Preparation method of beaaveria bassiana bc-01 mycelium polysaccharide and application thereof

By isolating the BC-01 strain of Beauveria bassiana from Beauveria bassiana and preparing mycelial polysaccharides using liquid culture, the problem of the lack of reported whitening effects of Beauveria bassiana has been solved, achieving whitening, antioxidant and immune-activating effects, which are applicable to the cosmetics field.

CN119662419BActive Publication Date: 2026-04-24SHANGHAI INST OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI INST OF TECH
Filing Date
2024-11-25
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing technologies for Beauveria bassiana extract mainly focus on anti-oxidation and whitening, but lack research on the whitening effect of Beauveria bassiana mycelial polysaccharides. Furthermore, the resources of Beauveria bassiana silkworm are limited and of unstable quality.

Method used

Beauveria bassiana strain BC-01 was isolated from Beauveria bassiana, mycelium was collected by liquid culture, polysaccharide was prepared and its inhibitory effect on tyrosinase activity and melanin production was verified, demonstrating whitening effect.

Benefits of technology

The prepared Beauveria bassiana BC-01 mycelial polysaccharide has good whitening, antioxidant and immune-activating effects, and is suitable for the cosmetics field. It is inexpensive, safe and has no toxic side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662419B_ABST
    Figure CN119662419B_ABST
Patent Text Reader

Abstract

The present application relates to the field of microorganisms, and particularly relates to a preparation method and application of a Beauveria bassiana BC-01 mycelium polysaccharide, wherein the Beauveria bassiana BC-01 has been preserved in the China General Microbiological Culture Collection Center on January 18, 2024, and the preservation number is CGMCC No. 41044. The strain produces mycelium polysaccharide with an IC 50 value of 0.5302 mg / mL for inhibiting tyrosinase; and a polysaccharide concentration of 1.5 mg / mL shows good whitening effect. The polysaccharide promotes the expression of cytokines IL-6 and TNF-alpha, and shows immune activity. The polysaccharide has the effects of whitening, antioxidation, and immune activation, and can promote the proliferation of Staphylococcus epidermidis and inhibit the proliferation of Propionibacterium acnes, and can be used as a new whitening and skin microecological material for developing cosmetics. The preparation method of the Beauveria bassiana mycelium polysaccharide is simple and easy to operate, the extraction process does not use organic reagents such as ethanol and methanol, and the production is safe and low in price.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a method for preparing polysaccharides from Beauveria bassiana BC-01 mycelium and their applications. Specifically, it relates to a polysaccharide from Beauveria bassiana BC-01 that has antioxidant, whitening, skin microecological regulation, and immune-activating properties, and its applications. Background Technology

[0002] The use of silkworm pupae in my country has a long history. The Song Dynasty medical text *Taiping Shenghui Fang* records the use of seven silkworm pupae ground into powder, an egg soaked in wine for seven days, the yolk removed, and the mixture applied to scars to treat hypertrophic scars. The Yuan Dynasty medical text *Yuyuan Fang* records the use of silkworm pupae in its "Seven White Ointment," and the Tang Dynasty medical text *Qianjin Yaofang* records the use of "Jade Complexion Powder." "Seven White Herbs," a famous whitening cosmetic in ancient my country, was popular from the Song Dynasty to the Qing Dynasty. It is composed of seven white medicinal herbs: white peony root, white atractylodes rhizome, white peony root, white angelica root, silkworm pupae, and white poria cocos. Silkworm pupae originate from nature, and its metabolites have high biological activity, effectively delaying skin aging, whitening and fading spots, and possessing antibacterial and anti-inflammatory effects, making it widely used in cosmetics. Extracts of *Beauveria bassiana* are included in the *Catalogue of Used Cosmetic Ingredients (2021 Edition)*.

[0003] Beauveria belongs to the phylum Ascomycotina, subphylum Pezizomycotina, class Sordariomycetes, order Hypocreales, family Cordycipitaceae, and genus Beauveria. It is the fungus that forms the white silkworm and contains a variety of active substances, including polysaccharides, polypeptides, alkaloids, polyketides, phenylpropanoids, terpenoids, and nucleosides.

[0004] Patent CN110903985B discloses an extracellular polysaccharide with antioxidant and moisturizing activity produced by a strain of Beauveria bassiana BC-01 and its applications. The Beauveria bassiana BC-01 strain has the accession number CGMCC NO.41044. Its extracellular polysaccharide exhibits good antioxidant and moisturizing properties and can be used in cosmetics and health products to protect cells from free radical damage, prevent aging, and is inexpensive and safe to produce. However, research on the skin-whitening effects of this strain does not include studies on its efficacy.

[0005] Wild resources of *Beauveria bassiana* are limited, and the quality of the product varies due to constraints in its growth environment, affecting its efficacy. Collecting mycelium using liquid culture and extracting active substances offers advantages such as short production cycle, low cost, and easy control, making it an effective method for preparing *Beauveria bassiana* extract. Currently, research on *Beauveria bassiana* and its extracts mainly focuses on antioxidant and skin-whitening effects, while research on *Beauveria bassiana* mycelial polysaccharides is almost nonexistent, especially regarding their skin-whitening effects. Summary of the Invention

[0006] To address the aforementioned problems, this invention isolates a strain of *Beauveria bassiana* BC-01 from *Beauveria bassiana*, collects mycelia through liquid culture, and prepares mycelial polysaccharides. Verification shows that the mycelial polysaccharides effectively inhibit tyrosinase activity and melanin production, exhibiting a good whitening effect. This invention provides a method for preparing *Beauveria bassiana* BC-01 mycelial polysaccharides and its applications, which can be used in the cosmetics field. It is inexpensive, safe to produce, environmentally friendly, and has no toxic side effects.

[0007] The objective of this application can be achieved through the following technical solutions:

[0008] One of the technical solutions of the present invention provides a Beauveria bassiana strain BC-01, which is isolated and purified from Sichuan silkworm. It has been proven that the polysaccharide components extracted from the mycelium produced by fermentation of the Beauveria bassiana strain BC-01 have good antioxidant, whitening, skin microecological regulation and immune activation effects, and have broad application prospects in the cosmetics field.

[0009] Furthermore, strain BC-01 was identified as Beauveria bassiana by taxonomic and molecular biological studies, with a homology of 99.82%; it was deposited at the China General Microbiological Culture Collection Center on January 18, 2024, with accession number CGMCC No. 41044.

