GALECTIN-1 gene knockout DC2.4 cell and application thereof in antigen presentation research

Abstract

The invention provides a DC2.4 cell with a GALECTIN-1 gene knocked out and application of the DC2.4 cell in antigen presentation research, and belongs to the technical field of gene engineering. The method comprises the following steps: constructing a recombinant CRISPR / Cas9 plasmid by using double-stranded DNA (Deoxyribonucleic Acid) as shown in SEQ ID No.3 and SEQ ID No.4, packaging the recombinant plasmid into a lentivirus, and infecting a cell by using the lentivirus, so as to obtain a cell in which the GALECTIN-1 gene is knocked out. A Western Blot detection result shows that the method realizes the knockout of the mouse GALECTIN-1 gene on the protein level, and the mouse GALECTIN-1 gene can be stably inherited. The sgRNA and the knockout vector disclosed by the invention can be used for directional knockout of the mouse GALECTIN-1 gene, have the characteristics of simplicity, convenience, high efficiency, rapidness, low cost and the like, and are of great significance in research on functions of the mouse GALECTIN-1 gene and antigen presentation of the mouse GALECTIN-1 gene in adaptive immunity.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to DC2.4 cells with GALECTIN-1 gene knocked out and applications thereof in antigen presentation research. Background Art

[0002] CRISPR / Cas9 technology is an adaptive immune system derived from bacteria and archaea and mediated by sgRNA (small guide RNA). The sgRNA is used to identify and bind to the target DNA. When the Cas9 protein activity is activated, it can bind to the DNA downstream of the region and cut it, generating double-stranded DNA breaks and inducing frameshift mutations caused by the non-homologous end joining repair mechanism, thereby editing the target gene. Due to its simplicity and high efficiency, CRISPR / Cas9 technology has been widely used in recent years as an important genetic means for site-specific editing of eukaryotic genes in the field of gene function research in humans, animals and plants.

[0003] Galectin-1 (GALECTIN-1) is the prototype galectin, an immunomodulatory protein that participates in immune responses by regulating the function of immune cells. For example, Galectin-1 can induce T cell apoptosis by binding to CD45 and CD7 on the surface of T cells. In addition, GALECTIN-1 has been widely studied in different fields such as cell biology and immunology, especially Galectin-1 is closely related to cancer biology. GALECTIN-1 can enhance oncogenic signaling pathways, regulate tumor cell growth or apoptosis, regulate cell migration and inhibit immune responses. Among them, GALECTIN-1 promotes tumor immune escape by participating in multiple pathways of innate and adaptive immunity of anti-tumor immunity. For example, GALECTIN-1 can regulate CD4 + T and CD + Differentiation and apoptosis of 8T cells. Knockdown of GALECTIN-1 can reduce CD4 + T and CD + 8T cell subsets, while GALECTIN-1 highly expressed in tumors can lead to abnormal function or inactivation of immune cells and promote tumor immune escape. In a mouse melanoma model, targeted inhibition of galectin-1 was associated with enhanced T cell-mediated tumor clearance, indicating a strong immunosuppressive effect on T cells. At the same time, GALECTIN-1 can also induce the recruitment and differentiation of tolerant dendritic cells and reduce the antigen presentation ability of macrophages. It can be inferred that GALECTIN-1 affects the differentiation and apoptosis of T cells and will be able to affect the ability of antigen presenting cells to present antigens. Therefore, it is speculated that GALECTIN-1 is closely related to adaptive immunity.

[0004] In the study of foot-and-mouth disease virus (FMDV), adaptive immunity plays an extremely important role. Antigen processing and presentation are the cornerstones of adaptive immunity and an important bridge between innate immunity and adaptive immunity. GALECTIN-1 affects the differentiation and apoptosis of T cells, but whether it affects the ability of antigen-presenting cells to present antigens is still unknown. Summary of the invention

[0005] In order to solve the above problems, the present invention provides DC2.4 cells with GALECTIN-1 gene knockout and the application thereof in antigen presentation research.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention also provides an sgRNA for knocking out the mouse GALECTIN-1 gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID No.1.

[0008] The present invention also provides a group of double-stranded DNAs, wherein the upstream sequence of the double-stranded DNA is shown as SEQ ID NO.3, and the downstream sequence of the double-stranded DNA is shown as SEQ ID NO.4.

[0009] The present invention also provides a recombinant vector comprising the sgRNA or the double-stranded DNA.

