Tobacco NtUGT75C1 gene and application thereof in improving quinclorac herbicide resistance

Abstract

The invention provides a tobacco NtUGT75C1 gene and application of the tobacco NtUGT75C1 gene in improvement of quinclorac herbicide resistance, and belongs to the technical field of bioengineering. The method comprises the following steps: cloning an NtUGT75C1 gene, constructing an overexpression recombinant vector for driving the NtUGT75C1 gene, infecting cultivated tobacco K326 by using the recombinant vector by using a leaf infection method, and selecting a transgenic positive plant to obtain a quinclorac herbicide-resistant tobacco plant, and after spraying 1mg / L of quinclorac herbicide on the quinclorac herbicide-resistant tobacco plant for 14 days, compared with a control plant, the quinclorac herbicide-resistant tobacco plant has obvious resistance, so that the quinclorac herbicide-resistant tobacco plant has a good application prospect. No quinclorac is left on the blade and the root. By utilizing the characteristic, the tobacco material with herbicide resistance can be cultivated by utilizing the NtUGT75C1, so that further guiding significance is provided for biological breeding of tobacco.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a tobacco NtUGT75C1 gene and application thereof in improving resistance to quinclorac herbicide. Background Art

[0002] Quinclorac (3,7-dichloro-8-quinolinecarboxylic acid) is a hormone-type herbicide that is widely used in crop cultivation to control field grass. However, the widespread use of quinclorac may cause harm to rice, tomatoes, corn and tobacco. For example, the addition of quinclorac to the culture medium will lead to a decrease in the total chlorophyll content of corn leaves and an increase in ethylene / cyanide biosynthesis; it will increase the level of endogenous abscisic acid and limit CO2 fixation in photosynthesis. Under field conditions, residual quinclorac in the soil will cause tobacco leaves to be abnormally narrow and thick, unable to stretch, with curled edges and wrinkled bottoms. In severe cases, the leaves will be linear. In tobacco-rice rotation, the long-term presence of quinclorac residues in the soil will seriously affect the growth and development of subsequently planted tobacco plants. The teratogenic threshold concentration of quinclorac in field tobacco is (2.08×10 -3 mg / kg), and under greenhouse cultivation conditions, the critical concentration of quinclorac in tobacco seedlings is 1 mg / L.

[0003] Screening candidate genes for quinclorac resistance is crucial for improving tobacco herbicide resistance under crop rotation systems. UDP-glycosyltransferase is a large gene family that is involved in the biosynthesis of plant secondary metabolites, coupling hormones, abiotic and biotic stresses, and affecting plant cell homeostasis. However, there have been no reports on regulating plant herbicide resistance. Summary of the invention

[0004] The invention provides a tobacco NtUGT75C1 gene and its application in improving resistance to quinclorac herbicide. Overexpression plants constructed using the NtUGT75C1 gene have obvious resistance, and no quinclorac residues can be left in tobacco leaves and roots, which provides further guidance for tobacco biological breeding.

[0005] In order to achieve the above object, the present invention provides a tobacco NtUGT75C1 gene, whose CDS sequence is shown in SEQ ID NO:1.

[0006] The present invention also provides a protein encoded by the tobacco NtUGT75C1 gene described in the above technical solution, and its amino acid sequence is shown in SEQ ID NO:2.

[0007] The present invention also provides an application of an over-expressed tobacco NtUGT75C1 gene in improving resistance to quinclorac herbicide, and the CDS sequence thereof is shown in SEQ ID NO:1.

[0008] The present invention also provides a method for obtaining a tobacco plant resistant to quinclorac herbicide, characterized in that the method comprises cloning the NtUGT75C1 gene, constructing a recombinant vector for driving the overexpression of the NtUGT75C1 gene, and then infecting cultivated tobacco K326 with the recombinant vector by a leaf infection method, selecting transgenic positive plants, and obtaining the tobacco plant resistant to quinclorac herbicide, wherein the CDS sequence of the NtUGT75C1 gene is shown in SEQ ID NO: 1.

