A strain of Talaromyces stollii T-12, microbial inoculum and application

Abstract

The present invention discloses a strain of Talaromyces stollii T-12, a microbial inoculum and its application, belonging to the technical field of biological control. This strain was deposited at the General Microbiological Center of the China Center for Type Culture Collection on December 9, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 41659. The Talaromyces stollii T-12 disclosed by the present invention is a fungus isolated from soil and can colonize well in the soil. The present invention first discovers that this fungus has obvious inhibitory effects on Sporisorium scitamineum, Pseudomonas rubrilineans and Fusarium moniliforme var. subglutinans, and can be applied to the prevention and control of sugarcane smut, sugarcane brown stripe disease and sugarcane top rot disease. Especially, it has excellent control effect on sugarcane smut and has potential application value. At the same time, it also has certain growth-promoting potential and the ability to produce siderophores, and has broad prospects for popularization and application.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, and in particular to a strain of Stahl's blue bacteria T-12, a microbial agent and application thereof. Background Art

[0002] Sugarcane is the most important sugar crop in my country, and is also an important raw material and strategic resource for light industry, chemical industry and energy. Sugarcane pests and diseases are important restrictive factors in sugarcane production, which can cause serious losses in sugarcane yield and quality. Sugarcane smut is a systemic fungal disease caused by Sporisorium scitamineum. Sugarcane smut belongs to heterothallic mating, and its life history goes through two stages: haploid sporophyte and binucleate mycelium. The haploid stage can only grow by budding and does not have infectivity and pathogenicity. Haploid spores of different mating types form binucleate mycelium with infectivity and pathogenicity after sexual mating, leading to disease. The disease is prevalent in all sugarcane-growing countries and is also one of the diseases that causes the most serious economic losses in China's sugarcane production. The economic losses caused by sugarcane smut on dry land and ratoon sugarcane are particularly serious. The incidence of ratoon sugarcane can reach 80% to 90%, causing a 20% to 50% loss in sugarcane yield, and the economic losses caused can reach billions each year. Sugarcane brown streak disease is one of the main leaf fungal diseases in the middle and late stages of sugarcane growth. In my country, the disease has repeatedly broken out and caused disasters, causing serious economic losses. In seriously affected fields, the incidence of brown streak disease is more than 80%, and the general yield reduction is 18% to 35%, and the severe cases can reach more than 40%, and the sugar content of sucrose is reduced by 15% to 30%. Sugarcane tip rot is an important global sugarcane fungal disease. Sugarcane tip rot is distributed and harmed in all sugarcane-growing provinces and regions in China. Especially in recent years, there have been many rainy and humid years, and the large-scale planting of susceptible varieties has led to the outbreak of sugarcane tip rot in my country's sugarcane areas, resulting in serious reductions in production and sugar. The survey results show that the disease is serious in susceptible varieties, often causing a large number of sugarcane stems to die, with an average disease rate of 81.1%, and up to 100% in severe cases; the measured yield loss of sugarcane is an average of 38.42%, and up to 48.5% in severe cases; the sugar content of sugarcane is reduced by an average of 3.14%, and in severe cases it is reduced by up to 4.21%.

[0003] Breeding and planting disease-resistant varieties is the most economical and effective measure to control fungal diseases of sugarcane. However, due to the complexity and variability of pathogens and the long breeding cycle of sugarcane, there is a severe shortage of varieties with strong disease resistance, excellent agronomic traits, and suitable for large-scale planting in current production. Due to the characteristics of low cost and quick effect of chemical control, chemical agents are mainly used to control fungal diseases of sugarcane during the planting process. However, chemical control easily leads to the development of drug resistance in pathogens, and also causes pesticide residues, destroys the ecological environment, and threatens human health. Biological control, with the main development concept of being green and environmentally friendly, has become a research hotspot for plant disease control at home and abroad due to its advantages of being environmentally friendly, having rich exploitable resources, and low production cost. As a component of the plant microbial system, biocontrol fungi can promote plant growth through various mechanisms, can minimize the ecological threats caused by chemical inputs in the soil and crops, and have good prospects. Therefore, screening more biocontrol microorganisms for controlling fungal diseases of sugarcane and providing biocontrol fungal resources with good control effects for fungal diseases of sugarcane are technical problems that need to be solved urgently by those skilled in the art.