[0010] The present invention also provides a method for knocking out the GALECTIN-1 gene, comprising the following steps:

[0011] S1. Design a knockout target site according to the coding region sequence of the mouse GALECTIN-1 gene to obtain a sgRNA guide sequence; the sgRNA guide sequence is shown in SEQ ID NO.3 and SEQ ID NO.4;

[0012] S2. Anneal the designed sgRNA guide sequence to form a double-stranded DNA sequence, and then connect it to the vector to obtain a connection product; then introduce the connection product into Escherichia coli to obtain colonies, and extract plasmids from the colonies to obtain recombinant plasmids;

[0013] S3. mixing the recombinant plasmid with the lentiviral packaging vector to prepare a lentiviral targeting vector;

[0014] S4. Use lentiviral targeting vector to stably transform the cell line and obtain cells with GALECTIN-1 gene knockout.

[0015] Preferably, the lentiviral packaging vector comprises psPAX2 and pMD2.G; the mass ratio of the recombinant plasmid to psPAX2 and pMD2.G is 2 to 3:1 to 2:1.

[0016] Preferably, after stably transforming the cell line with the lentiviral targeting vector, the method further comprises the step of screening cells in which the GALECTIN-1 gene has been successfully knocked out: extracting genomic DNA of a single cell, using the extracted cell genomic DNA as a template, performing PCR amplification with primers, and sequencing and identifying the PCR product to obtain cells in which the GALECTIN-1 gene has been successfully knocked out.

[0017] Preferably, the primers are shown as SEQ ID No.5 and SEQ ID No.6.

[0018] The present invention also provides a cell, wherein the cell is a cell in which the GALECTIN-1 gene is knocked out and / or its expression is inhibited.

[0019] The present invention also provides the use of GALECTIN-1 gene knocked-out cells in antigen presentation research.

[0020] Preferably, the cells are DC2.4 cells.

[0021] The present invention also provides the use of the cells in which the GALECTIN-1 gene is knocked out and / or its expression is inhibited in the preparation of drugs for preventing and treating foot-and-mouth disease.

[0022] By adopting the above technical scheme, the present invention has the following beneficial effects: the present invention constructs a recombinant CRISPR / Cas9 plasmid with double-stranded DNA shown in SEQ ID No.3 and SEQ ID No.4, and packages the recombinant plasmid into a lentivirus, infects cells with the lentivirus, and obtains cells with GALECTIN-1 gene knocked out. The Western Blot test results show that the method achieves mouse GALECTIN-1 gene knockout at the protein level and can be stably inherited. The sgRNA and knockout vector of the present invention can be used for the targeted knockout of the mouse GALECTIN-1 gene, which has the characteristics of simplicity, high efficiency, rapidity, low cost, etc., and is of great significance for the study of the function of the mouse GALECTIN-1 gene and its antigen presentation in adaptive immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the sequencing comparison result of the GALECTIN-1 gene of a single cell clone after DC 2.4 cells were infected with Lenti CRISPR-PZF2-GALECTIN-1 lentivirus.

[0024] Figure 2 This is the Western Blotting detection result of GALECTIN-1 protein expression in the primary single-cell clone after DC 2.4 cells were infected with Lenti CRISPR-PZF2-GALECTIN-1 lentivirus.

[0025] Figure 3 This is the Western Blotting detection result of GALECTIN-1 protein expression in DC 2.4 cells after the single cell clone was subcultured for ten generations after Lenti CRISPR-PZF2-GALECTIN-1 lentivirus infected DC 2.4 cells.

[0026] Figure 4 A graph showing the test results for exploring the concentration of the CCK8 inhibitor OTX008.

[0027] Figure 5 This is a graph showing the results of Elispot detection of the inhibitor OTX008 on IFN-γ secretion.

[0028] Figure 6 This is a graph showing the results of Elispot detection of IFN-γ secretion in single cell clones.

[0029] Figure 7 The results of targeted sequencing of the GALECTIN-1 gene by sgRNA in Comparative Example 1 and Comparative Example 2 are shown. DETAILED DESCRIPTION

[0030] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0031] Example 1 Recombinant vector construction

[0032] 1. Design of sgRNA for the mouse GALECTIN-1 gene

[0033] The mouse GALECTIN-1 gene (gene name: mouse GALECTIN-1, gene ID number: 216551, detailed gene information is available at https: / / www.ncbi.nlm.nih.gov / gene / 216551) was searched on the Genebank website to obtain the mouse GALECTIN-1 genome sequence.

[0034] Select the mRNA with accession number "NM_173752.4" in GeneBank, find and download the gene coding region sequence. According to the above gene coding region sequence sgRNA design sgRNA sequence (SEQ ID No. 1), as shown in Table 1.