[0010] The second technical solution of the present invention provides a Beauveria bassiana mycelial polysaccharide, which is obtained by producing and isolating the mycelium of the Beauveria bassiana strain BC-01 described in the first technical solution above. The preparation method of the Beauveria bassiana mycelial polysaccharide is as follows:

[0011] S1. Preparation of Beauveria bassiana mycelium:

[0012] Seed culture: Fresh mycelium is inoculated into liquid seed culture medium and cultured on a shaker to obtain primary seed culture. The primary seed culture is then inoculated into seed culture medium at an inoculation rate of 5% to 10% (V / V) and cultured under the above culture conditions to obtain secondary seed culture.

[0013] Fermentation culture: The secondary seed culture was inoculated into the basic fermentation medium at an inoculation rate of 5% to 10% (V / V) and cultured to obtain fermentation broth; the mycelium was collected by centrifugation of the fermentation broth, washed three times with distilled water, and freeze-dried to obtain freeze-dried mycelium;

[0014] S2. Preparation of polysaccharides from Beauveria bassiana mycelium:

[0015] Weigh out a quantity of freeze-dried mycelium and pass it through an 80-mesh sieve. Use hot water extraction to obtain the extract. Centrifuge the extract, combine the filtrates, and concentrate to 1 / 4 to 1 / 3 of the original volume. After alcohol precipitation, centrifuge to collect the precipitate, add a small amount of water to dissolve and dialyze. Freeze-dry to obtain Beauveria bassiana mycelial polysaccharide.

[0016] Further, the fresh bacterial cells mentioned in step S1 are single colonies of Beauveria bassiana strain BC-01 cultured on potato dextrose agar (PDA) medium; the single colonies are preferably obtained by activating Beauveria bassiana strain BC-01 preserved in glycerol; the activation is a routine operation well known to those skilled in the art, generally involving: inoculating the glycerol-preserved strain onto a PDA plate for activation twice, and incubating at a constant temperature of 26°C for 4-5 days;

[0017] In some preferred embodiments of this application, the potato glucose agar medium comprises: 200g potato, 20g glucose, 20g agar powder, and 1000mL distilled water.

[0018] In some preferred embodiments of this application, the liquid seed culture medium in step S1 is potato glucose liquid culture medium, which, by mass percentage, comprises: 20% glucose, 20% potato extract powder, 2% tryptone, 1.5% K2HPO4, 2% MgSO4·7H2O, and the remainder is water.

[0019] In some preferred embodiments of this application, the basic fermentation culture medium in step S1 comprises the following components at the following concentrations: glucose 20 g / L, potato 200 g / L, and water as the solvent.

[0020] Furthermore, the inoculation described in step S1 needs to be carried out under aseptic conditions; an inoculation shovel, inoculation hook, inoculation loop or other inoculation tools approved by those skilled in the art can be used for inoculation; the volume of the liquid seed culture medium or basic fermentation culture medium is preferably (120-130) mL / 250 mL in some specific embodiments.

[0021] Furthermore, the mycelial polysaccharide includes the following monosaccharides: fucose, galactose, glucose, and mannose; with a molar ratio of 0.103:1.205:14:0.678.

[0022] Further, the conditions for culturing the primary and secondary seed solutions in step S1 are: 140–160 r / min, 25–27 °C; the culturing times for the primary and secondary seed solutions are 70–74 h and 46–50 h, respectively.

[0023] Further, the fermentation conditions in step S1 are 140–160 r / min, 25–27 °C, and 115–125 h; the centrifugation conditions are 7000–9000 r / min, 2–4 °C, and 8–12 min.

[0024] Further, in step S2, the hot water extraction method involves the following steps: the material-to-liquid ratio is 1:(28-32), the extraction temperature is 90℃, the extraction time is 2 hours, and the extraction is performed 3 times; the centrifugation conditions for the extract are 7000-9000 r / min, 2-4℃, and 8-12 minutes; the alcohol precipitation is performed by adding 2.9-3.1 times the volume of anhydrous ethanol to the concentrate and precipitating at 2-4℃ for 20-24 hours; the conditions for centrifuging to collect the precipitate are: centrifuging at 4400-5000 r / min for 8-15 minutes to collect the precipitate; and the dialysis duration is 45-50 hours.

[0025] The third technical solution of the present invention provides the application of Beauveria bassiana mycelial polysaccharide as described above in the skin microecology, wherein the Beauveria bassiana mycelial polysaccharide is used as a whitening active ingredient, an antioxidant active ingredient, or a skin microecological regulator.

[0026] Furthermore, the Beauveria bassiana mycelial polysaccharide was verified to promote the growth of Staphylococcus epidermidis and inhibit the growth of Propionibacterium acnes.

[0027] The fourth technical solution of the present invention provides the application of Beauveria bassiana mycelial polysaccharide as described above in immune regulation, wherein the Beauveria bassiana mycelial polysaccharide is used as an immune activator.

[0028] Furthermore, the immune activator is used to promote the production of cytokines IL-6 and TNF-α.

[0029] Compared with the prior art, the beneficial effects of the present invention are at least as follows:

[0030] This invention provides a method for preparing Beauveria bassiana BC-01 mycelial polysaccharide and its application. The obtained mycelial polysaccharide has whitening, antioxidant, and immunomodulatory effects, and can promote the growth of Staphylococcus epidermidis while inhibiting the proliferation of Propionibacterium acnes, thus regulating the skin microecology. It can be used in the preparation of drugs for treating acne. The Beauveria bassiana mycelial polysaccharide provided by this invention has good application prospects in whitening and microecological regulation. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention.

[0032] Figure 1 This is a colony morphology diagram of Beauveria bassiana BC-01 provided by the present invention;

[0033] Figure 2 The chromatogram for monosaccharide analysis-standards is shown below (peaks 1-12 in the figure are fucose, galactosamine, rhamnose, arabinose, glucosamine, galactose, glucose, xylose, mannose, fructose, galacturonic acid, and glucuronic acid, respectively).

[0034] Figure 3 The chromatogram of monosaccharide analysis of mycelial polysaccharides of Beauveria bassiana BC-01 provided by the present invention (peaks 1, 2, 3, and 4 in the figure are fucose, galactose, glucose, and mannose, respectively).