[0004] Fungi of the genus Talaromyces generally have good adaptability to the natural environment and adversity. Such fungi play an important role in production practice. Some strains have the ability to dissolve phosphorus and produce cellulase, and some strains can be used as pigment-producing bacteria. In addition, some Talaromyces flavus, Talaromyces purpureogenus, etc. have application potential in plant disease control. There is no report in the prior art on using Talaromyces stollii to control fungal diseases of sugarcane. Summary of the Invention

[0005] The purpose of the present invention is to provide a strain of Talaromyces stollii T-12, a microbial inoculum, and its application to solve the problems existing in the above prior art. The Talaromyces stollii T-12 disclosed by the present invention has obvious inhibitory effects on Sporisorium scitamineum, Pseudomonas rubrilineans, and Fusarium moniliforme var. subglutinans of sugarcane, especially has a significant effect on inhibiting the growth and development of the dikaryotic mycelium of Sporisorium scitamineum of sugarcane. In addition, the Talaromyces stollii T-12 has the potential to promote growth by producing siderophores.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a strain of Talaromyces stollii T-12, which was deposited on December 09, 2024, at the China General Microbiological Culture Collection Center, with the deposit address being No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being CGMCC No. 41659.

[0008] The second technical solution of the present invention is a microbial inoculant, including the Talaromyces stollii T-12.

[0009] The third technical solution of the present invention is the application of the Talaromyces stollii T-12 or the microbial inoculant in preventing and controlling sugarcane diseases.

[0010] The fourth technical solution of the present invention is the application of the Talaromyces stollii T-12 or the microbial inoculant in the preparation of products for preventing and controlling sugarcane diseases.

[0011] The fifth technical solution of the present invention is a method for preventing and controlling sugarcane diseases, using the Talaromyces stollii T-12 or the microbial inoculant to prevent and control sugarcane diseases.

[0012] The sixth technical solution of the present invention is the application of the Talaromyces stollii T-12 or the microbial inoculant in siderophore production.

[0013] The seventh technical solution of the present invention is the application of the Talaromyces stollii T-12 or the microbial inoculant in the preparation of products for siderophore production.

[0014] The eighth technical solution of the present invention is the application of the Talaromyces stollii T-12 or the microbial inoculant in promoting plant growth.

[0015] Based on the above technical solutions, the present invention has the following technical effects:

[0016] The Talaromyces stollii T-12 disclosed in the present invention is a fungus isolated from soil and can colonize well in the soil. The present invention for the first time discovers that this fungus has an obvious inhibitory effect on Sporisorium scitamineum, Pseudomonas rubrilineans, and Fusarium moniliforme var. subglutinans, and can be applied to prevent and control sugarcane smut, sugarcane brown stripe, and sugarcane top rot. Especially, it has an excellent control effect on sugarcane smut and has potential application value; at the same time, it also has a certain growth-promoting potential, the ability to produce siderophores, and broad prospects for popularization and application. Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0018] Figure 1The figure shows the antibacterial effect of Talaromyces stollii T-12 against Sporisorium scitamineum, Pseudomonas rubrilineans, and Fusarium moniliforme in an in vitro plate confrontation culture; among them, A. dikaryotic mycelium of Sporisorium scitamineum (left: treatment, right: control); B. Pseudomonas rubrilineans (left: treatment, right: control); C. Fusarium moniliforme (left: treatment, right: control).

[0019] Figure 2 The figure shows the colony morphological characteristics of Talaromyces stollii T-12.

[0020] Figure 3 The figure shows the morphological characteristics of the conidiophores of Talaromyces stollii T-12.

[0021] Figure 4 The figure shows the phylogenetic tree of Talaromyces stollii T-12.

[0022] Figure 5 The figure shows the results of Talaromyces stollii T-12 inhibiting the growth and development of the dikaryotic mycelium of Sporisorium scitamineum. Among them, A is the phenotypic diagram of the dikaryotic mycelium of Sporisorium scitamineum cultured alone; B is the phenotypic diagram of the dikaryotic mycelium of Sporisorium scitamineum co-cultured with Talaromyces stollii T-12.

[0023] Figure 6 The figure shows the effect of Talaromyces stollii T-12 in producing siderophores.