[0009] Preferably, 14 days after spraying 1 mg / L quinclorac herbicide on the leaves of tobacco plants resistant to quinclorac herbicide, no quinclorac remains in the roots and / or leaves compared with control plants.

[0010] Preferably, the tobacco plant refers to the base variety K326 used as the receptor material, and includes at least one selected from cultivated tobacco, sun-cured tobacco, Benth's tobacco, and wild tobacco.

[0011] Compared with the prior art, the advantages and positive effects of the present invention are:

[0012] The glucosyltransferase family gene NtUGT75C1 provided by the present invention has a typical GT-B fold and PSPG-box region, and is mainly expressed in the cell membrane. The present invention clones the NtUGT75C1 gene, constructs an overexpression recombinant vector driving the NtUGT75C1 gene, and then uses the leaf infection method to infect and cultivate tobacco K326 with the recombinant vector, selects transgenic positive plants, and obtains tobacco plants resistant to dichloroquine herbicide. After spraying 1 mg / L dichloroquine herbicide for 14 days, compared with the control plants, the plants have obvious resistance, and there is no dichloroquine residue in the leaves and roots. Utilizing this characteristic, NtUGT75C1 can be used to cultivate tobacco materials with herbicide resistance, thereby providing further guiding significance for tobacco biological breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The protein structure prediction (a) and subcellular localization result (b) of NtUGT75C1 provided in the embodiments of the present invention;

[0014] Figure 2 The CDS amplification result of the NtUGT75C1 gene provided in the embodiment of the present invention;

[0015] Figure 3The amplification result of the pEASY-Blunt::NtUGT75C1 recombinant vector provided in the embodiment of the present invention;

[0016] Figure 4 The E. coli amplification results of the PBI121::NtUGT75C1 recombinant vector provided in the embodiment of the present invention;

[0017] Figure 5 The results of Agrobacterium amplification of the PBI121::NtUGT75C1 recombinant vector provided in the embodiments of the present invention;

[0018] Figure 6 The amplification results of the transgenic positive plants provided in the embodiments of the present invention (a) and the relative expression level of NtUGT75C1 in the representative positive plants (b);

[0019] Figure 7 Growth results (a) of NtUGT75C1 overexpressing plants and control plants before (-) and after (+) spraying with quinclorac provided in an embodiment of the present invention, and the leaf area of ​​the second new leaf of the plants after spraying (b). DETAILED DESCRIPTION

[0020] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Materials and Reagents

[0022] Plant materials: Seeds of tobacco Nicotiana tabacum cv. K326 were stored by the Biotechnology Research Center of the Tobacco Research Institute, Chinese Academy of Agricultural Sciences;

[0023] Seedlings and plasmids: Escherichia coli DH5a, Agrobacterium tumefaciens EHA105 strain, and overexpression vector PBI121 backbone plasmid were preserved by the Biotechnology Research Center of Tobacco Research Institute, Chinese Academy of Agricultural Sciences;

[0024] Restriction endonucleases were from NEB, T4 ligase was from Takara Biotech, and other biochemical reagents were purchased from Cesan, Cyens, ShowBai Rui, BioBest and other domestic and foreign companies:

[0025] Example 1 Cloning of NtUGT75C1 gene

[0026] Primer design: Based on the CDS sequence of NtUGT75C1, two groups of restriction sites were designed for the convenience of constructing the vector: BamHI and SacI, as follows:

[0027] NtUGT75C1-cds-F: 5'-ATGGAAATTTTGAAGGATAATTGCCA-3'

[0028] NtUGT75C1-cds-R:5'-TTATTCACCAGCAAAACCTCATGA-3'

[0029] NtUGT75C1-BamHI-F: 5'-CGGGGGACTCTAGAGGATCCATGGAAATTTTGAAGGATAATTGCCA-3'

