Preparation method and application of yeast expression triple helix structure II type recombinant human collagen

Abstract

The invention discloses a preparation method and application of yeast expression triple helix structure II type recombinant human collagen, and relates to the technical field of biology. The preparation method comprises the following steps: fermenting and purifying engineering bacteria to obtain the triple-helix structure II type recombinant human collagen; the construction method of the engineering bacterium comprises the following steps: transforming a pMChZ-alpha1 (II) plasmid, a pPIC9K-P4H (DP)-1 plasmid and a pMCeH-alpha1 (II) plasmid into a yeast host bacterium, and constructing to obtain the engineering bacterium. Saccharomycetes are used as host bacteria to construct and express II-type recombinant human collagen gene engineering bacteria, and the II-type recombinant human collagen with the triple-helix structure can be obtained through fermentation and purification. The triple-helix structure II type recombinant human collagen prepared by the invention can be widely applied to the fields of cosmetics, medical cosmetology, medical instruments, biomedical materials and the like, and has important market application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of yeast-expressed triple-helix type II recombinant human collagen. Background Art

[0002] Collagen is the most abundant protein in the body and the main component of the extracellular matrix. It plays an important role in maintaining the normal physiological functions of cells, tissues and organs and repairing injuries. In terms of molecular structure, each collagen peptide chain is mainly composed of Gly-XY (X, Y are any amino acid residues other than Gly) triplet repeats. This unique structure is necessary for the formation of the advanced structure of collagen fibers. It determines the excellent biocompatibility and low immunogenicity of collagen, and has been widely used in the pharmaceutical, health care and cosmetic industries.

[0003] Type II collagen is rich in sources and is currently mainly extracted from animal tissues, but the animal extraction method has the risk of virus transmission. With the development of biotechnology, great achievements have been made in obtaining recombinant collagen by microbial fermentation using genetic recombination technology. The collagen produced solves the virus risk defects of traditional extraction methods and significantly improves the stability, hydrophilicity and biocompatibility of collagen. Chinese patent CN1380414A discloses a recombinant human type II collagen functional polypeptide and its preparation method and use. The prepared recombinant type II collagen polypeptide lacks the characteristic triple helix structure and fiber morphology of collagen. Chinese patent CN115819557A discloses a method for obtaining recombinant humanized type II collagen by expression in Escherichia coli. The Escherichia coli expression system has the risk of purification difficulties and high endotoxin content, while the methanol-nourishing Pichia pastoris, as a eukaryotic expression system, has the characteristics of high expression of the target protein, simple purification method, and no influence of endotoxin. It has been widely used in the expression of recombinant proteins and is the dominant host bacteria for the recombinant expression of collagen. Recombinant humanized collagen can be expressed in microorganisms at a relatively low cost, but this type of collagen lacks key collagen characteristics, is easily hydrolyzed by enzymes or non-enzymatic hydrolysis due to chemical reactions, and has low mechanical properties, making it difficult to apply to fields that require high molecular weight, highly supportive collagen.

[0004] Therefore, there is an urgent need for a method to obtain high molecular weight, highly supportive triple-helical type II recombinant human collagen. Summary of the invention

[0005] The purpose of the present invention is to provide a preparation method and application of yeast-expressed triple-helical type II recombinant human collagen to solve the problems of the above-mentioned prior art. The type II recombinant human collagen prepared by the preparation method has a triple-helical structure, a large molecular weight, strong support, and good market application value.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for constructing an engineering bacterium expressing triple helical type II recombinant human collagen, comprising the steps of transforming a pMChZ-α1(II) plasmid, a pPIC9K-P4H(DP)-1 plasmid and a pMCeH-α1(II) plasmid into a yeast host bacterium to construct the engineering bacterium;

[0008] The pMChZ-α1(II) plasmid is obtained by cloning α1(II) into the pMChZ-AOX vector;

[0009] The pPIC9K-P4H(DP)-1 plasmid is obtained by replacing KanR in the P4H 9K DP plasmid with the sequence shown in SEQ ID NO.6;

[0010] The pMCeH-α1(II) plasmid is obtained by cloning α1(II) into the pMCeH-AOX vector;

[0011] The nucleotide sequence of α1(II) is shown in SEQ ID NO.2;

