graph Pad Prism 8.0 software was then used to perform statistical analysis on the data.

[0105] RNAi interference efficiency verification and its effect on AMPs secretion after interference, such as Figure 1 As shown, the results revealed The expression level of 7 was significantly lower than that of the control group, indicating that the dsRNA synthesized in Example 1 was injected into silkworms. 7 was suppressed ( Figure 1 A). When using RNAi technology to knock down AMP expression levels significantly increased 24 hours after BmNPV infection. Figure 1 B) Statistical results showed that the secretion rate of Attacin increased by 870% and the secretion rate of Gloverins increased by 540% in AMPs, while the secretion rate of Moricin did not increase. This indicates interference with the host. After 7 days, it can significantly induce the expression of AMPs.

[0106] Example 2

[0107] 7. Injection of silkworm nucleopolyhedrovirus after interference delays silkworm mortality.

[0108] ds-BmSpz7 (10 μl, 1 μg / μl) was injected into 50 fifth-instar day-1 silkworm larvae (P50 strain) using a microsyringe. The control group was injected with ds-egfp (10 μl, 1 μg / μl). Six hours later, silkworm nucleopolyhedrovirus (2.3 × 10⁷ TCID⁻¹) was injected. 50 / mL 10μl). Fresh mulberry leaves, sprayed with a penicillin-streptomycin antibiotic dilution (1:100) and dried, were added to the feed daily at the appropriate time and in sufficient quantities. After 4 days, silkworms began to show symptoms, and mortality was counted. The survival rate of silkworms after dsRNA interference was compared. Results are as follows: Figure 2 As shown, compared with the control group ds-egfp, After knocking down 7, it significantly delayed the death time of silkworms infected with the virus (8 hours).

Claims

1. The application of the Spätzle 7 gene as a regulatory target or regulatory marker in enhancing the secretion of the antimicrobial peptide Gloverin in silkworms, wherein the sequence of the Spätzle 7 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The application is to enhance the expression of the antimicrobial peptide Gloverin in silkworms.

3. The application according to claim 1 or 2, characterized in that, The spätzle 7 gene includes gene sequences that are more than 90% homologous to its DNA sequence and have the same function.

4. The application of the Spätzle7 gene or an inhibitor or interferon targeting the protein encoded by the spätzle7 gene in enhancing the secretion of the antimicrobial peptide Gloverin in silkworms, wherein the sequence of the Spätzle7 gene is shown in SEQ ID NO.

1.

5. The application according to claim 4, characterized in that, The inhibitor or interfering agent may be a gene editing reagent that specifically knocks out the Spätzle7 gene, an interfering molecule that specifically interferes with the expression of the Spätzle7 gene, a small molecule compound that specifically inhibits the expression of the Spätzle7 gene protein, or an antibody or ligand that specifically binds to the expression of the Spätzle7 gene protein.

6. The application according to claim 5, characterized in that, The interfering agent is dsRNA, the sequence of which is shown in SEQ ID NO.

2.

7. The application according to claim 6, characterized in that, The interfering agent is dsRNA, and its interfering primer sequences are: TAATACGACTCACTATAGGGATTGGGTCGGTTCAGTTCAG and TAATACGACTCACTATAGGGTACGGAAGCTGTGTCGAGTG.

8. A method for increasing the secretion of antimicrobial peptides in silkworms, characterized in that, By knocking down the Spätzle7 gene in the silkworm host, the expression of the antimicrobial peptide Gloverin in the silkworm was increased. The sequence of the Spätzle7 gene is shown in SEQ ID NO.

1.

9. The method according to claim 8, characterized in that, The host is injected with dsRNA that interferes with the Spätzle7 gene, and then infected with silkworm nucleopolyhedrovirus, which induces the secretion of large amounts of the antimicrobial peptide Gloverin; the spätzle7 gene interfering agent includes the dsRNA described in claim 6.

10. The application of the method for increasing the secretion of antimicrobial peptides by silkworms as described in claim 8 in prolonging the death time of silkworms infected with nucleopolyhedrovirus.

Images