[0030] NtUGT75C1-SacI-R: 5'-CGATCGGGGAAATTCGAGCTCTTATTCACCAGCAAAACCTCATGA-3'

[0031] PCR used a 50μL reaction system: cDNA 1μL, F primer 0.5μL, R primer 0.5μL, 2×Phanta FlashMaster Mix (Dye Plus) 25μL, ddH2O to 50μL. PCR amplification program: 98℃ pre-denaturation 30s, 98℃ denaturation 10s, 56℃ annealing 5s, 72℃ extension 1min, 35 cycles; 72℃ complete extension 5min. PCR products were identified by 1% agarose gel electrophoresis, and the results showed that the size of the electrophoresis bands met ( Figure 2 ).

[0032] Recovery of PCR products: Use agarose gel DNA recovery kit (CW2302, Kangwei Century) to recover the target fragment. Add an equal volume of Buffer PG to 50μL PCR reaction solution and mix thoroughly; add the resulting 100μL solution to the adsorption column in the collection tube, place at room temperature for 2 minutes, centrifuge at 13,000rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube; add 450μL Buffer PW (add anhydrous ethanol before use) to the adsorption column, centrifuge at 13,000rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube, repeat twice. Centrifuge at 13,000rpm for 1 minute, pour out the waste liquid in the collection tube; put the adsorption column into a new 1.5mL centrifuge tube (self-prepared), drop 50μL Buffer EB in the middle of the adsorption membrane, and place at room temperature for 2 minutes. The DNA solution was collected by centrifugation at 13,000 rpm for 1 minute and stored at -20°C to obtain the purified tobacco NtUGT75C1 gene, whose CDS sequence is shown in SEQ ID NO: 1 and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO: 2. Protein prediction of the gene revealed that it has a typical GT-B fold and PSPG-box region ( Figure 1 a), Subcellular localization results showed that NtUGT75C1 was mainly expressed in the cell membrane ( Figure 1 b).

[0033] Transformation of ligation product: 4 μL of purified target gene NtUGT75C1 was added to ZeroCloning Vector 1μL was gently mixed, reacted at room temperature at 37℃ for 5min, and then placed on ice. The ligation product was added to 50μL Trans1-T1 competent cells and flicked to mix, ice bathed for 30min, heat-shocked at 42℃ for 45s, and immediately placed on ice for 2min. Add 500μL LB liquid medium equilibrated to room temperature and cultured at 200rpm and 37℃ for 1 hour. All bacterial liquid was spread on LB solid medium containing kanamycin (100mg / L), and positive colonies were selected for PCR amplification (M13-F:GAGGAAACAGCTATGAC; M13-R:GTAAAACGACGGCCAGT)( Figure 3 ), the band sizes were consistent, the amplified products were sequenced, and after the sequence obtained was aligned correctly, the Escherichia coli containing the target gene was expanded and the plasmid was extracted.

[0034] Small amount of plasmid extraction: Strictly follow the instructions of TIANGEN's plasmid extraction kit (DP103) to extract plasmid.

[0035] (1) Use a sterile pipette to pick up a single white colony from the LB plate and inoculate it into 5 ml LB medium containing Amp (100 mg / ml);

[0036] (2) Continuous shaking culture at 37°C and 300 rpm / min for 8–10 h;

[0037] (3) Centrifuge at 12,000 rpm / min at room temperature for 3 min and discard the supernatant as much as possible;

[0038] (4) Add 250 μl of Buffer P1 to the centrifuge tube containing the bacterial pellet and vortex to thoroughly suspend the bacterial pellet;

[0039] (5) Add 250 μl of Buffer P2 to the centrifuge tube and gently mix by inverting up and down 4-6 times to fully lyse the bacteria;

[0040] (6) Add 350 μl of Buffer N3 to the centrifuge tube and immediately mix by gently inverting up and down 4-6 times;

[0041] (7) Centrifuge at 12000 rpm / min for 10 min, aspirate the supernatant, and add it to the SpinColumn CM loaded into the Collection Tube;

