Application of fa hmgr gene in regulating strawberry color, aroma or in strawberry breeding

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to application of FaHMGR gene in regulation of strawberry color, aroma or in strawberry breeding. The present application clones the HMGR gene of strawberry, studies expression of the HMGR gene in different tissues and development stages, and studies the influence of FaHMGR on formation of fruit quality of strawberry through transient expression, combined with transcriptome and metabolome analysis, and the results show that HMGR influences the color and aroma of strawberry fruit, and has important influence on the quality of strawberry.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the FaHMGR gene in regulating strawberry coloring, aroma, or in strawberry breeding. Background Technology

[0002] As the most abundant class of compounds in plant secondary metabolites, terpenes play a crucial role in plant growth and development, environmental adaptation, and fruit quality formation. Strawberries are by far the world's most popular berry crop, valued for their unique flavor and nutritional components. Research on terpenes in strawberries focuses primarily on aroma. Terpenes are important components of volatile organic compounds (VOCs). Nine sesquiterpenes and three triterpenes have been found in Falandi strawberries. Although VOCs account for only 0.001%-0.01% of the strawberry's weight, they are key elements of strawberry flavor; even small changes can significantly alter the taste. Linalool and nerol are the main aroma components in strawberries. Menthol, α-pinene, β-myrcene, α-terpineol, and β-phellandrene are also present in different varieties and developmental stages of the fruit. Significant differences exist in the yields of linalool and nerol between wild and cultivated strawberries. The terpene synthase gene FaNES1 is specifically highly expressed in cultivated strawberry fruits, converting cytosolic geraniol diphosphate (GPP) and fructose diphosphate (FPP) into linalool and nerol. Researchers have used multi-omics to reveal grape flavor genes and their regulatory elements, showing that the distal region of strawberry Chr 3C is associated with various terpenes, and FaNES1 is significantly correlated with the content of linalool, β-myrcene, α-pinel, (E)-β-farnesene, and nerol.

[0003] On the other hand, the focus is on disease resistance mechanisms. Terpenes are one of the three most important metabolites involved in strawberry defense. Linalool and myrtleenol in strawberry leaves can effectively inhibit the spore germination and mycelial growth of *Strombocytosporum tobira*, preventing strawberry snake-eye disease. Studies have also confirmed that strawberry leaves produce monoterpenes under UV-C induction, interacting synchronously with ABA to resist pathogens. Terpinen-4-ol enhances resistance to gray mold and soft rot in strawberries by activating phenylpropanoid metabolic pathways in the fruit. Furthermore, the accumulation of triterpenoid metabolites leads to differences in resistance to nanoplastic exposure among different varieties. In wild strawberry species, there may be a link between rapidly induced terpene metabolism and autoimmunity leading to potential anthracnose resistance.

[0004] Terpenoids are synthesized in plants primarily through two pathways: the cytoplasmic MVA pathway and the plastid 2-methylerythritol-4-phosphate pathway (MEP pathway). Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is the first rate-limiting enzyme in the terpene MVA pathway and plays a crucial role in the biosynthesis of terpenoids in the cytoplasm. HMGR regulates the production of almost all different terpenoids in plants and occupies a central regulatory position in terpene-containing plants. HMGR is positively correlated with terpene production. Studies have shown that amplification of the HMGR and TPS genes leads to the enrichment of terpenes in roses. HMGR not only regulates the content of beneficial terpenoids such as sterols, rubber and resins, and saponins, improving adaptability to adverse environments, but also directly affects the synthesis of sesquiterpenes and triterpenoids, accelerating the accumulation of carotenoids in *Escherichia coli*. However, research on its association with fruit aroma, color and other quality traits is limited, and it has never been reported in strawberries. Studying the effects of HMGR on quality traits is of great significance for fruit development and ripening. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the FaHMGR gene in regulating strawberry coloring, aroma, or in strawberry breeding. This invention clones the HMGR gene of strawberry, studies its expression in different tissues and developmental stages, and investigates the effect of FaHMGR on strawberry fruit quality formation through transient expression.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of the FaHMGR gene in regulating strawberry coloring, aroma, or in strawberry breeding.

[0008] Preferably, the nucleotide sequence of the FaHMGR gene is shown in SEQ ID NO: 1.

[0009] The present invention also provides an expression vector, comprising an initial vector and the FaHMGR gene described herein.

[0010] Preferably, the initial carrier is pCAMBIA1302.

[0011] The present invention also provides a host, which is transformed or transfected with the expression vector described above; the host is a microorganism.

[0012] This invention also provides the application of the FaHMGR gene, the expression vector, or the host in regulating strawberry coloring, aroma, or in strawberry breeding.

[0013] The present invention also provides a silencing vector, comprising an original vector and the FaHMGR gene; the nucleotide sequence of the FaHMGR gene is shown in SEQ ID NO: 2.

[0014] The present invention also provides a silent recombinant bacterium, which is transformed or transfected with the aforementioned silent vector.