[0035] Table 1 Target sequences

[0036] Sequence number name Target sequence SEQ ID No.1 Seq-1 CAACCGCCTCAACATGGAGG SEQ ID No.2 Seq-2 CCTCCATGTTGAGGCGGTTG SEQ ID No.3 Seq-1F CACCGCAACCGCCTCAACATGGAGG SEQ ID No.4 Seq-1R AAACCCTCCATGTTGAGGCGGTTGAC

[0037] Sequence 1 is the sgRNA sequence, and sequence 2 is the complementary sequence; 3 and 4 are synthesized by adding the sticky ends of the BsmBΙ restriction enzyme to the sgRNA sequence to obtain the insert fragment GALECTIN-1sgRNA (Seq-1F) and its complementary sequence.

[0038] 2. Synthesize sgRNA double-stranded fragments and anneal

[0039] The sgRNA designed above is to be cloned into the Lenti CRISPR-PZF2 vector (constructed and maintained in our laboratory). The sgRNA sequence is added with the sticky end of the BsmBI restriction enzyme and sent to the bioengineering biosynthetic single nucleotide chain.

[0040] A linker was added to the sgRNA base sequence to synthesize the insert fragment GALECTIN-1-sgRNA (Seq-1F): The insert fragment and its complementary sequence were annealed to obtain double-stranded fragments as shown in SEQ ID No. 3 and SEQ ID No. 4:

[0041] Seq-1F: 5'-CACCGCAACCGCCTCAACATGGAGG (SEQ ID No. 3);

[0042] Seq-1R: 5'-AAACCCTCCATGTTGAGGCGGTTGAC (SEQ ID No. 4);

[0043] Seq-1F and Seq-1R were mixed in equal volumes for annealing reaction. The annealing reaction system included 13.5 μL of each primer shown in Seq-1F and Seq-1R at a concentration of 10 μM and 3 μL of 10×PCR Buffer. The mixture was placed in a PCR instrument for reaction at 99°C for 5 min and 4°C for ∞. The double-stranded fragment of sgRNA was obtained, which could be connected to the restriction vector or stored at -20°C for later use.

[0044] 3. Enzyme digestion and gel recovery of Lenti CRISPR-PZF2 vector

[0045] Take 2μg of Lenti CRISPR-PZF2 vector and digest it with BsmBI. The digestion system is: Lenti CRISPR-PZF2 2μg, BsmBI 2μL, 10×buffer G 5μL, add ddH2O to make up the system to 50μL. Mix well and react in a 37℃ water bath for 2-4h. Use the agarose DNA recovery kit (Vazyme: FastPure Gel DNAExtraction Mini Kit-DC301) according to the instructions to recover and purify the above digestion products to obtain the Lenti CRISPR-PZF2 vector after digestion.

[0046] 4. Ligation of Seq-1F and Seq-1R double-stranded fragments with Lenti CRISPR-PZF2 vector backbone

[0047] In a 1.5mL EP tube, add 50ng of the Lenti CRISPR-PZF2 vector backbone after enzyme digestion, 0.5μL of 10×T4 buffer, 2μL of GALECTIN-1-sgRNA double-stranded fragment, and 0.5μL of T4 DNA ligase. Add ddH2O to make up the system to 5μL. Mix well and react in a ligator at 16℃ for 1h. Place at 4℃ for later use.

[0048] 5. Ligation product transformation and PCR identification

[0049] Add the above ligation product to 50 μL DH5α competent cells, gently blow to mix, and place on ice for 2 minutes; heat shock in a 42°C water bath for 90 seconds and place on ice for 2 minutes; add 1 mL of LB medium without resistance and place in a 37°C shaker to recover and culture for 1 hour; centrifuge the bacterial solution at 1500 rpm for 30 seconds, discard the supernatant, and resuspend and mix the remaining 100 μL of the liquid; spread the bacterial solution on an ampicillin-resistant plate and place it in a 37°C constant temperature incubator for overnight culture; pick a single colony for expansion culture, harvest the bacterial solution, and perform sequencing identification, and save the correctly identified recombinant plasmid Lenti CRISPR-PZF2-GALECTIN-1-sgRNA.

[0050] Example 2 Preparation of mouse GALECTIN-1 gene knockout DC 2.4 cell line

[0051] 1. Packaging Lenti CRISPR-PZF2-GALECTIN-1-sgRNA Lentivirus

[0052] 1) 293T cells (ATCC, 293T / 17 [HEK 293T / 17]) were cultured at 10 6 The cells / well were inoculated into 6-well plates, and complete culture medium (containing 5% fetal bovine serum and 1% double antibody) was added to 2 mL, and the plates were placed in a cell culture incubator for 12 h.