[0042] (8) Centrifuge at 12000 rpm / min for 60 seconds, discard the waste liquid in the Collection Tube, and place the Spin Column CM back into the Collection Tube;

[0043] (9) Add 700 μl of Buffer PW to the Spin Column CM, centrifuge at 12,000 rpm / min for 60 sec, discard the waste liquid in the Collection Tube, and return the Spin Column CM to the Collection Tube;

[0044] (10) Add 500 μl of Buffer PW to the Spin Column CM, centrifuge at 12,000 rpm / min for 60 sec, discard the waste liquid in the Collection Tube, and return the Spin Column CM to the Collection Tube;

[0045] (11) Centrifuge at 12000 rpm / min for 60 seconds and discard the waste liquid. Leave the Spin Column CM open at room temperature for several minutes to completely dry the residual Buffer PW on the adsorption membrane.

[0046] (12) Place the Spin Column CM in a new centrifuge tube, add 50 μl of Buffer EB to the middle of the adsorption membrane, leave it at room temperature for 2 minutes, centrifuge it at 12,000 rpm / min for 1 minute, and collect the plasmid solution in a centrifuge tube. Store the plasmid at -20°C.

[0047] Example 2 Construction of PBI121::NtUGT75C1 recombinant vector

[0048] The restriction sites of PBI121 vector are BamHI and SacI. The amplified product and the vector restriction product were recovered using an agarose gel DNA recovery kit (CW2302, Kangwei Century) and then ligated with CE ligase (ClonExpress UltraOne Step Cloning Kit, Norwegian) Connect 3μL of the target fragment, 5μL of the vector fragment, and 8μL of 2×ClonExpress Mix at 50℃ for 5 minutes and immediately place on ice. Take 6μL of the recombinant product and add it to 100μl of competent cells (E.coli DH5a), flick the tube wall to mix, and let it stand on ice for 30min; after heat shock in a 42℃ water bath for 45sec, immediately place it on ice to cool for 2-3min. Add 500μL LB liquid culture medium and culture at 200rpm and 37℃ for 1 hour. Take all the bacterial liquid and spread it on LB solid culture medium containing kanamycin (100mg / L), and select positive colonies for PCR amplification ( Figure 4 ), the band size is consistent. Select the positive colony for PCR amplification,

[0049] 35s-PCR-F:AAGGGATGACGCACAATCCCACTAT;

[0050] NtUGT75C1-cds-R:TTATTCACCAGCAAAACCTCATGA

[0051] The amplified product was sequenced, and after the sequencing results were aligned correctly, the E. coli containing the target gene was expanded and the plasmid was extracted. The plasmid was extracted strictly according to the instructions of the TIANGEN plasmid extraction kit (DP103).

[0052] Example 3 Recombinant vector transformation of Agrobacterium

[0053] Take 100μL of Agrobacterium competent cells (EHA105) stored at -80℃ and melt them in an ice water bath. Under sterile conditions, add 1ug of the plasmid (PBI121::NtUGT75C1) to be transformed to the just melted competent cell suspension and mix gently. Let stand in the ice water bath for 10min; place the centrifuge tube in liquid nitrogen for quick freezing for 5min; quickly place the centrifuge tube in a 37℃ water bath for 5min, do not shake the water surface. Then quickly transfer to an ice water bath and let stand for 5min. Add 750μL of LB liquid culture medium without antibiotics and culture at 28℃ for 3h. Resuscitate the bacteria and express resistance. Centrifuge at 5000rpm for 1min to collect the bacteria, retain about 100μL of supernatant, gently blow and resuspend the bacteria, and evenly apply it to the LB solid culture medium plate containing kanamycin (100mg / L). After the liquid in the plate is completely absorbed, invert the plate and culture at 28℃ for 72 hours.