[0024] Figure 7 The figure shows the biocontrol effect of Talaromyces stollii T-12 against Sporisorium scitamineum. Detailed implementation manners

[0025] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the description of this invention, which will be obvious to those skilled in the art. Other embodiments obtained from the description of this invention will be obvious to those skilled in the art. The description and examples of this application are merely exemplary.

[0029] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0030] The technical solutions described in this invention, unless otherwise specified, are all conventional solutions in the art. The reagents or raw materials used, unless otherwise specified, are all purchased from commercial channels or have been made public.

[0031] An embodiment of this invention provides a strain of Talaromyces stollii T-12, which was deposited at the General Microbiology Center of the China Microbial Culture Collection Center on December 09, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 41659.

[0032] An embodiment of this invention also provides a microbial inoculant, including the said Talaromyces stollii T-12.

[0033] An embodiment of this invention also provides the application of the said Talaromyces stollii T-12 or the said microbial inoculant in preventing and controlling sugarcane diseases.

[0034] An embodiment of this invention also provides the application of the said Talaromyces stollii T-12 or the said microbial inoculant in the preparation of products for preventing and controlling sugarcane diseases.

[0035] In some specific embodiments, the sugarcane diseases include sugarcane diseases caused by Sporisorium scitamineum, Pseudomonas andropogonis, and / or Fusarium moniliforme var. subglutinans.

[0036] An embodiment of this invention also provides a method for preventing and controlling sugarcane diseases, using the said Talaromyces stollii T-12 or the said microbial inoculant to prevent and control sugarcane diseases.

[0037] In some specific embodiments, the sugarcane diseases include sugarcane diseases caused by Sporisorium scitamineum, Pseudomonas andropogonis, and / or Fusarium moniliforme f. sp. alidonis.

[0038] The embodiments of the present invention also provide the application of the Talaromyces stollii T-12 or the microbial inoculum in the production of siderophores.

[0039] The embodiments of the present invention also provide the application of the Talaromyces stollii T-12 or the microbial inoculum in the preparation of products for producing siderophores.

[0040] The embodiments of the present invention also provide the application of the Talaromyces stollii T-12 or the microbial inoculum in promoting plant growth.

[0041] Through experiments, when the Talaromyces stollii T-12 provided by the present invention is co-cultured with the dikaryotic hyphae of Sporisorium scitamineum, the growth and development of the dikaryotic hyphae of Sporisorium scitamineum can be effectively inhibited. In addition, the Talaromyces stollii T-12 shows good antibacterial effects against Pseudomonas andropogonis and Fusarium moniliforme f. sp. alidonis.

[0042] The dikaryotic hyphae of Sporisorium scitamineum, Pseudomonas andropogonis, and Fusarium moniliforme f. sp. alidonis used in the embodiments of the present invention are the pathogenic bacteria of sugarcane smut, sugarcane brown stripe, and sugarcane top rot, respectively, and are isolated from diseased sugarcane tissues.

[0043] Example 1

[0044] Screening of Talaromyces stollii T-12

[0045] 1. Isolation of potential biocontrol bacteria

[0046] Soil samples were evenly taken from a sugarcane continuous cropping field in Gengma, Yunnan. 10 g of the collected soil samples were weighed and added to 90 mL of sterile water, and then cultured with shaking at 150 rpm at room temperature for 30 min. After that, the supernatant was aspirated and the biocontrol bacteria were isolated on PDA medium by the 10-fold serial dilution method. 100 μL of the soil dilution was evenly spread on each plate and cultured in the dark at 28 °C for 1-2 d. After the colonies grew out, the fungi with different colony morphologies were picked, purified, propagated, and stored for later use, named T-12.

[0047] 2. Screening of antagonistic bacteria by the plate confrontation method

[0048] The target fungi are: the dikaryotic mycelium of Sporisorium scitamineum, Pseudomonas andropogonis, and Fusarium moniliforme Sheld. Experimental group: Use a 5-mm punch to punch out fungal discs from strain T-12 and the target fungi, and place them in the center of a 7-cm PDA medium plate respectively. Strain T-12 is placed 2 cm away from the fungal disc, and then cultured in a constant temperature incubator at 28°C for 7 days. Blank control group: Punch out 5-mm fungal discs from the three target fungi, namely the dikaryotic mycelium of Sporisorium scitamineum, Pseudomonas andropogonis, and Fusarium moniliforme Sheld, and place them in the center of a 7-cm PDA medium plate respectively, and then culture them in a constant temperature incubator at 28°C for 7 days.