[0053] 2) Take out two sterile EP tubes and add 150 μL Opti-DMEM culture medium to each of them. Add 2 μg of recombinant plasmid and PZF2 auxiliary plasmid (donated by China Agricultural University) to the first sterile EP tube. The added mass ratio of Lenti CRISPR-PZF2-GALECTIN-1 recombinant vector, psPAX2 and pMD2.G packaging vector is 2.24:1.83:1. The mixture is called A solution. Add 4 μL Lip2000 liposomes to the second sterile EP tube and mix well, which is called B solution.

[0054] 3) Gently add liquid B to liquid A, mix evenly (blowing 3-5 times with a gun), and let stand at room temperature for 25 minutes;

[0055] 4) Gently add the A / B mixture dropwise into the 6-well plate, gently shake the cell culture plate back and forth, and then return the 6-well plate to the cell culture incubator for continued culture.

[0056] The virus stock solution was collected after 48 h and 72 h of culture, centrifuged at 2000 rpm for 3 min, and the supernatant was stored in a -80°C low-temperature refrigerator.

[0057] 2. Lenti CRISPR-PZF2-GALECTIN-1 lentivirus infection and screening of gene knockout cells

[0058] 1) Lentiviral infection method is as follows:

[0059] DC 2.4 cells were plated in a 12-well plate. When the density reached 60%-80%, the cells were washed twice with PBS. 1 mL of the collected lentiviral stock solution was added to the cell plate and cultured for 24 h.

[0060] 2) The method for screening gene knockout cells is as follows:

[0061] Digest the stably transfected mouse dendritic cell line infected with Lenti CRISPR-PZF2-GALECTIN-1 lentivirus in step 1) with trypsin, add 1mL of puromycin (puro) (final concentration of 5μg / mL) culture medium to mix, and match a wild-type cell (WT cell) that has not been transfected as a control. Change the medium every two days, use WT cells as a control, stop screening when all WT cells die, and generally complete screening in 4 days. After the screening stops, replace the culture medium, generally replace it with 10% complete culture medium, and continue culturing for 3-4 days. After the cells after drug screening recover and grow a small amount, proceed to the next step.

[0062] 3) Mixed cell line knockout validation

[0063] ①Digest the selected cells with trypsin and collect 50% of the cells;

[0064] ②Use a genome extraction kit (Vazyme: FastPure EndoFree PlasmidMini Plus Kit-DC204) to extract the genome of cells;

[0065] ③Use the extracted cell genomic DNA as a template and perform PCR amplification with the following primers:

[0066] seq-2F: CCCTCACATAGACACACACAAAC (SEQ ID No. 5);

[0067] seq-2R: GTGTAACACCAAGGAAGATGGGA (SEQ ID No. 6).

[0068] The PCR reaction system included 25 μL of 2×Taq Master Mix, 2 μL of each of the primers Seq-2F ​​and Seq-2R at a concentration of 10 μM, 0.1 μg of template DNA, and ddH2O to make up the system to 50 μL. The PCR reaction program was as follows: 95°C pre-denaturation reaction for 3 min; 95°C denaturation reaction for 15 s, 60°C annealing reaction for 15 s, 72°C extension reaction for 45 s, 35 cycles; 72°C extension for 5 min.

[0069] ④ Perform agarose gel electrophoresis on the amplified product, observe the size of the amplified product band, sequence the PCR product for identification, and perform single cell culture after successful targeting.

[0070] 4) Cell monoclonal culture

[0071] ① Take the cells screened in step 1) of step 3, dilute them, pick up single cells with a syringe and place them in a 96-well plate for culture. Culture two 96-well plates in total, 100 μL / well;

[0072] ② After culturing for 12 hours, the medium was changed to 20% FBS medium and the single cell wells were observed under a microscope;

[0073] ③Cultivate the cells for 7 days, change the medium every 3 days, observe the cell growth under a microscope, and confirm the growing single-cell clones.

[0074] 5) Single cell clone genetic verification

[0075] ① After the cell group in step 4 (3) is digested and expanded to a 24-well plate, when the density of single-cell clones grows to 50%-60% of the bottom area of ​​the well, trypsin is used to digest the cells, 50% of the cells are taken out into an EP tube, the cell genome is extracted for gene sequencing verification, and the remaining 50% of the cells continue to be cultured and expanded in the 24-well plate;

[0076] ②Use the extracted cell genomic DNA as a template and perform PCR amplification with the following primers:

[0077] seq-2F: CCCTCACATAGACACACACAAAC (SEQ ID No. 5);

[0078] seq-2R: GTGTAACACCAAGGAAGATGGGA (SEQ ID No. 6).