[0054] Example 4 PCR verification of Agrobacterium monoclonal colonies

[0055] PCR used a 50μL reaction system: 1μL bacterial solution, 0.5μL NtUGT75C1-cds-F, 0.5μL E9-200R (5'-CCATTTCACAGTTCGATAGC-3'), 25μL 2×Phanta Flash Master Mix (Dye Plus), and ddH2O to 50μL. PCR amplification program: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 56℃ annealing for 5s, 72℃ extension for 1min, 35 cycles; 72℃ extension for 5min. PCR products were identified by 1% agarose gel electrophoresis, and the band size was consistent with ( Figure 5 The Agrobacterium strains with the correct PCR and sequencing results were used in subsequent tobacco genetic transformation experiments.

[0056] Example 5 Cultivation of Sterile Tobacco Seedlings

[0057] Place tobacco Nicotiana tabacum cv.K326 seeds in a 1.5mL centrifuge tube, add 800μL 10% H2O2 solution to the centrifuge tube, shake the centrifuge tube upside down to fully sterilize the seeds, and sterilize for about 12 minutes. In a sterile clean bench, use a pipette to aspirate the solution from the centrifuge tube, be careful not to aspirate the tobacco seeds, aspirate 800μL sterilized distilled water, wash the 10% H2O2 solution remaining on the surface of the seeds, and wash with sterilized distilled water 3-5 times, 1 minute each time. Pour the sterilized tobacco seeds on sterilized filter paper, use a toothpick to point the dried seeds on the MS culture medium, and place them in an artificial climate culture room for cultivation. When the seedlings grow two true leaves, transfer the sterile seedlings to tissue culture bottles for continued cultivation, and put two seeds in each bottle for subsequent experiments.

[0058] Example 6 Agrobacterium-mediated genetic transformation of tobacco

[0059] Pre-culture: Select healthy and dark green leaves from sterile bottles, place them on sterile culture dishes, remove the edges and main veins of the leaves with a scalpel, cut the leaves into fingernail size, place them in MS culture medium, with the front side of the leaves facing up, and culture them in the dark for two days;

[0060] Agrobacterium activation: Small shake: Use a sterile white gun tip to pick up a single colony and put it into LB liquid culture medium (5mL) containing the corresponding antibiotic, and shake it in a constant temperature shaker at 28°C. Large shake: Take 1mL of the bacterial solution from the small shake and add it to 50mL LB liquid culture medium containing the corresponding resistance, shake it overnight in a constant temperature shaker at 28°C for 16 hours, until the bacterial solution turns orange. Transfer 50mL of the bacterial solution to a sterile centrifuge tube, centrifuge it at 4000rpm for 10min, remove the supernatant, and use sterile filter paper to absorb the bacterial solution at the mouth of the centrifuge tube. Pour the pre-cooled MS liquid culture medium into the centrifuge tube, shake and mix, fully resuspend the bacteria, and measure OD600 with a spectrophotometer. Adjust the OD600 to about 0.8, and then add acetosyringone AS at a final concentration of 20mg / mL, ready for infection;

[0061] Infection and co-cultivation: Use sterile tweezers to pick up the pre-cultured leaves from the culture medium, and place the leaves in the resuspended Agrobacterium infection solution. Shake the bottle during the infection process to allow the leaves to be fully infected. The infection lasts about 8 minutes. Use sterile tweezers to pick up the infected leaves, spread them flat on sterile filter paper, fully absorb the Agrobacterium solution on the surface of the leaves, and spread the leaves with the back facing up on the co-cultivation medium (C), and place them in the artificial climate chamber for dark culture for 3 days;

[0062] S1 subculture: Use sterile forceps to transfer the leaves after 3 days of co-culture to S1 differentiation medium, select the leaves with curled edges, and lay them flat on the medium with the front side facing up. Place 7 leaves in each culture dish, culture in the dark in the artificial climate room for 2 days, and then continue to culture under light;

[0063] S2 subculture: Cut the callus tissue on the edge of the leaf with a scalpel, transfer it to S2 differentiation medium, place it in an artificial climate chamber, and culture it under light conditions for about 2 weeks until the small buds grow into young seedlings;