[0012] The pMChZ-AOX vector is obtained by modifying the pPIC9K plasmid as follows: replacing 4648-9221 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; deleting BamHI located upstream of αMF in the pPIC9K plasmid; and introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation;

[0013] The pMCeH-AOX vector is constructed by replacing PpHIS4 and PEM7-BleoR-CYC1 tt on the pMChZ-AOX vector with DNA molecules whose nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0014] Furthermore, the construction method specifically comprises the following steps:

[0015] The pMChZ-α1(II) plasmid was transformed into the yeast host to obtain α1(II)-1#-Z R strain;

[0016] The pPIC9K-P4H(DP)-1 plasmid was transformed into the α1(II)-1#-Z R strains, and obtained the α1(II)-1#-P4H strain;

[0017] The pMCeH-α1(II) plasmid is transformed into the α1(II)-1#-P4H strain to obtain the engineered bacteria.

[0018] Furthermore, the host bacteria is Pichia pastoris X33 or Pichia pastoris KM71.

[0019] Furthermore, BamHI located upstream of αMF in the pPIC9K plasmid was deleted by point mutation.

[0020] The present invention also provides an engineering bacterium expressing triple helical type II recombinant human collagen constructed according to the above construction method.

[0021] The present invention also provides the use of the above-mentioned engineering bacteria in the preparation of triple helical structure type II recombinant human collagen.

[0022] The present invention also provides a method for preparing triple helical type II recombinant human collagen expressed in yeast, comprising the steps of obtaining the triple helical type II recombinant human collagen by fermentation and purification using the above-mentioned engineering bacteria.

[0023] The present invention also provides a type II recombinant human collagen with a triple helical structure prepared according to the above preparation method.

[0024] The present invention also provides the use of the triple helical structure type II recombinant human collagen in the preparation of biomedical materials, cosmetics or medical devices.

[0025] The present invention discloses the following technical effects:

[0026] The present invention provides a method for preparing type II recombinant human collagen with a triple helical structure, wherein yeast is used as a host bacterium to construct a genetically engineered bacterium expressing type II recombinant human collagen, and the triple helical type II recombinant human collagen can be obtained through fermentation and purification. The triple helical type II recombinant human collagen prepared by the present invention can be widely used in the fields of cosmetics, medical cosmetology, medical devices, biomedical materials, etc., and has important market application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 is the plasmid map of pPIC9K;

[0029] Figure 2is the plasmid map of pMChZ-AOX;

[0030] Figure 3 is the plasmid map of pMCeH-AOX;

[0031] Figure 4 is the plasmid map of pPIC9K-P4H(DP)-1;

[0032] Figure 5 Results of detecting collagen using COL2A1, P4HA, and P4HB antibodies, respectively;

[0033] Figure 6 is the circular dichroism test result;

[0034] Figure 7 The results are obtained by transmission electron microscopy. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] Example 1

[0041] 1. Construction of a sequence encoding triple helical type II recombinant human collagen

[0042] The amino acid sequence of the α1(Ⅱ) chain of triple helical type II recombinant human collagen is shown in SEQ ID NO. 1. The coding gene of the α1(Ⅱ) chain is optimized according to the expression preference of Pichia pastoris to obtain the coding gene with the nucleic acid sequence shown in SEQ ID NO. 2.

[0043] 2. Construction of plasmid

[0044] 2.1 Construction of plasmid pMChZ-AOX

[0045] The synthetic nucleotide sequence is as shown in SEQ ID NO.3, and the replacement fragment is substituted for the 4648-9221 bp of the pPIC9K vector sequence, that is, the KanR resistance gene, Bom and AOX13'fragment elements in pPIC9K are replaced by the replacement fragment; BamHI (938-943 bp) located upstream of αMF (i.e., α-factor secretion signal) in pPIC9K is deleted by point mutation, and the BamHI recognition site is introduced by point mutation downstream of AOX1tt (also known as AOX1 transcription termination or AOX1 termination) (between 1583-1584 bp), and the sequences of other vector elements remain unchanged, thereby constructing the plasmid pMChZ-AOX (wherein h represents the recombination site PpHIS4, and Z represents the selection marker BleoR). The plasmid can express Cre recombinase when induced by methanol, catalyze the recombination of lox71 and lox66, and realize the recovery of the resistance gene. BamHI located after AOX1tt can be used to construct an in vitro multi-copy plasmid with the same tail enzyme. The maps of the original plasmid pPIC9K and the plasmid pMChZ-AOX constructed in the present invention are as follows: Figure 1 and Figure 2 shown.