[0035] Figure 4 The molecular weight distribution diagram of the mycelial polysaccharide of Beauveria bassiana BC-01 provided by the present invention;

[0036] Figure 5 The ultraviolet spectrum of mycelial polysaccharide of Beauveria bassiana BC-01 provided by the present invention;

[0037] Figure 6 Infrared spectrum of mycelial polysaccharide of Beauveria bassiana BC-01 provided by the present invention;

[0038] Figure 7 The effect of Beauveria bassiana BC-01 mycelial polysaccharide provided by the present invention on Staphylococcus epidermidis (Beauveria bassiana mycelial polysaccharide is the experimental group, compared with the control group, *P<0.05);

[0039] Figure 8 The effect of Beauveria bassiana BC-01 mycelial polysaccharide provided by the present invention on Propionibacterium acnes (Beauveria bassiana mycelial polysaccharide is the experimental group, compared with the control group, ****P<0.0001, *P<0.05, **P<0.01);

[0040] Figure 9The effects of different concentrations of Beauveria bassiana BC-01 mycelial polysaccharide provided in this invention on the production of IL-6, TNF-α, and NO levels in LPS-induced RAW264.7 cells were investigated (NT was the untreated control group, LPS was the model group, DEX was the positive group, and Beauveria bassiana mycelial polysaccharide was the experimental group. Compared with the control group, ****P < 0.0001; compared with the model group, *P < 0.05, **P < 0.01, ***P < 0.001).

[0041] Figure 10 The effect of different concentrations of Beauveria bassiana BC-01 mycelial polysaccharide provided by this invention on the melanin content of B16-F10 cells (NT is the untreated control group, Arbutin and Kojic Acid are the positive groups, and Beauveria bassiana mycelial polysaccharide is the experimental group, ** represents P<0.01, *** represents P<0.001). Detailed Implementation

[0042] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any way. It should be pointed out that those skilled in the art can make several modifications and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0043] All raw materials used in this invention are not particularly limited in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.

[0044] Example 1: Screening and Identification of Beauveria bassiana

[0045] (1) Isolation of Beauveria bassiana

[0046] The Beauveria bassiana BC-01 of this invention was isolated and purified from Sichuan white silkworm.

[0047] The specific separation and purification methods are as follows:

[0048] White silkworms were surface-sterilized in 75% alcohol for 30 seconds, followed by surface sterilization in sterile water for another 30 seconds. The silkworms were then cut in half, and their internal tissue was streaked onto agar plates. The streaks were then inoculated into potato dextrose agar (PDA) medium supplemented with chloramphenicol at a final concentration of 100 mg / mL. The white silkworms were placed in the medium. The PDA medium consisted of 200 g potato, 20 g glucose, 20 g agar powder, and 1000 mL distilled water. The pH of the PDA medium was kept at its natural state (no adjustment was required after preparation). After preparation, the medium was sterilized at 121°C for 20 minutes before use. When using, the sterilized medium was aliquoted and chloramphenicol was added to prepare agar plates, to be added immediately before use. After inoculation, the plates were incubated upright at 26°C for 4 days. Once single colonies appeared on the plates, they were further subcultured to isolate pure bacterial strains.

[0049] The strains selected in the initial screening (i.e., single colonies) were inoculated into 125 mL and 250 mL of basal fermentation medium, respectively. The components of the basal fermentation medium were as follows: glucose 20 g / L, potato 200 g / L, natural pH, sterilized at 121 °C for 20 min before use. After inoculation, fermentation was carried out under the following conditions: fermentation temperature 26 °C, fermentation time 4 days, and rotation speed 150 r / min. After fermentation, the fermentation broth was centrifuged at 10,000 r / min at 4℃ to remove bacterial cells, and washed three times with distilled water to obtain mycelium. Hot water extraction was performed at a material-to-liquid ratio of 1:20, an extraction temperature of 90℃, and an extraction time of 2 hours, for a total of three extractions. The filtrates were combined and rotary evaporated to 1 / 3 of the original volume. Three times the volume of anhydrous ethanol was added to precipitate the mycelium, which was then placed in a refrigerator at 4℃ and allowed to stand overnight. The precipitate was collected by centrifugation, dissolved in deionized water, and dialyzed using a 3500 μL cutoff dialysis bag for 48 hours. The polysaccharide content was determined using the sulfuric acid-phenol method (a conventional method in the field). The strain with high polysaccharide content was selected as the Beauveria bassiana strain BC-01 of this invention.

[0050] The results showed that the *Beauveria bassiana* BC-01 of this invention grew rapidly in liquid culture medium. Small white spherical mycelia were observed 3 days after inoculation. The liquid culture medium gradually became turbid, and with the extension of fermentation time, it gradually became viscous. After centrifugation to remove bacterial cells, ethanol precipitation, and dissolution with deionized water, the polysaccharide content was determined using the sulfuric acid-phenol method. The calculated polysaccharide yield from the mycelia was 7.2%.

[0051]

[0052] Crude polysaccharide quality: refers to the total amount of polysaccharides obtained from the raw material through the extraction process;

[0053] Raw material quality: refers to the total amount of raw materials used for extraction.

[0054] (2) Identification of Beauveria bassiana strain BC-01

[0055] (a) Observation of colony and cell morphology

[0056] Beauveria bassiana BC-01 was inoculated onto PDA agar plates and incubated at 26℃ for 3–5 days. Colony growth was observed. Initially, Beauveria bassiana BC-01 formed white, fluffy colonies on the plates, which were white, round, and raised. Later in the culture, pale yellow, powdery spores were produced. Figure 1 As shown.

[0057] (b) ITS sequence analysis

[0058] ITS (Internal Transcribed Spacer) identification refers to DNA sequencing of ITS sequences. The obtained ITS sequence is compared with known fungal ITS sequences to obtain information about the species of the fungus being tested. The specific method is as follows: Mycelia of *Beauveria bassiana* BC-01 strain were picked and placed on a PDA solid plate. Total DNA was extracted using a fungal genome extraction kit (TIAN GEN). Following the instructions of the Bioteke 2×powerTaq PCR MasterMix kit, PCR amplification was performed using universal fungal ribosomal spacer regions ITS1 and ITS4 as primers. The nucleic acid sequence of ITS1 is shown in SEQ ID No. 1, specifically 5'-TCCGTAGGTGAACCTGCGG-3'; the nucleic acid sequence of ITS4 is shown in SEQ ID No. 2, specifically 5'-TCCTCCGCTTATTGATATGC-3'. The PCR amplification products were recovered using a 1% agarose gel extraction kit (BioFlux), purified, and sent to Shanghai Meiji Biotechnology Co., Ltd. for sequencing. Blast analysis was performed on the GenBank NCBI website.