[0064] S3 subculture: Use a sterile scalpel to cut the seedlings on the S2 medium, transfer them to the S3 differentiation medium, put them in an artificial climate chamber, and culture them under light conditions for about 2 weeks. The seedlings will gradually become strong;

[0065] Rooting culture: Use a sterile scalpel to remove the swollen callus tissue at the bottom of the seedling, then transfer it to the rooting medium (R), place it in an artificial climate chamber, and culture it under light for 1-2 weeks to promote the seedlings to take root as soon as possible;

[0066] When the seedlings grow strong roots, they are moved to the soil for further growth. The concentrations of hormones and antibiotics at each culture period are shown in Table 1.

[0067] Table 1 Preparation of MS culture medium with different components (1L)

[0068]

[0069] Example 7 Transgenic Plant Positive Detection

[0070] Amplification primer 121-kan-F2: GATGGATTGCACGCAGGTTC;

[0071] 121-kan-R2: GGCCACAGTCGATGAATCCA.

[0072] According to the PCR electrophoresis results ( Figure 6 ) and sequencing results, the T0 generation plants identified as positive were transferred to plug trays for culture, and after 3 weeks, the healthy seedlings were transferred to pots for further culture.

[0073] Example 8 Quinclorac spraying operation process

[0074] 14 days after transplanting, the leaf surfaces of positive plants were evenly saturated with spray at a concentration of 1 mg / L, and K326 plants sprayed with clean water and dichloroquine were used as controls. Resistant plants with no curling of new and old leaves were selected and transplanted into pots. They were sprayed a second time on the 7th day after transplanting, and the leaf area of ​​the second leaf newly grown after the tobacco was sprayed with the agent was measured using ImageJ software. The results showed that compared with the control plants, the overexpression plants grew normally after spraying dichloroquine and had dichloroquine resistance, while the control plants showed curling of new leaves and yellowing of leaves after spraying dichloroquine ( Figure 7 ).

[0075] Example 9 Quinclorac Residue Detection Process

[0076] BioMérieux Testing Technology Co., Ltd. (Qingdao, China) was commissioned to detect the residues of quinclorac in roots and leaves of overexpression plants and control plants using the EN 15662:2018 method. The results are shown in Table 2.

[0077] Table 2 Residues of quinclorac in overexpression and control plants

[0078]

[0079] As shown in the data in Table 2, there was no obvious residue in the roots and leaves of the overexpression plants before and after spraying, while there was no obvious residue in the roots and leaves of the control plants before spraying, but there was significant dichloroquinoline residue in the roots and leaves after spraying.

Claims

1. Tobacco NtUGT75C1 gene, characterized in that The CDS sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the tobacco NtUGT75C1 gene according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO:

2.

3. Application of overexpressing tobacco NtUGT75C1 gene in improving resistance to quinclorac herbicide, characterized in that: The CDS sequence is shown in SEQ ID NO:

1.

4. A method for obtaining tobacco plants resistant to quinclorac herbicide, characterized in that: The NtUGT75C1 gene was cloned, and a recombinant vector driving the overexpression of the NtUGT75C1 gene was constructed. The recombinant vector was then used to infect cultivated tobacco K326 using a leaf infection method, and transgenic positive plants were selected to obtain tobacco plants resistant to quinclorac herbicide. The CDS sequence of the NtUGT75C1 gene is shown in SEQ ID NO:

1.

5. The use according to claim 4, characterized in that: Fourteen days after spraying 1 mg / L quinclorac herbicide on the leaves of tobacco plants resistant to quinclorac herbicide, no quinclorac residues were found in the roots and / or leaves compared with the control plants.

6. The method according to claim 4 or 5, characterized in that: The tobacco plant refers to the base variety K326 used as a receptor material, and includes at least one selected from cultivated tobacco, sun-cured tobacco, Ben's tobacco, and wild tobacco.

Images