[0049] The calculation formula is as follows: Inhibition rate (%) = (colony diameter of the blank control group - colony diameter of each experimental group) / (colony diameter of the blank control group - diameter of the fungal disc) × 100.

[0050] At the end of the experiment, calculate the inhibition rate. The experimental results in Table 1 are the inhibitory effects of strain T-12 on three sugarcane pathogenic fungi.

[0051] Table 1 Inhibitory effects of strain T-12 on three sugarcane pathogenic fungi

[0052]

[0053]

[0054] From Figure 1 Table 1, it can be seen that strain T-12 has a certain inhibition rate on the dikaryotic mycelium of Sporisorium scitamineum, Pseudomonas andropogonis, and Fusarium moniliforme Sheld, especially has a good inhibitory effect on the dikaryotic mycelium of Sporisorium scitamineum. Thus, it can be known that strain T-12 has a control effect on most sugarcane fungal diseases.

[0055] 3. Morphological characteristics of the selected strain T-12: On Czapek yeast extract agar (CYA) at 28°C for 7 days, the colony of T-12 is circular, with a velvety texture, and the surface is covered with a large amount of flocculent mycelium; there are a large number of conidia, which are pea green; the center of the back of the colony is light ochre salmon color mixed with light yellow. On malt extract agar (MEA) at 28°C for 7 days, the texture is velvety and the surface is covered with a large amount of white flocculent mycelium; there are a large number of conidia, ranging from pea green to sage green; the back of the colony is ochre ( Figure 2 ). The conidiophores have smooth walls; the penicilli are biverticillate and sometimes triverticillate; there are 3-6 metulae per whorl, arranged closely; the phialides are lanceolate, arranged closely, 4-6 per whorl, and the conidia are ellipsoidal with smooth walls ( Figure 3 ).

[0056] 4. Molecular biological identification of the obtained strain T-12: The genomic DNA of T-12 mycelium was extracted using the Fast DNA Extraction Kit of Tiangen Biochemical Technology Co., Ltd. Using the extracted DNA as a template, the ITS, BenA, and RPB2 sequences were amplified with the 3 pairs of primers in Table 2 respectively.

[0057] Table 2 Primers for molecular identification of Talaromyces stollii

[0058]

[0059] The ITS sequence of strain T-12 is shown in SEQ ID NO.7:

[0060] SEQ ID NO.7: CGAGTGCGGGGCCCTCGTGGCCCAACCTCCCACCCTTGTCTC TATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGTTCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCG TGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGGCCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGAAGGACTGGCGGGGGTTGGTCACCACCACAAAATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA;

[0061] The BenA sequence of strain T-12 is shown in SEQ ID NO.8:

[0062] SEQ ID NO.8: TAACCAAATCGGTGCTGCTTTCTGGTGAGTTTGACTCGACCC AAACTTTCTATCAATTGTCGCGGCGGCACGCTGACTTGTACAGGCAAATTATCTCTGCTGAGCACGGTCTCGATGGCTCTGGTGTGTAAGTATTTCACAATTCGAATACACCTACTGTCCGAGGTTATCTGATCATCGACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTTTGAAAGTTTCTCGACTCCTGCAGAACAAACACTTATTCAGCTAGGCCTCCGGCAACAAATACGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCCTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACTGAGGG;

[0063] The RPB2 sequence of strain T-12 is shown in SEQ ID NO.9:

[0064] SEQ ID NO.9: CGCTACGCTTTTCCGAACTCTTTTCACCCGTGTTACAAGAGAT CTCACCCGTTACGTCCAACGATGCGTTGAAACAAACCGCGAAGTGGTTCTCAACGTGGGTCTCAAGCCAGCCACCCTTACAGGTGGTTTGAAATATGCTCTCGCTACTGGCAATTGGGGTGAACAGAAGAAGGCAATGAGCTCGAAAGCAGGTGTTTCCCAGGTGCTCAGTCGATACACCTTTGCCTCCACTTTGTCTCATTTGAGACGTACCAATACTCCTATTGGTCGTGATGGAAAAATCGCTAAACCTCGTCAGCTACATAACACGCACTGGGGTTTGGTTTGTCCTGCTGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCTTTGATGTGCTCTATTACAGTGGGCTCTCCCAGTGAGCCTATCGTTGATTTCATGATTCAGAGAAACATGGAAGTGCTTGAGGAATTTGAACCGCTAGTTACGCCTCATGCCACCAAGGTCTTCGTCAATGGTGTTTGGGTTGGTGTTCATCGTGATCCAGCTCACTTGGTCAGCACAGTCCAGTCACTCCGTCGACGGAACATGATTTCACATGAAGTCAGTTTGGTTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACCGATGCCGGTCGTGTTTGTCGACCACTTTTCGTCATTGACAACGATCCGCGAAGTGAGAACTGCGGATCCTTGGTGCTCAACAAAGATCATATTCGCAGACTTGAAGCAGACCGTGAGCTTCCACCAGATCTCGACCCCGAAGAGCGAAGGGAACAGTATTACGGCTGGGAGGGTCTTGTCAAGTCAGGAGTCATTGAATACGTTGATGCTGAAGAGGAGGAAACCATTATGATTGCCATGTCTCCCGAAGATCTCGAAATCTCGAAACAGCTACAAGCCGGGTATGCTCTGCCTGAAGACAATAGCGACCCAAATAAGCGTGTCCGCTCAGTGCTGAGTCAACGGGCGCATATCTGGACTCACTGTGAGATTCATCCAAGTATGATTCTTGGTATCTGCGCCAGTATCATTC。

[0065] The PCR reaction system and amplification program were as follows: The PCR reaction system was 25 μL, containing 12.5 μL of 2×EasyTag PCR SuperMix (TransGen), 1 μL each of the forward primer and the reverse primer, 1 μL of DNA template, and double-distilled water was added to make up to 25 μL.

[0066] The PCR amplification program was 3 min at 94 °C; 30 s at 94 °C, 40 s at 58 °C (ITS / BenA) or 50 °C (RPB2), 1 min at 72 °C, for a total of 35 cycles; 10 min at 72 °C; and stored at 4 °C.

[0067] After the amplified products were detected by 1.2% agarose gel electrophoresis, they were sent to BGI for sequencing to obtain the gene sequences. The original sequences were manually checked and edited using the biological software Bioedit 7.0.9. Taking the type strains of the reported species in the genus Talaromyces as references, the single-gene sequences were spliced into a multi-gene sequence combination of BenA-RPB2-ITS, and an NJ phylogenetic tree was constructed using MEGA7.0. It was Figure 4 found that strain T-12 clustered into one clade with Talaromyces stollii with a bootstrap value of 100%.

[0068] The strain T-12 was identified as Talaromyces stollii by morphological and molecular biological methods and named Talaromyces stollii T-12. Talaromyces stollii T-12 was deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 09, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 41659.

[0069] Example 2

[0070] Inhibitory effect of Talaromyces stollii T-12 on the growth and development of the dikaryotic mycelium of Sporisorium scitamineum

[0071] Using a 5 mm puncher, mycelial plugs were taken from the edges of the colonies of Talaromyces stollii T-12 and the dikaryotic mycelium of Sporisorium scitamineum and inoculated onto PDA plates (Φ = 90 mm). The two mycelial plugs were 2 cm apart. After confrontation culture for 5 days, the dikaryotic mycelium of Sporisorium scitamineum near the end of Talaromyces stollii T-12 was picked for microscopic observation. As Figure 5 shown, Talaromyces stollii T-12 has a significant inhibitory effect on the growth and development of the dikaryotic mycelium of Sporisorium scitamineum.

[0072] Example 3

[0073] Detection of the siderophore secretion ability of Talaromyces stollii T-12

[0074] Siderophores refer to substances secreted by bacteria into the surrounding environment under iron-deficient conditions that have a strong specific chelating effect on Fe 3+ . The CAS plate method utilizes the fact that chrome azurol S (CAS), ferric ions, and hexadecyltrimethylammonium bromide (HTDMA) can form a sky-blue complex. The culture plate is stained with the CAS dye solution. When the strain releases ferric ions into the culture plate, the ternary complex is destroyed and turns yellow, that is, a yellow halo appears around the colony. Record the presence or absence of an orange halo on the medium. As Figure 6 can be seen, Talaromyces stollii T-12 shows a yellow halo on the CAS plate, indicating that it has great potential in promoting growth.