[0059] Detection Results: The ITS nucleotide sequence of the *Beauveria bassiana* strain BC-01 of this invention is shown in SEQ ID No. 3. Blast analysis showed that the strain with the highest homology to this invention was *Beauveria bassiana*, with a homology of 99.82%. According to Goodfellow and O'Donnell, species with DNA G+C (mol%) ≤10%–12% and ITS sequence homology ≥95% can be classified into one genus. Furthermore, Embey and Stackebrangdt considered that when ITS sequence homology ≥97%, it can be considered a species. Therefore, the *Beauveria bassiana* strain BC-01 of this invention belongs to the same species as *Beauveria bassiana*, and is named *Beauveria bassiana* BC-01. This strain has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41044.

[0060] Example 2: Preparation of polysaccharides from Beauveria bassiana BC-01 mycelium

[0061] (1) Preparation of Beauveria bassiana mycelium

[0062] Strain activation: The strain preserved in glycerol was inoculated onto a PDA plate and activated twice, and then incubated at 26°C for 4–5 days.

[0063] Seed culture: Under aseptic conditions, fresh bacterial cells were transferred to liquid seed culture medium using an inoculation spatula and cultured on a shaker at 125 mL / 250 mL volume, 150 r / min, and 26 °C for 3 days to obtain primary seed culture; the primary seed culture was inoculated into liquid seed culture medium at an inoculation rate of 7% (V / V) and cultured under the above conditions for 2 days to obtain secondary seed culture.

[0064] The liquid seed culture medium contains the following components in the indicated mass concentrations: 20% potato extract powder, 20% glucose, 2% tryptone, 1.5% K2HPO4, 2% MgSO4·7H2O, and the remainder is water. It is sterilized at 121°C for 20 min.

[0065] Fermentation culture: The secondary seed culture was inoculated into the basal fermentation medium at an inoculum volume of 5% (V / V), with a volume of 125 mL / 250 mL, and the culture was carried out at 26℃ for 5 days with a shaking speed of 150 rpm to obtain the fermentation broth. The fermentation broth was centrifuged (8000 rpm, 4℃) for 10 min, and the mycelium was collected. The mycelium was washed three times with distilled water and then freeze-dried to obtain the mycelium.

[0066] (2) Preparation of polysaccharide from mycelium BC-01

[0067] A quantity of freeze-dried mycelium was passed through an 80-mesh sieve and extracted using hot water extraction: the material-to-liquid ratio was 1:30, the extraction temperature was 90℃, the extraction time was 2 hours, and the extraction was repeated 3 times. The extract was centrifuged (8000 r / min, 4℃) for 10 minutes, the filtrates were combined and concentrated to 1 / 4 of the original volume, three times the volume of anhydrous ethanol was added to the concentrate, and the mixture was precipitated at 4℃ for 24 hours. The precipitate was collected by centrifugation at 4500 r / min for 10 minutes, dissolved in a small amount of water, dialyzed for 48 hours, and then freeze-dried to obtain crude mycelial polysaccharide. The polysaccharide content was determined to be 60.27 g / 100 g using the phenol-sulfuric acid method, and the protein content was determined to be 0.09% using the Coomassie brilliant blue method.

[0068]

[0069] Where M is the protein content (μg) obtained from the standard curve, V is the total volume of the sample extract (mL), Vs is the volume of the sample liquid taken during the determination (mL), and m is the sample mass (g).

[0070]

[0071] Where m1 is the sugar content in the sample measured from the standard curve (μg), v1 is the sample volume (mL), v2 is the sample volume (mL), m2 is the sample mass (g), and 0.9 is the correction factor for replacing glucose with dextran.

[0072] Example 3 Physicochemical properties of Beauveria bassiana BC-01 mycelial polysaccharides

[0073] (1) Monosaccharide composition of Beauveria bassiana BC-01 mycelial polysaccharide

[0074] The mycelial polysaccharide sample obtained in Example 2 was prepared into a 5 mg / mL sugar solution. 100 μL of the sugar solution was mixed with 100 μL of trifluoroacetic acid (TFA), and the tube was sealed with nitrogen. The reaction solution was placed in a 110°C oven for hydrolysis for 2 hours. After cooling, the tube was opened. 200 μL of the reaction solution was mixed with 200 μL of methanol and dried with nitrogen. This process was repeated 3–4 times to remove TFA. The monosaccharide composition was determined using high-performance ion chromatography (HPAEC). The polysaccharides were analyzed after hydrolysis with TFA. Analytical conditions: Dionex ICS2500 system: GS50 quaternary gradient pump, ED50A electrochemical detector (gold electrode), LC30 column oven at 30℃; Chromeleon 6.5 chromatography workstation; CarboPac PA20 anion exchange column (150mm × 3mm); elution program: 2 mmol / L sodium hydroxide eluent, flow rate 0.45 mL / min, 120 min. Mobile phase: A: deionized water; B: 0.25 mol / L NaOH; C: 1 mol / L NaAc, flow rate 0.4 mL / min, injection 25 μL. Elution gradient: 0 min A / B / C phase (99.2:0.8:0, V / V / V), 30 min A / B / C phase (99.2:0.8:0, V / V / V), 40 min A / B / C phase (79.2:0.8:20, V / V / V), 40.1 min A / B / C phase (20:80:0, V / V / V), 60 min A / B / C phase (99.2:0.8:0, V / V / V). Twelve monosaccharide standards were used as references (fucose (Fuc), galactosamine (Galn), rhamnose (Rha), arabinose (Ara), glucosamine (Glcn), galactose (Gal), glucose (Glc), xylose (Xyl), mannose (Man), fructose (Fruc), galacturonic acid (GlcA), glucuronic acid (GLU)).

[0075] Table 1. Polysaccharide and monosaccharide composition of Beauveria bassiana mycelium

[0076] label Types of monosaccharides Standard peak area Peak time Sample peak area 1 Fucose 0.5 7.809 0.0586 2 Galactose 4.76 8.959 0.5559 3 glucose 88.89 10.2 10.3723 4 Mannose 5.85 12.759 0.6821

[0077] like Figure 2 and Figure 3 As shown in the figure, the values ​​at the peaks represent substances according to Table 1, calculated using the formula for the molar ratio of monosaccharides:

[0078]

[0079] The monosaccharide composition of the polysaccharide from Beauveria bassiana BC-01 mycelium was fucose: galactose: glucose: mannose, with a molar ratio of 0.103:1.205:14:0.678.

[0080] (2) Average molecular weight of polysaccharide from Beauveria bassiana BC-01 mycelium

[0081] The mycelial polysaccharide obtained in Example 2 was dissolved into a solution with a concentration of 3-5 mg / mL, and the molecular weight of the Beauveria bassiana mycelial polysaccharide was determined by HPGPC high-performance gel permeation chromatography.