[0079] The PCR reaction system included 25 μL of 2×Taq Master Mix, 2 μL of each primer shown in Seq-2F ​​and Seq-2R at a concentration of 10 μM, 0.1 μg of template DNA, and ddH2O to make up the system to 50 μL; the PCR reaction program was 95°C pre-denaturation reaction for 3 min; 95°C denaturation reaction for 15 s, 60°C annealing reaction for 15 s, 72°C extension reaction for 45 s, 35 cycles; 72°C extension for another 5 min;

[0080] ③ The amplified products were tested by agarose gel electrophoresis to observe the size of the amplified product bands, and the amplified products were sequenced for identification. After the positive cells were confirmed by sequencing comparison, the positive cells were expanded and cultured, and cryopreserved and named DC2.4-GALECTIN-1. - / -- ( - / - represents gene knockout), the sequencing result comparison diagram is shown in Figure 1 shown.

[0081] Example 3. Detection of the knockout effect of mouse GALECTIN-1 gene

[0082] 1. Western Blot detection of GALECTIN-1 protein expression in single cell clones

[0083] In order to verify the knockout effect of mouse GALECTIN-1 gene, Western Blot experiment was used to detect the expression of GALECTIN-1 protein in mouse GALECTIN-1 gene knockout DC 2.4 cell line.

[0084] 1) Cell collection: DC 2.4-GALECTIN-1 - / - Single cell clones and wild-type DC 2.4 cells were digested with trypsin, collected into 1.5 mL centrifuge tubes, centrifuged, and the supernatant was discarded, retaining the cell pellet;

[0085] 2) Lysis of cells: Add NP-40 containing protease and phosphatase inhibitors to lyse the cells, lyse on ice for 10 min, centrifuge at 13000 r / min for 15 min, take the supernatant into a new 1.5 mL centrifuge tube, and measure the protein concentration;

[0086] 3) Sample preparation: Mix the total cell protein supernatant with 5× SDS protein loading buffer at a ratio of 4:1 and boil at 95°C for 5 min;

[0087] 4) Electrophoresis: Prepare 12% SDS-PAGE gel and perform electrophoretic separation of proteins. When concentrating the gel, the voltage is 80V and the time is 30min. When separating the gel, the voltage is 120V and the time is 1h.

[0088] 5) Transfer: Wet transfer method, constant voltage 100V, transfer for 1.5h;

[0089] 6) Blocking: Use TBST solution with a final concentration of 5% skim milk powder and incubate overnight at 4°C;

[0090] 7) Primary antibody incubation: The primary antibody GALECTIN-1 mAb (Proteintech) was diluted 1:2000 in a TBST solution with a final concentration of 5% skim milk powder and incubated at room temperature for 1.5 h;

[0091] 8) Secondary antibody incubation: Wash the membrane three times with TBST, 10 min each time; dilute Peroxidase-AffiniPure DonkeyAnti-Goat IgG (H+L) (Jackson: 705-035-003) 1:5000 in a TBST solution with a final concentration of 5% skim milk powder, and incubate at room temperature for 1 h.

[0092] 9) Exposure imaging: Wash the membrane three times with TBST, 10 min each time. Take equal amounts of chemiluminescent HRP (ECLWBKLS0500) colorimetric solution A and solution B, mix them evenly, and use a gel imaging instrument to image the result. Figure 2 shown.

[0093] The results showed that there were a large number of GALECTIN-1 protein signals in DC 2.4 wild cells, and DC 2.4-GALECTIN-1 - / - No GALECTIN-1 protein signal was detected in the single-cell clone, indicating that the single-cell clone achieved mouse GALECTIN-1 gene knockout at the protein level.

[0094] 2. Western Blot detection of GALECTIN-1 protein expression in single cell clones

[0095] In order to verify whether the knockout cells of mouse GALECTIN-1 gene can be stably inherited, Western Blot experiment was used to detect the expression of GALECTIN-1 protein in the mouse GALECTIN-1 gene knockout DC 2.4 cell line.

[0096] Cell collection: DC 2.4-GALECTIN-1 - / - After the cells were passaged for 10 generations and wild DC 2.4 cells were digested with trypsin, collected into 1.5 mL centrifuge tubes, centrifuged and discarded the supernatant, and the cell pellet was retained; the subsequent detection steps were the same as the detection of GALECTIN-1 protein expression in single cell clones, and the results were as follows Figure 3 shown.

[0097] The results showed that there were a large number of GALECTIN-1 protein signals in DC 2.4 wild cells, and DC 2.4-GALECTIN-1 - / - No GALECTIN-1 protein signal was detected in the passaged cells, indicating that the single-cell clone achieved mouse GALECTIN-1 gene knockout at the protein level and could be stably inherited.

[0098] It is explained that the mouse GALECTIN-1 gene knockout DC 2.4 cell line constructed by the CRICPR / Cas9 system in the present invention edited the mouse GALECTIN-1 gene at the DNA level and completely silenced the expression of GALECTIN-1 protein, providing a practical tool for the study of mouse GALECTIN-1 gene function.