[0046] The synthetic nucleotide sequence, such as that shown in SEQ ID NO.3, contains lox71 and lox66 sequences at both ends of the replacement fragment, ori is located upstream of lox71, and a Cre transcription unit is located inside, and the Cre gene is driven by the AOX1 promoter with a mutation in the SacⅠ restriction site; there are prokaryotic and eukaryotic promoters upstream of BleoR, which can be used for prokaryotic and eukaryotic screening, and there is a prokaryotic promoter upstream of AmpR, which can be used for prokaryotic screening.

[0047] SEQ ID NO.3:

[0048]

[0049]

[0050]

[0051] Part is ori, 5' end lox71, 3' end is lox66; For AmpR, pAmpR (AmpR promoter), pAOX1 promoter with mutated SacⅠ site, is the Cre recombinase gene, For AOX1tt, pTEF1 (corresponding to Figure 2 TEF1 promoter), The lowercase letters are pEM7 (corresponding to Figure 2 EM7 promoter), The part is BleoR, the part with lowercase letters is CYC1tt (corresponding to Figure 2 CYC1 terminator).

[0052] 2.2 Construction of plasmid pMCeH-AOX

[0053] The sequence shown in SEQ ID NO.4 (PpENO) and the sequence shown in SEQ ID NO.5 were synthesized to replace PpHIS4 and PEM7-BleoR-CYC1 tt in pMChZ-AOX (obtained in step 2.1), respectively, to obtain the plasmid pMCeH-AOX (e represents the recombination site is PpENO, H represents the screening marker is HygR), the map is shown in FIG. Figure 3 shown.

[0054] SEQ ID NO.5:

[0055] ATGGGTAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGT CTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTC CTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCC CGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGT CACGTTGCAAGACCTCCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCT GCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTG ATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGT CGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTC GGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATT CCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGA GCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTAT CAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAG CCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGC CGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTG, wherein the underline is HygR and the 3' end is TEFtt.

[0056] 3. Construction of recombinant expression vector

[0057] 3.1 The coding gene of α1(II) (SEQ ID NO. 2) was cloned into the pMChZ-AOX vector constructed in 2.1 to obtain the recombinant expression plasmid pMChZ-α1(II).

[0058] 3.2 The coding gene of α1(II) (SEQ ID NO.2) was cloned into the pMCeH-AOX vector constructed in 2.2 to obtain the recombinant expression plasmid pMCeH-α1(II).

[0059] 3.3 Construction of P4H expression vector pPIC9K-P4H(DP)-1

[0060] The sequence shown in SEQ ID NO.6 was synthesized to replace KanR of P4H 9K DP plasmid (disclosed in patent CN114480471A), that is, PTEF and PEM7 were added to the 5' end of the selection marker (according to the direction of pPIC9K plasmid), and CYC1tt was added to the 3' end to obtain P4H expression vector pPIC9K-P4H(DP)-1. Figure 4 shown.

[0061] SEQ ID NO.6:

[0062]

[0063] in, The bold underline is PTEF, For PEM7, The lowercase part is KanR, It is CYC1tt.

[0064] 4. Construction of recombinant engineering strains, induced expression and strain screening

[0065] Pichia X33 was used as the starting strain, and the competent cells of Pichia were prepared according to the competent cell preparation method described by Lin-Cereghino (Lin-Cereghino et al., 2005); pMChZ-α1(II) obtained in 3.1 was linearized using SalⅠ to obtain the linearized plasmid pMChZ-α1(II). The linearized plasmid pMChZ-α1(II) was electroporated into the competent cells of Pichia according to the method of Invitrogen's Pichia Expression Kit USERGUIDE, and then coated on YPDZ plates (containing bleomycin 300 μg / mL), and the grown transformants were recorded as X33-α1(II)-1#-Z R .

[0066] In the embodiment of the present invention, the naming rule of the obtained transformants is: starting strain name / POI-# of electroporation times-screening antibiotic sensitivity, and the antibiotic sensitivity description will be omitted if the screening marker is not recovered. Here, Z is the abbreviation of Zeocin, S (sensitive) represents sensitive, and R (resistant) represents resistant.