[0082] Analytical conditions: Column: Ultrahydrogel TM Linear spectrometer: 2 in series (300mm × 7.8mm); Chromatograph: Water 600 high performance liquid chromatograph (2410 differential refractive index detector and Empower workstation); 45℃; Mobile phase: 0.1mol / L NaNO3; Flow rate: 0.9mL / min; Injection volume: 10μL.

[0083] Under these chromatographic conditions, with Mw 2.000 × 10 3 ku, Mw 1.338×10 2 ku, Mw 41.10ku, Mw21.40ku, Mw 4.600ku and Mw 1.800×10 -1 A standard curve was prepared using KU dextran standards. A 3.00 mg / mL aqueous solution was prepared using freeze-dried Beauveria bassiana mycelial polysaccharide samples, and the molecular weight distribution of the Beauveria bassiana mycelial polysaccharide was determined as follows: Figure 4 As shown, it is mainly composed of three components, with weight-average molecular weights (Mw) of 1.51 × 10⁻⁶ and 1.51 × 10⁻⁶ respectively. 6 ku, 2.6×10 4 ku, 7.67×10 2 ku.

[0084] (3) Ultraviolet spectral analysis of Beauveria bassiana mycelial polysaccharides

[0085] The mycelial polysaccharide obtained in Example 2 was prepared into a 1 mg / mL solution using distilled water, and its ultraviolet spectrum was scanned in the wavelength range of 200–400 nm. The detection results are shown below. Figure 5 .Depend on Figure 5 The results showed that the mycelial polysaccharide had a typical ultraviolet absorption spectrum of polysaccharides, with an absorption characteristic at 260 nm and no absorption peak at 280 nm, indicating that the substance contained polysaccharides, a small amount of nucleic acid, and no protein.

[0086] (4) Infrared spectral analysis of Beauveria bassiana mycelial polysaccharides

[0087] KBr compression method was used, at 4000-400cm -1 Within range (resolution 4cm) -1 The mycelial polysaccharides obtained in Example 2 were analyzed by infrared spectroscopy. The results are shown in the figure. Figure 6 .Depend on Figure 6 The results show that the infrared spectrum of the mycelial polysaccharide exhibits typical polysaccharide characteristics. (3461 cm⁻¹) -1 The absorption peak at 2363 cm⁻¹ is the stretching vibration peak of the hydroxyl (OH) bond. -1 This wavenumber is generally not related to a specific functional group; it may be a signal of noise or other impurities, or it may correspond to the stretching vibration of the cyano group (-C≡N); 2122 cm⁻¹ -1 The peak at 1638 cm⁻¹ is the stretching vibration peak of the carboxyl group (-COOH). -1 The peak at 1414 cm⁻¹ is the absorption peak of the stretching vibration of the carbonyl (C=O) bond. -1 The peak at 1248 cm⁻¹ is the stretching vibration peak of the β-glucuronidate (-C=O) bond; -1 The peak at 1058 cm⁻¹ is the stretching vibration peak of the CO-C bond on the glucose ring; the peak at 1058 cm⁻¹ is the stretching vibration peak of the CO bond in cellulose; 824 cm⁻¹ is the peak of the stretching vibration of the CO bond in cellulose. -1 and 734cm -1 The peak at 603 cm⁻¹ is the CH bending vibration peak of the α-glucose ring. -1 The peak at this point is a characteristic COC stretching vibration peak of polysaccharides.

[0088] Example 4: Antioxidant capacity of Beauveria bassiana BC-01 mycelial polysaccharides

[0089] (1) DPPH free radical scavenging rate of Beauveria bassiana BC-01 mycelial polysaccharide

[0090] Preparation of DPPH solution: Weigh 4 mg of DPPH and dilute to 100 mL in a brown volumetric flask with anhydrous ethanol to obtain a 0.1 mg / mL DPPH solution.

[0091] Preparation of sample solutions: Accurately weigh an appropriate amount of Beauveria bassiana BC-01 mycelial polysaccharide prepared in Example 2, dissolve it in deionized water, and prepare a 5 mg / mL sample solution. The above sample solution was then serially diluted to obtain sample solutions of 1, 2, 3, 4, and 5 mg / mL, respectively.

[0092] DPPH free radical scavenging ability: 100 μL of polysaccharide sample solutions of different concentrations were added to 100 μL of DPPH under light-protected conditions, and reacted at 37℃ for 30 min under light-protected conditions. The absorbance value was measured at 517 nm and recorded as A1. 100 μL of polysaccharide sample solutions of different concentrations were added to 100 μL of anhydrous ethanol, and reacted at 37℃ for 30 min under light-protected conditions. The absorbance value was measured at 517 nm and recorded as A2. Then, 100 μL of deionized water was added to 100 μL of DPPH under light-protected conditions, and reacted at 37℃ for 30 min under light-protected conditions. The absorbance value was measured at 517 nm and recorded as A0.

[0093]

[0094] The higher the clearance rate, the stronger the antioxidant capacity. The test results are shown in Table 2.

[0095] Table 2 DPPH free radical scavenging rate

[0096] Concentration (mg / mL) 1 2 5 8 10 Clearance rate / % 18.02 23.68 50.88 55.49 83.11

[0097] Table 2 shows that, within a certain range, the DPPH scavenging rate of mycelial polysaccharides increases with increasing concentration. At 10 mg / mL, the DPPH free radical scavenging rate of mycelial polysaccharides reaches 83.11%. The IC50 value was obtained by fitting a Graph Pad Prism 9 curve. 50 The value was 0.7094 mg / mL.

[0098] (2) ABTS scavenging rate of Beauveria bassiana BC-01 mycelial polysaccharide

[0099] Preparation of ABTS working solution: Accurately weigh 0.3843 g of ABTS and dissolve it in 100 mL of distilled water to obtain 7 mmol / L ABTS; weigh 0.0662 g of potassium persulfate and dissolve it in 100 mL of distilled water to obtain 2.45 mmol / L potassium persulfate. Mix the two solutions in equal volumes at a 1:1 ratio, and let them stand in the dark at room temperature for 12 hours before use. They are stable for 2–3 days. Dilute the mixed solution with PBS to a certain factor so that the absorbance at 734 nm is 0.7 ± 0.02.

[0100] Sample solution preparation: Accurately weigh an appropriate amount of Beauveria bassiana BC-01 mycelial polysaccharide prepared in Example 2, dissolve it in PBS, and prepare a 5 mg / mL sample solution. Serially dilute the above sample solution to obtain sample solutions of 1, 2, 3, 4, and 5 mg / mL, respectively.