[0099] Example 4. Exploring the potential regulatory function of the GALECTIN-1 gene on antigen presentation

[0100] 1. CCK8 method to explore the concentration of GALECTIN-1 inhibitor OTX008

[0101] 1) Inoculate WT DC2.4 (Mouse Dendritic Cell) cell suspension (100 μL / well) in a 96-well plate, with approximately 5,000 cells per well.

[0102] 2) Give different IC 50 of OTX008, and 5, 10, 15, 20, 50, 100, 150, 200, 250, and 300 TCID 50 Inhibitor OTX008 (IC 50 WT DC2.4 cells were treated with 100 μM CCK-8 solution for 24 h, and 10 μL CCK-8 solution was added to each well. The wells with cell culture medium and CCK-8 but no cells were set as blank controls, and the wells with cells, culture medium, CCK-8 solution, and no drug solution were set as zero drug addition groups (negative controls).

[0103] 3) Continue incubating in the cell culture incubator for 1.5 h.

[0104] 4) Measure the absorbance at 450nm using an enzyme-labeled instrument. Figure 4 show.

[0105] The results showed that the maximum dose of OTX008 was 50IC without affecting cell activity. 50 , so this dose is used as the dosage of the inhibitor OTX008.

[0106] 2.ELISPOT assay to detect the effect of inhibitor OTX008 on antigen presentation

[0107] IFN-γ is of great significance in immunological research, especially in the evaluation of antigen presentation. Since IFN-γ is mainly produced by activated T cells and natural killer cells, it plays a key role in cell-mediated immune responses. IFN-γ can enhance the expression of MHC molecules, especially MHC-I class molecules, which promotes the effective presentation of antigens and thus strengthens the immune response. Therefore, when studying immune responses, especially cellular immune responses to specific antigens, the detection of IFN-γ is often used as an important indicator to measure T cell activation and antigen-specific cellular immune responses, which is called

[0108] The "gold standard" is based on its wide application and importance in experimental and clinical research. Therefore, the antigen presentation effect can be evaluated by detecting the secretion of IFN-γ. The specific steps are as follows:

[0109] 1) Inoculate WT DC2.4 cell suspension (100 μL / well) in a 96-well plate, with approximately 2×10 4 cells, cultured overnight;

[0110] 2) The next day, the cells were pretreated with the inhibitor for 24 h at a dose of OTX008-50 IC 50 ;

[0111] 3) Obtain mouse spleen cells;

[0112] Immunization of IFNAR at 8 weeks old - / - C57 / BL6 mice were challenged with 5000 PFUs / 0.1 mL of the virus subcutaneously in the abdomen of each mouse. Seven days after immunization, the mice were euthanized and the spleen was removed aseptically. The spleen was ground evenly and passed through a 70 μm cell filter, placed in a 50 mL centrifuge tube filled with complete culture medium (RPMI1640 + 10% FBS + 1% double antibody), centrifuged at 1700 rpm for 5 minutes, and the supernatant was discarded. Red blood cell lysis solution (RBC) was added to lyse the red blood cells, 5 mL was added, and it was allowed to stand for 5 minutes; 15 mL of culture medium (RP10) was added to stop the lysis, centrifuged at 1500 rpm for 5 minutes, and the filtrate was discarded; 1 mL of culture medium was added to resuspend, and the cell stock solution was transferred to a 1.5 mL printed tube to obtain the cell stock solution, which was diluted 10 times and 100 times respectively, and counted to obtain spleen T cells.

[0113] 4) Magnetic bead separation of CD8 + T cells

[0114] Select a suitable separation column and prepare the buffer (BSA stock solution: Rinsing Buffer = 1:20 dilution); calculate the required cell stock solution, centrifuge, discard the supernatant, and resuspend with the prepared buffer; dilute 10 7cells; add CD8 antibody positive magnetic beads: label 10 per 10 μL 7 If there are 5 cells, add an appropriate amount of CD8 antibody positive magnetic beads and mix well. Install the magnetic rack, collect the waste liquid in a centrifuge tube and pass it through the column with 1mL Buffer, remove the air in the sorting column, infiltrate the sorting column, and let it flow naturally under the action of gravity; add the suspended cell liquid to pass through the column (a sorting column can pass 5mL of cells, excessive amount will cause clogging and slow flow rate) After all cells have passed through the column, wash it with 1mL Buffer. Take the sorting column off the magnetic rack, pass it with 2mL Buffer, pass it with the help of a piston, and collect the sorted CD8 + T cells, count; enrich and purify CD8 + T cells can be sorted once more using a new sorting column.