[0067] X33-α1(II)-1#-Z R The strain was shaken for induction. The steps of shaken induction were as follows: inoculate the strain into a 100 mL Erlenmeyer flask containing 10 mL BMGY medium and culture at 28-30°C and 220 rpm until the OD 600 Centrifuge at 3000g for 5 min at room temperature to collect the cells and resuspend them in BMMY medium to a concentration of OD 600 The cell culture medium was placed on a shaker at 28-30°C and 220 rpm for 3 days. 100% methanol was added to the culture medium every 24 hours to a final concentration of 1.0% for induction. After induction, the bacterial solution was streaked on a YPD plate, and the grown colonies were spotted on YPD and YPDZ (100 μg / mL) plates respectively. The strain that grew normally on the YPD plate but could not grow on the YPDZ plate was the strain X33-α1(II)-1#-Z with the recovery screening marker. S .

[0068] X33 / α1(II)-1#-Z S As the starting strain, pPIC9K-P4H(DP)-1 was linearized using BspEⅠ and electroporated into the competent cell of the starting strain to obtain the transformant X33-α1(II)-1#-P4H.

[0069] Using X33-α1(II)-1#-P4H as the starting strain, pMCeH-α1(II) was linearized using SalⅠ and electroporated into the competent cell of the starting strain to obtain X33-α1(II)-2#-P4H.

[0070] Each transformant obtained above was induced by shaking flasks, and the total protein was extracted after the induction by breaking the cell wall. The extraction steps were as follows: 1 mL of the sample was placed in a 1.5 mL EP tube, centrifuged at 12000g for 5 min at 4°C, and the supernatant and the bacteria were collected separately. 80 μL of the supernatant was added with 20 μL of loading buffer, heated at 80°C for 5 min to prepare the sample, and 20 μL was taken for SDS-PAGE. Add 200 μL of cell wall breaking solution (50 mM sodium phosphate (pH 7.4), 1 mM EDTA, 5% glycerol, 1 mM PMSF (phenylmethylsulfonyl fluoride, dissolved in anhydrous ethanol to make 100× mother solution, added before cell wall breaking)), 40% liquid volume of 0.5 mm glass beads; vortex for 1 min, put on ice for 1 min, and cycle 6-10 times; centrifuge at 3000 g for 3 min at 4°C, take 80 μL of the supernatant (total protein) and add 20 μL of loading buffer, and heat at 99°C for 5 min to prepare the sample.

[0071] The same total protein was loaded for SDS-PAGE and WB detection. The results are as follows Figure 5 As shown. Figure 5 It can be seen that X33-α1(II)-1#-Z R α1(II) was detected, and P4HA and P4HB subunits were expressed normally after being transferred into pPIC9K-P4H(DP)-1. The expression level of X33-α1(II)-2#-P4H was significantly increased by using the plasmid pMCeH-α1(II) with a changed recombination site for two electroporations.

[0072] 5. High-density fermentation and protein purification

[0073] The engineered bacteria with high expression levels identified through protein expression are subjected to high-density fermentation culture and protein purification in a fermenter.

[0074] X33-α1(II)-2#-P4H was inoculated into a 1L shake flask containing 200mL of seed medium YPG and cultured at 220rpm and 30℃ for 18h until OD 600 =8.

[0075] Use a 5L fermentation tank (Baoxing Biotechnology) with 2L of fermentation medium. Before inoculation, adjust the speed to 300rpm, the ventilation volume to 4L / min, the temperature to 30°C, and adjust the pH with an alkali solution prepared with concentrated ammonia water to set the pH to 6.0. First, add 0.9mL PTM1, then add the prepared 200mL seed solution to the tank (flame circle inoculation), then click on the dissolved oxygen electrode to calibrate, and start fermentation after calibration. When the dissolved oxygen drops to 30% for the first time during growth, use the dissolved oxygen cascade speed function to maintain 30%; wait for the glycerol to be consumed, the dissolved oxygen to rebound, and the dissolved oxygen to be greater than 70% (OD 600 value of about 20), cancel the dissolved oxygen cascade speed, increase the stirring speed to 650rpm, use 30% linkage feeding of glycerol, and feed 150mL. Stop feeding glycerol, after the dissolved oxygen rebounds to more than 70%, induce culture with methanol, and feed at a constant rate of 4mL / h. Induction for 80-90h, OD 600 When the change is not obvious or decreases, the tank can be released to obtain the fermentation liquid.