[0101] ABTS scavenging ability: After mixing 200 μL of ABTS working solution with 10 μL of samples of different concentrations, the solution was placed at room temperature in the dark for 5 min, and the absorbance was measured at 734 nm. This value is recorded as A. t Distilled water was used as a blank control and recorded as A0. 200 μL of PBS solution was reacted with 10 μL of sample in the same way and the absorbance value was recorded and recorded as A2.

[0102]

[0103] The higher the clearance rate, the stronger the antioxidant capacity. The test results are shown in Table 3.

[0104] Table 3 ABTS free radical scavenging rate

[0105] Concentration (mg / mL) 1 2 3 4 5 6 7 Clearance rate / % 13.62 22.52 23.39 24.1 24.95 34.25 38.76

[0106] Table 3 shows that the mycelial polysaccharide has a good ability to scavenge ABTS free radicals, exhibiting a dose-increasing effect within the range of 0.1 mg / mL to 7 mg / mL. At a concentration of 7 mg / mL, its scavenging rate reaches 38.76%.

[0107] (3) Total reducing power of polysaccharides from Beauveria bassiana BC-01 mycelium

[0108] Solution preparation: 1% potassium ferricyanide, phosphate buffer (PBS, 0.2 mol / L, pH=6.6), 10% trichloroacetic acid.

[0109] Sample solution preparation: Accurately weigh an appropriate amount of Beauveria bassiana BC-01 mycelial polysaccharide prepared in Example 2, dissolve it in PBS, and prepare a 5 mg / mL sample solution. Serially dilute the above sample solution to obtain sample dilutions of 1, 2, 3, 4, and 5 mg / mL, respectively.

[0110] Total reducing power: Accurately measure 800 μL of each sample dilution, add 400 μL each of PBS and potassium ferricyanide solution, react at 50℃ for 50 min, and cool to room temperature; then add 400 μL of 10% centrifuged TCA aqueous solution (trichloroacetic acid), 1.6 mL of distilled water, and 400 μL of 0.1% ferric chloride aqueous solution, incubate at room temperature for 10 min, and measure the absorbance at 700 nm. The formula for calculating the total reducing power is as follows:

[0111] Total reducing power A = Sample A - Blank A

[0112] The test results are shown in Table 4.

[0113] Table 4 Overall Restoring Capacity

[0114] Concentration mg / mL 1 2 3 4 5 Total reducing power 0.1184 0.1679 0.1732 0.2087 0.2382

[0115] As shown in Table 4, mycelial polysaccharides have good reducing ability, and the overall reducing ability of mycelial polysaccharides increases continuously in the range of 1 mg / mL to 5 mg / mL.

[0116] Example 5: The ability of Beauveria bassiana BC-01 mycelial polysaccharide to inhibit tyrosinase

[0117] Preparation of tyrosinase solution: Prepare and dilute to 100 U / mL with PBS (pH=6.8), use immediately after preparation. Levodopa: Prepare to 1 mg / mL with PBS (pH=6.8).

[0118] Preparation of sample solutions: Accurately weigh an appropriate amount of Beauveria bassiana BC-01 mycelial polysaccharide prepared in Example 2, dissolve it in PBS, and prepare a 10 mg / mL sample solution. Serially dilute the above sample solution to obtain sample solutions of 1, 2, 3, 4, 5, 8, and 10 mg / mL, respectively.

[0119] Tyrosinase inhibition: Add 1 mL of sample solution of the same concentration to both the sample tube (T) and the sample background (T0), and add 1 mL of phosphate buffer to both the enzyme reaction tube (C) and the solvent background (C0). Add 0.5 mL of tyrosinase solution to both the sample tube (T) and the enzyme reaction tube (C), replacing the sample background (T0) and solvent background (C0) with 0.5 mL of phosphate buffer. Mix the sample and tyrosinase thoroughly and incubate in a 37°C water bath for 10 min. Add 2 mL of levodopa solution to each tube sequentially, controlling the reaction time for each tube to be 5 min, and measure the absorbance at 475 nm. Three parallel tubes should be prepared for each sample tube (T) and each enzyme reaction tube (C) for each tested concentration. T—Absorbance of the sample tube, i.e., absorbance of the solution after the sample reacts with tyrosinase; T0—Absorbance of the sample background; C—Average of three absorbance values ​​of the enzyme reaction tube, i.e., absorbance of the reaction between tyrosinase and dopa without the addition of sample; C0—Absorbance of the solvent background.

[0120]

[0121] The tyrosinase inhibition capacity is shown in Table 5.

[0122] Table 5 Tyrosinase Inhibition Capacity

[0123] Concentration (mg / mL) 1 2 3 4 5 8 10 Inhibition rate / % 35.6 40.66 42.11 54.36 55.57 59.9 71.89

[0124] Table 5 shows that the polysaccharide from Beauveria bassiana mycelium has a good inhibitory effect on tyrosinase. The inhibition rate shows a dose-dependent relationship with concentration within the range of 1 mg / mL to 10 mg / mL, and the inhibition rate gradually increases with increasing concentration. When the concentration of the polysaccharide in this invention is 10 mg / mL, the inhibition rate reaches 71.89%. The IC50 value was obtained by fitting a Graph Pad Prism 9 curve. 50 The value was 0.5302 mg / mL.

[0125] Example 6: Growth-promoting effect of Beauveria bassiana BC-01 mycelial polysaccharide on Staphylococcus epidermidis

[0126] The Staphylococcus epidermidis strain used in this embodiment was screened in the laboratory and deposited at the China Center for Type Culture Collection on June 1, 2022. The strain name is Staphylococcus epidermidis CCSM0287 and the accession number is CCTCC No: M 2022779.

[0127] The effect of mycelial polysaccharides on the growth of *Staphylococcus epidermidis* was determined using a liquid culture method. Mycelial polysaccharide samples were prepared into solutions and filtered through a sterile 0.22 μm filter membrane for sterilization. Six half-dilutions were performed using a sterile 96-well plate, with four replicates for each group. 100 μL of sterile TSB medium was added to each well from well 2 to well 6 beforehand. First, 200 μL of the 8 mg / mL sample (prepared with sterile TSB) was added to well 1. Then, 100 μL of the solution from well 1 was added to well 2, and the process was repeated until well 6. 100 μL of sterile TSB medium was added to well 6, and after thorough mixing, 100 μL of the liquid was discarded. Next, 100 μL of *Staphylococcus epidermidis* suspension was added to wells 1 through 6 of the 96-well plate. Sample group (a): 100 μL of each half-dilution sample + 100 μL of 10... 6 CFU / mL Staphylococcus epidermidis suspension; Sample control group (b): 100 μL of each half-diluted sample + 100 μL of sterile TSB medium; Negative control group (c): 200 μL of sterile TSB medium; Positive control group (d): 100 μL of 10 6 A bacterial suspension of CFU / mL was added to 100 μL of sterile TSB medium and incubated at 37℃ for 48 h. Turbidity changes were observed, and the absorbance of each well at 600 nm was measured using a microplate reader. Each experiment was repeated three times. The growth-promoting effect of Beauveria bassiana BC-01 mycelial polysaccharide on Staphylococcus epidermidis is shown in [the following section is missing from the original text]. Figure 7 .