[0115] 5) Elispot detection of the effect of inhibitor OTX008 on IFN-γ secretion

[0116] The detection was performed using a 96-well ELISPOT plate (Dakoway, 2210003) (the layout of the plate is shown in Table 2), and 4×10 4 WT DC2.4: 2×10 5 CD8 + T cells = 1:5, then add VP4 19-30 (O-type foot-and-mouth disease virus-specific antigen peptide in patent "ZL 202311248353.9") Single protein peptide stimulation (final concentration of 10 μg / mL), total volume 100 μL / well.

[0117] Table 2 Planking layout

[0118]

[0119] At the same time, set up a positive control well: PMA (500ng / mL) + Lonomycine (10μg / mL), and add DMSO to set up a negative control well. Set up 3 replicate wells for each type. Incubate at 37℃, 5% CO2 for 20 hours and then perform color development. The color development operation is as follows:

[0120] 1) Cell lysis: Pour out the cells and culture medium in the wells, add ice-cold deionized water, 200 μL / well, and place in a 4°C refrigerator for 10 minutes to hypotonic lyse the cells.

[0121] 2) Washing: Shake out the liquid in the wells, add 1×WashingBuffer working solution, 260μL / well, leave for 1min and then discard the liquid in the wells. Repeat six times and dry on absorbent paper each time.

[0122] 3) Detection antibody incubation: Add 1× Biotinylated Antibody working solution to each experimental well, 100 μL / well, and incubate at 37°C for 1 h.

[0123] 4) Washing: Add 1× Washing Buffer working solution, 260 μL / well, leave for 1 min and then discard the liquid in the wells. Repeat six times and dry on absorbent paper each time.

[0124] 5) Enzyme-linked avidin incubation: Add 1×Streptavidin-HRP working solution to each experimental well, 100 μL / well, and incubate at 37°C for 1 h.

[0125] 6) Washing the plate: shake out the liquid in the wells, add 1×WashingBuffer working solution, 260μL / well, leave for 1 minute and then discard the liquid in the wells, repeat five times, each time tapping dry on absorbent paper, after washing, uncover the plate base, wash the bottom surface of the membrane and the base with deionized water / tap water, carefully absorb the remaining water on the base and the bottom of the membrane with absorbent paper, close the base, add 1×WashingBuffer working solution, 260μL / well, leave for 1 minute and then discard the liquid in the wells, and tap dry the liquid in the wells thoroughly.

[0126] 7) Color development: Add the prepared AEC color development solution to each experimental well, 100μL / well. Incubate at room temperature away from light for 5-30 minutes, and choose the end time of color development according to the spot formation. If the room temperature is lower than 20℃, it is recommended to develop the color in a 37℃ incubator and check every 5-10 minutes.

[0127] 8) Stop color development: Pour out the liquid in the wells, uncover the base of the plate, wash the front and back of each experimental well and the base 3-5 times with deionized water / tap water to stop color development. Place the plate in a cool place at room temperature and close the base after it is naturally dried.

[0128] 9) Count the spots on the ELISPOT plate and record various parameters of the spots for statistical analysis. The results are as follows: Figure 5 shown.

[0129] The results showed that the foot-and-mouth disease virus specific peptide VP4 19-30 After stimulating the spleen lymphocytes of the immunized mice and treating the WT DC2.4 cells with the inhibitor OTX008, the secretion of IFN-γ was detected, which was significantly lower than that of the DMSO-treated control group. This indicates that the inhibitor OTX008 treatment can weaken the antigen presentation of DC2.4, thereby affecting the body's adaptive immune function.

[0130] Example 5. Elispot method to explore the influence of single cell clones in antigen presentation

[0131] 1. Obtain mouse spleen cells (same steps as in Example 4);

[0132] 2. Magnetic bead separation of CD8 + T cells (same steps as in Example 4);

[0133] 3. Elispot method to detect the effect of single cell clones on antigen presentation

[0134] Number of cells required per well: Antigen presenting cells: CD8 + T cells = 4 × 10 4 :2×10 5

[0135] Calculate the total number of cells required: 3.6×10 5 GALECTIN-1 - / - DC2.4 and wild-type DC 2.4 cells, 3.8×10 6 CD8 + T cells;

[0136] A 96-well ELISPOT plate (Dakoway Biotechnology Co., Ltd., 2210003) was used for detection (the layout of the plate is shown in Table 3), and 4×10 4 WT DC2.4 / DC 2.4GALECTIN-1 - / - : 2×10 5 CD8 + T cells = 1:5, then add VP4 19-30 (O-type foot-and-mouth disease virus specific antigen peptide) single protein peptide stimulation (final concentration of 10μg / mL), total volume 100μL / well. At the same time, set up a positive control well: add PMA (500ng / mL) + Lonomycine (10μg / mL), set up a negative control well: add pure water. Set up 3 replicate wells for each type. Place at 37℃, 5% CO2 for 20h and then perform color development. The color development operation steps are the same as Example 4. The results are as follows Figure 6 shown.