[0075] Example 4

[0076] Control effect of Talaromyces stollii T-12 on potted sugarcane smut

[0077] 4.1 Sugarcane planting: Select sugarcane with good growth, many sugarcane joints and abundant germ buds as the research object. The sugarcane variety is Yunzhe 08-1609. Cut the middle part of the sugarcane into single-bud segments and soak them in a water bath at 50°C for 2 hours. Plant the germ buds in a pot with a diameter of 30 cm and a height of 20 cm containing a mixed soil of 1:1:1 (ordinary soil: nutrient pond mud: substrate soil). Plant 3 sugarcane buds in each pot and place them in a greenhouse for cultivation. Water regularly to prevent sudden drought from affecting the growth of sugarcane.

[0078] 4.2 Sugarcane inoculation: Activate strain T-12 and the dikaryotic mycelium of Sporisorium scitamineum separately and culture them overnight until OD 600 = 2.5 for use. After 1 month of cultivation, the height of the sugarcane seedlings is approximately 30-40 cm. Select sugarcane seedlings with good growth and uniform size for inoculation. The treatment methods for the experimental groups are shown in Table 3. Select 30 sugarcane seedlings for inoculation treatment in each group of experiments. The inoculation amount is 1 mL of the treatment solution. Use a syringe to inject the inoculation solution into the sugarcane stem from the sugarcane stem part 3-5 cm above the ground. After inoculation, continue to cultivate the sugarcane for 3-5 months until most of the sugarcane in the control group gets sick, and then investigate the disease incidence of sugarcane under different treatments. At the harvest stage, cut the sugarcane stems for yield measurement.

[0079] 4.3 Control effect investigation: Investigate the disease incidence of sugarcane 4 months after inoculation, record the number of sugarcane plants infected with sugarcane smut under different treatments, and calculate the incidence rate.

[0080] Incidence rate (%) = Number of sugarcane plants with disease / Total number of sugarcane plants × 100.

[0081] Calculate the control effect of the experimental group on sugarcane smut according to the formula.

[0082] Control effect (%) = (Incidence rate of the control group - Incidence rate of the treatment group) × 100 / Incidence rate of the control group.

[0083] Table 3 Treatments for pot experiments

[0084]

[0085] From Table 3 and Figure 7 It can be seen that Talaromyces stollii T-12 can significantly inhibit the infection of sugarcane by Sporisorium scitamineum, reduce the incidence of sugarcane smut, and reduce the inhibitory effect of Sporisorium scitamineum on the growth of sugarcane.

[0086] As can be seen from the above embodiments, Talaromyces stollii T-12 provided by the present invention has obvious inhibitory effects on Sporisorium scitamineum, Pseudomonas rubrilineans, and Fusarium moniliforme Sheld. var. subglutinans, especially in significantly inhibiting the growth and development of the dikaryotic mycelium of Sporisorium scitamineum. This strain also has a growth-promoting effect and the ability to produce siderophores, and can be used as a resource of highly efficient disease-resistant and growth-promoting strains.

[0087] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the claims of the present invention.

Claims

1. A strain of Talaromyces stollii T-12, characterized in that: The strain was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 9, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.41659.

2. A microbial agent, characterized in that: The invention comprises the Stahl's blue bacteria T-12 as described in claim 1.

3. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in preventing and controlling sugarcane diseases, characterized in that: The sugarcane disease is caused by Sporisorium scitamineum, Bipolari setariae and / or Fusarium proliferatum.

4. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in the preparation of a product for preventing and controlling sugarcane diseases, characterized in that: The sugarcane disease is caused by Sporisorium scitamineum, Bipolarisetariae and / or Fusarium proliferatum.

5. A method for preventing and controlling sugarcane diseases, characterized in that: The sugarcane diseases are controlled by using the Stoller's blue fungus T-12 described in claim 1 or the microbial agent described in claim 2; the sugarcane diseases are caused by Sporisorium scitamineum, Bipolarisetariae and / or Fusarium proliferatum.

6. Use of the Stahl's blue bacteria T-12 as claimed in claim 1 or the microbial agent as claimed in claim 2 in producing siderophores.

7. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in the preparation of a product producing siderophore.

8. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in promoting plant growth, characterized in that: The plant is sugar cane.

Images