[0128] from Figure 7 It is known that the polysaccharide described in this invention promotes the growth of Staphylococcus epidermidis in the range of 0.25 mg / mL to 4 mg / mL, and significantly promotes the growth of Staphylococcus epidermidis when the polysaccharide concentration is 4 mg / mL. This may be because the Beauveria bassiana mycelial polysaccharide increases the carbon source in the culture of Staphylococcus epidermidis, allowing the bacteria to obtain energy for growth.

[0129] Example 7: Antibacterial effect of Beauveria bassiana BC-01 mycelial polysaccharide on Propionibacterium acnes

[0130] The *Propionibacterium acnes* used in this embodiment was a laboratory-preserved strain purchased from the American Type Culture Collection (ATCC), named *Propionibacterium acnes* 6919, with accession number ATCC No. 6919. The effect of mycelial polysaccharides on the growth of *Propionibacterium acnes* was determined using a liquid culture method. Mycelial polysaccharide samples were prepared into solutions and filtered through a sterile 0.22 μm filter membrane for sterilization. All procedures were performed under aseptic conditions. Six half-dilutions were performed using a sterile 96-well plate, with four replicates for each group. 100 μL of sterile TSB medium was added to each well from well 2 to well 6 beforehand. First, 200 μL of the 8 mg / mL sample (prepared with sterile TSB) was added to well 1. Then, 100 μL of the solution from well 1 was added to well 2, and the process was repeated until all six wells were reached. 100 μL of sterile TSB medium was added to well 6, and after thorough mixing, 100 μL of the liquid was discarded. Next, 100 μL of Propionibacterium acnes suspension was added to wells 1 through 6 of the 96-well plate. Sample group (a): 100 μL of each half-dilution sample + 100 μL of 10... 5 CFU / mL Propionibacterium acnes suspension; Sample control group (b): 100 μL of each half-diluted sample + 100 μL of sterile TSB medium; Negative control group (c): 100 μL of sterile TSB medium + 100 μL of sterile water; Positive control group (d): 100 μL of 10... 5 A bacterial suspension of CFU / mL was added to 100 μL of sterile TSB medium and incubated anaerobically at 37℃ for 48 h. Turbidity changes were observed, and the absorbance of each well at 600 nm was measured using a microplate reader. Each experiment was repeated three times. The antibacterial effect of mycelial polysaccharides on Propionibacterium acnes is shown in [the following section is missing from the original text]. Figure 8 .

[0131] The polysaccharide described in this invention promotes the growth of *Propionibacterium acnes* at concentrations of 0.25 mg / mL to 1 mg / mL, but significantly inhibits its growth at concentrations of 2 mg / mL to 4 mg / mL, with the best inhibitory effect observed at a concentration of 4 mg / mL. This indicates that the polysaccharide from *Beauveria bassiana* BC-01 mycelium has an inhibitory effect on *Propionibacterium acnes*.

[0132] Example 8: Immunoactivating effect of Beauveria bassiana mycelial polysaccharide

[0133] (1) Cytotoxicity test

[0134] RAW264.7 macrophages were cultured normally in DMEM medium (10 mL / L) containing 10% fetal bovine serum at 37°C and 5% CO2. When the cells reached 80-90% confluence, they were digested with trypsin and cultured at 8 × 10⁻⁶ cells / day. 5Cells were seeded at a density of cells / mL in 96-well plates. After 24 h of cell adhesion, different amounts of Beauveria bassiana mycelial polysaccharide solution were added and cultured for 24 h. The initial polysaccharide concentration was 5 mg / mL. Induction group (LPS, concentration 15.63 μg / mL–500 μg / mL) and positive control group (DEX, dexamethasone 80 μM) were set up, with 3 parallel wells for each experimental group. The LPS was used to activate macrophages; the DEX was used as a positive control. After treatment, CCK-8 reagent was added and incubated for 1 h according to the manufacturer's instructions. The absorbance was measured at 450 nm, and relative cell viability was calculated. If cell viability was less than 90%, cytotoxicity was considered.

[0135] Relative cell viability % = (OD value of sample group / OD value of control group) × 100%

[0136] like Figure 9 As shown, the polysaccharide of the present invention showed no cytotoxicity to RAW264.7 when added at concentrations of 15.63 μg / mL to 125 μg / mL. Subsequent experiments were conducted using sample concentrations of 31.25 μg / mL to 125 μg / mL.

[0137] (2) Measurement of cytokines

[0138] Based on the cell viability results, BC-01 samples with added concentrations of 31.25 μg / mL, 62.5 μg / mL, and 125 μg / mL were selected as sample groups for LPS (1 μg / mL)-induced cell inflammation experiments. A positive control group (DEX, dexamethasone 80 μM) was also established. The levels of TNF-α, IL-6, and NO cytokines were detected using an ELISA kit.

[0139] Depend on Figure 9 It was observed that, compared with the control group, the addition of LPS significantly increased the levels of IL-6 and TNF-α in the supernatant, with extremely significant differences. NO content gradually decreased with increasing polysaccharide content. The expression levels of IL-6, NO, and TNF-α in the positive group (dexamethasone) were significantly decreased. Therefore, it can be considered that the test model group and the positive group functioned normally, and the experimental system was effective. Compared with the model group, 125 μg / mL polysaccharide significantly promoted the expression of IL-6 and TNF-α in RAW264.7 cells (P < 0.1, P < 0.05), and polysaccharide levels between 31.25 μg / mL and 125 μg / mL promoted NO production in RAW264.7 cells. These results indicate that mycelial polysaccharides promote increased cytokine levels, demonstrating immune activity.