[0137] Table 3 Planking layout

[0138]

[0139] The results showed that the foot-and-mouth disease virus specific peptide VP4 19-30 Stimulate the spleen lymphocytes of immunized mice, GALECTIN-1 - / - The secretion of IFN-γ by single cell clones as antigen presenting cells was significantly lower than that of WT DC2.4 cells as antigen presenting cells. Figure 6This indicates that DC 2.4 cells with GALECTIN-1 gene knockout can weaken the effective presentation of antigens, thereby affecting the body's adaptive immune function.

[0140] Comparative Example 1

[0141] Knockout of GALECTIN-1 gene using sgRNA-1:

[0142] sgRNA-1:

[0143] 5'-cgcttcaatgcccatggaga-3' (SEQ ID No. 7);

[0144] 5'-tctccatgggcattgaagcg-3' (SEQ ID No. 8).

[0145] Comparative Example 2

[0146] Knockout of GALECTIN-1 gene using sgRNA-2:

[0147] sgRNA-2

[0148] 5'-ggggaaccgaacaccgggaa-3' (SEQ ID No. 9);

[0149] 5'-ttcccggtgttcggttcccc-3' (SEQ ID No. 10).

[0150] After sequencing, the targeting results of Comparative Example 1 and Comparative Example 2 are as follows Figure 7 shown. Figure 7 It was shown that sgRNA-1 and sgRNA-2 could not knock out the GALECTIN-1 gene.

[0151] As can be seen from the above examples, the present invention provides DC2.4 cells with GALECTIN-1 gene knockout and their application in antigen presentation research. The knockout method of the GALECTIN-1 gene of the present invention can be used for the targeted knockout of the mouse GALECTIN-1 gene, and has the characteristics of simplicity, high efficiency, rapidity, low cost, etc., and is of great significance for the study of the function of the mouse GALECTIN-1 gene and related pathways. The DC 2.4 cells with the mouse GALECTIN-1 gene knockout prepared by the present invention can be used in antigen presentation research.

[0152] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A sgRNA for knocking out the mouse GALECTIN-1 gene, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID No.

1.

2. A double-stranded DNA, characterized in that The upstream sequence of the double-stranded DNA is shown in SEQ ID NO.3, and the downstream sequence of the double-stranded DNA is shown in SEQ ID NO.

4.

3. A recombinant vector comprising the sgRNA according to claim 1 or the double-stranded DNA according to claim 1.

4. A method for knocking out the GALECTIN-1 gene, characterized in that: The steps include: S1. Design a knockout target site according to the coding region sequence of the mouse GALECTIN-1 gene to obtain a sgRNA guide sequence; the sgRNA guide sequence is shown in SEQ ID NO.3 and SEQ ID NO.4; S2. Anneal the designed sgRNA guide sequence to form a double-stranded DNA sequence, and then connect it to the vector to obtain a connection product; then introduce the connection product into Escherichia coli to obtain colonies, and extract plasmids from the colonies to obtain recombinant plasmids; S3. mixing the recombinant plasmid with the lentiviral packaging vector to prepare a lentiviral targeting vector; S4. Use lentiviral targeting vector to stably transform the cell line and obtain cells with GALECTIN-1 gene knockout.

5. The method for knocking out the GALECTIN-1 gene according to claim 4, characterized in that: The lentiviral packaging vector includes psPAX2 and pMD2.G; the mass ratio of the recombinant plasmid to psPAX2 and pMD2.G is 2-3:1-2:

1.

6. The method for knocking out the GALECTIN-1 gene according to claim 4, characterized in that: After the cell line is stably transformed with the lentiviral targeting vector, the step of screening cells in which the GALECTIN-1 gene has been successfully knocked out is also included: extracting the genomic DNA of a single cell, using the extracted cell genomic DNA as a template, performing PCR amplification with primers, and sequencing and identifying the PCR products to obtain cells in which the GALECTIN-1 gene has been successfully knocked out.

7. The method for knocking out the GALECTIN-1 gene according to claim 6, characterized in that: The primers are shown as SEQ ID No.5 and SEQ ID No.

6.

8. A cell, characterized in that The cells shown are cells in which the GALECTIN-1 gene is knocked out and / or its expression is inhibited.

9. Application of GALECTIN-1 gene knockout cells in antigen presentation research.

10. The use according to claim 9, characterized in that: The cells are DC2.4 cells.

Images