[0076] After the fermentation, the bacterial liquid was centrifuged at 5000rpm for 30min to collect the bacterial cells, which were resuspended in the purified cell wall breaking solution at a ratio of 1:10 (W:V), broken by a homogenizer at 1000bar, and centrifuged at 12000rpm and 4℃ for 30min to separate the supernatant and precipitate. The precipitate was washed, renatured, digested with pepsin, ultrafiltered and desalted, and then freeze-dried to obtain α1(II) freeze-dried powder.

[0077] 6. Structural characterization of α1(II) lyophilized powder

[0078] The α1(II) freeze-dried powder was reconstituted and then acid hydrolyzed. The sample was analyzed by liquid chromatography-mass spectrometry. The peak area of ​​the targeted data was calculated using MassLynx quantitative software. The identification result was obtained using the standard curve method. The result showed that the hydroxyproline content reached more than 30% of the total proline.

[0079] The α1(II) freeze-dried powder was dissolved in water and tested by circular dichroism spectrometer. The test results were as follows Figure 6 As shown, it is consistent with the circular dichroism spectral characteristics of triple-helical collagen.

[0080] The collagen samples were negatively stained and then tested by transmission electron microscopy. The test results were as follows: Figure 7 Shown are the typical structural features of collagen microfibrils with alternating light and dark characteristics.

[0081] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an engineering bacterium expressing triple helical type II recombinant human collagen, characterized in that: The method comprises the steps of transforming a pMChZ-α1(II) plasmid, a pPIC9K-P4H(DP)-1 plasmid and a pMCeH-α1(II) plasmid into a yeast host bacterium to construct the engineered bacterium; The pMChZ-α1(II) plasmid is obtained by cloning α1(II) into the pMChZ-AOX vector; The pPIC9K-P4H(DP)-1 plasmid is obtained by replacing KanR in the P4H 9K DP plasmid with the sequence shown in SEQ ID NO.6; The pMCeH-α1(II) plasmid is obtained by cloning α1(II) into the pMCeH-AOX vector; The nucleotide sequence of α1(II) is shown in SEQ ID NO.2; The pMChZ-AOX vector is obtained by modifying the pPIC9K plasmid as follows: replacing 4648-9221bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; deleting BamHI located upstream of αMF in the pPIC9K plasmid; and introducing a BamHI recognition site between 1583-1584bp of the pPIC9K plasmid by point mutation; The pMCeH-AOX vector is constructed by replacing PpHIS4 and PEM7-BleoR-CYC1 tt on the pMChZ-AOX vector with DNA molecules whose nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

2. The construction method according to claim 1, characterized in that: The construction method specifically comprises the following steps: The pMChZ-α1(II) plasmid was transformed into the yeast host to obtain α1(II)-1#-Z R strain; The pPIC9K-P4H(DP)-1 plasmid was transformed into the α1(II)-1#-Z R strains, and obtained the α1(II)-1#-P4H strain; The pMCeH-α1(II) plasmid is transformed into the α1(II)-1#-P4H strain to obtain the engineered bacteria.

3. The construction method according to claim 1, characterized in that: The host bacteria is Pichia pastoris X33 or Pichia pastoris KM71.

4. The construction method according to claim 1, characterized in that: The BamHI located upstream of αMF in the pPIC9K plasmid was deleted by point mutation.

5. An engineered bacterium expressing triple helical type II recombinant human collagen constructed according to the construction method according to any one of claims 1 to 4.

6. Use of the engineered bacteria as claimed in claim 5 in the preparation of triple helical type II recombinant human collagen.

7. A method for preparing triple helical type II recombinant human collagen expressed in yeast, characterized in that: The method comprises the step of obtaining the triple helical type II recombinant human collagen by fermentation and purification using the engineering bacteria described in claim 5.

8. A triple helical type II recombinant human collagen prepared according to the preparation method of claim 7.

9. Use of the triple helical type II recombinant human collagen as claimed in claim 8 in the preparation of biomedical materials, cosmetics or medical devices.

Images