[0140] Example 9: Beauveria bassiana mycelial polysaccharide inhibits melanin synthesis in B16 cells

[0141] (1) Cytotoxicity test

[0142] B16-F10 mouse melanocytes (B16) were purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection Committee. B16 cell viability assay: B16 cells were cultured normally in DMEM medium containing 10% FBS at 37°C with 5% carbon dioxide. When the cells reached 90% confluence, they were cultured at a rate of 2 × 10⁻⁶ cells / year. 4 Cells were seeded at a density of 0.5–10 mg / mL in 96-well plates. After 48 hours of cell adhesion, different concentrations of sample (0.5–10 mg / mL) were added for 72 hours. Following this, CCK-8 reagent was added and the cells were incubated for 1 hour. The absorbance was measured at 450 nm. Cell viability was considered cytotoxic if it was less than 90%.

[0143]

[0144] like Figure 10 As shown, the polysaccharide BC-01 of the present invention showed no cytotoxicity to B16 cells when the concentration was between 0.5 mg / mL and 1.5 mg / mL. Therefore, samples with a concentration of 0.5 mg / mL to 1.5 mg / mL were subsequently used to treat B16 cells.

[0145] (2) B16 melanin content test

[0146] Select B16 cells in optimal growth condition and arrange them at a ratio of 1×10⁻⁶. 5 B16 cells were seeded at a density of 1 / mL in 12-well plates and allowed to adhere for 48 hours. Three safe concentrations of samples were then used to treat the cells. Kojic acid (10 mM) and arbutin (10 mM) were used as positive controls. After 72 hours, 1N NaOH solution containing 10% DMSO was added to the B16 cells. The plates were then sealed at 80°C for 1 hour, and the absorbance was measured at 405 nm to assess the total melanin content of the B16 cells.

[0147] Based on the above, B16 cells were treated with different concentrations of BC-01, and the effect on intracellular melanin content was measured. The results are as follows: Figure 10 The results showed that, compared with the control group, mycelial polysaccharide BC-01 at concentrations of 0.5 mg / mL to 1.5 mg / mL reduced intracellular melanin content. At a concentration of 1.5 mg / mL, the melanin content decreased by 25% compared with the control group, a significant difference. Therefore, mycelial polysaccharide BC-01 has a good whitening effect.

[0148] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

[0149] The sequences involved in the embodiments of this application are summarized as follows:

[0150] SEQ ID No. 1 (Nucleic acid sequence of primer ITS1):

[0151] 5'-TCCGTAGGTGAACCTGCGG-3';

[0152] SEQ ID No. 2 (Nucleic acid sequence of primer ITS4):

[0153] 5'-TCCTCCGCTTATTGATATGC-3';

[0154] SEQ ID No. 3 (ITS nucleotide sequence of Beauveria bassiana BC-01 strain):

[0155] GCGGTCTTGGAGCTTCACTCCCTACCCTTCTGTGACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGGACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGGCGGGAGGAAG

Claims

1. A polysaccharide from Beauveria bassiana mycelium, characterized in that, The polysaccharide was isolated from the mycelium of Beauveria bassiana strain BC-01, which was deposited on January 18, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41044. The preparation method of the Beauveria bassiana mycelial polysaccharide is as follows: S1. Preparation of Beauveria bassiana mycelium: Seed culture: Fresh bacterial cells are inoculated into liquid seed culture medium and cultured on a shaker to obtain primary seed culture. The primary seed culture is then inoculated into seed culture medium at an inoculation rate of 5%~10% V / V to obtain secondary seed culture. Fermentation culture: The secondary seed culture was inoculated into the basic fermentation medium at an inoculation rate of 5%~10% V / V and cultured to obtain fermentation broth; the mycelium was collected by centrifugation of the fermentation broth, washed 3 times with distilled water, and freeze-dried to obtain freeze-dried mycelium; S2. Preparation of polysaccharides from Beauveria bassiana mycelium: Weigh out a quantity of freeze-dried mycelium and pass it through an 80-mesh sieve. Use hot water extraction to obtain the extract. Centrifuge the extract, combine the filtrates, and concentrate to 1 / 4 to 1 / 3 of the original volume. After alcohol precipitation, centrifuge to collect the precipitate, add a small amount of water to dissolve and dialyze. Freeze-dry to obtain Beauveria bassiana mycelial polysaccharide.

2. The Beauveria bassiana mycelial polysaccharide according to claim 1, characterized in that, The mycelial polysaccharides include the following monosaccharides: fucose, galactose, glucose, and mannose.

3. The Beauveria bassiana mycelial polysaccharide according to claim 2, characterized in that, The molar ratio of fucose, galactose, glucose, and mannose is 0.103:1.205:14:0.

678.

4. The Beauveria bassiana mycelial polysaccharide according to claim 1, characterized in that, The liquid seed culture medium in step S1 is potato glucose liquid culture medium, which, by mass percentage, includes: 20% glucose, 20% potato extract powder, 2% tryptone, 1.5% K2HPO4, 2% MgSO4·7H2O, and the remainder is water; the basic fermentation culture medium includes the following components at the following concentrations: 20 g / L glucose, 200 g / L potato, and water as the solvent.

5. The Beauveria bassiana mycelial polysaccharide according to claim 1, characterized in that, The conditions for culturing the primary and secondary seed solutions in step S1 are: 140~160 r / min, 25~27℃; the culturing times for the primary and secondary seed solutions are 70~74 h and 46~50 h, respectively.

6. The Beauveria bassiana mycelial polysaccharide according to claim 1, characterized in that, The fermentation conditions in step S1 are 140~160 r / min, 25~27℃, and 115~125 h; the centrifugation conditions are 7000~9000 r / min, 2~4℃, and 8~12 min.

7. The Beauveria bassiana mycelial polysaccharide according to claim 1, characterized in that, In step S2, the hot water extraction method has the following characteristics: the material-to-liquid ratio is 1:(28~32), the extraction temperature is 90℃, the extraction time is 2 h, and the extraction is performed 3 times. The centrifugation conditions for the extract were 7000~9000 r / min, 2~4℃, and 8~12 min. The alcohol precipitation is performed by adding 2.9 to 3.1 times the volume of anhydrous ethanol to the concentrate and precipitating at 2 to 4°C for 20 to 24 hours. The conditions for centrifugation to collect the precipitate are: centrifugation at 4400~5000 r / min for 8~15 min to collect the precipitate; The dialysis duration is 45-50 hours.

8. The application of the Beauveria bassiana mycelial polysaccharide as described in claim 1 in the preparation of cosmetics with whitening and antioxidant effects.

9. The use of the Beauveria bassiana mycelial polysaccharide as described in claim 1 in the preparation of acne treatment drugs.

Citation Information

Patent Citations

  • Antioxidant and moisturizing extracellular polysaccharides produced by Beauveria bassiana T2-2 and their applications

    CN110903985B