[0015] The present invention also provides the application of the silencing vector or the silencing recombinant bacteria in regulating strawberry coloring, aroma, or in strawberry breeding.

[0016] The raw transcriptome data has been uploaded to the SRA database in NCBI, accession number: PRJNA781262.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] HMGR is a key enzyme in the biosynthesis of terpenoids in plants, playing a crucial role in fruit development and quality traits. This invention cloned the HMGR gene from strawberry and investigated its expression and its impact on strawberry fruit quality. Results showed that the expression level of FaHMGR in the fruit was significantly higher than in other tissues, especially during the color-changing stage. Fruit with inhibited FaHMGR expression promoted strawberry coloring, with anthocyanin content 3.33 mg / g higher than the control, and the appearance of five new anthocyanin components, including pelargonidin-3-glucoside. Simultaneously, ABA content increased, MEP pathway gene expression was upregulated, aroma was increased, especially the variety of terpenes, while linalool content decreased. Strawberry fruit with overexpression of FaHMGR exhibited inhibited coloring, suppressed expression of most anthocyanin pathway genes, and decreased methyl hexanoate and linalool contents. Attached Figure Description

[0019] Figure 1 The expression of the FaHMGR gene and hormone levels in fruits from different tissues and at different developmental stages.

[0020] Figure 2 Transient expression of FaHMGR in strawberry. (A) Fruit development under transient FaHMGR expression in strawberry. The pie chart represents the chlorophyll and anthocyanin content in strawberry (green for chlorophyll; red for anthocyanin).

[0021] Figure 3 Anthocyanin composition in strawberries with overexpression and inhibition of FaHMGR expression. Data in the table represent peak areas.

[0022] Figure 4 To investigate the effects of overexpression and inhibition of FaHMGR expression on hormone levels.

[0023] Figure 5The image shows the detection of aroma components in strawberry fruit by the control group (CK). The red arrow represents linalool, which decreased after FaHMGR overexpression and inhibition. The green arrow indicates that the main aroma component, methyl hexanoate, also decreased (the same applies below).

[0024] Figure 6 The effect of FaHMGR overexpression on aroma components of strawberry fruit.

[0025] Figure 7 The effect of inhibited FaHMGR expression on aroma components of strawberry fruit.

[0026] Figure 8 To investigate the effect of transient FaHMGR expression on gene expression levels in anthocyanin and aroma metabolic pathways.

[0027] Figure 9 This is a vector map. Detailed Implementation

[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1

[0030] 1. Test materials

[0031] The experiment was conducted at the Yangdu Experimental Vineyard of the Zhejiang Academy of Agricultural Sciences (E 12024′, N 3026′). Red Face strawberry plants were used as experimental materials. Young roots, stems, leaves, petals, pistils, and fruits at different developmental stages were collected and immediately frozen individually in liquid nitrogen and stored at 80℃ to determine the tissue expression of the HMGR gene.

[0032] 2. Hormone content detection

[0033] The contents of auxin indole-3-acetic acid (IAA), abscisic acid (ABA), gibberellin (GA3), zeatin riboside (ZR), and BR hormones were determined using enzyme-linked immunosorbent assay (ELISA) according to Wang's method (Wang, YJJoEB, Mechanism of phytohormone involvement in feedback regulation of cotton leaf senescence induced by potassium deficiency. 63, p. 5887-5901 (2012)). Hormone extraction from samples: 0.5 g of pulp was added to 2 mL of sample extract (80% methanol, containing 1 mmol L-1 BHT), and ground in an ice bath. The mortar was cleaned twice, and the mixture was transferred to a 10 mL test tube and shaken well. The mixture was placed in a 4°C refrigerator for 4 hours, centrifuged at 3500 rpm for 8 minutes, and the supernatant was collected. Solid-phase extraction was performed using a C-18 column. The sample after column extraction was transferred to a 10 mL centrifuge tube, freeze-dried, and then brought to a final volume of 2 mL.

[0034] Result: From Figure 1 -A indicates that FaHMGR exhibits strong tissue-specific expression, with expression levels in different tissues, from highest to lowest, as follows: fruit, root, flower, stem, pistil, and leaf. The expression level of FaHMGR in fruit is significantly higher than in other tissues. From... Figure 1 -B indicates that FaHMGR expression gradually decreases during the fruit enlargement stage (fruit1-fruit3), increases during the fruit whitening stage (fruit4-fruit6), reaches its highest level at fruit7, when the fruit begins to turn red, and then gradually decreases until it reaches its lowest level at the ripening stage (fruit10).

[0035] By detecting the content of six hormones in fruits from different tissues and developmental stages, the levels of IAA and ABA were significantly higher than the other four, followed by JA-ME, while BR had the lowest levels in all tissues and developmental stages. The levels of several hormones were low in the roots, which is the opposite of the expression of the HMGR gene. At the initial coloring stage of the fruit (fruit7), the levels of GA3, ABA, ZR, JAME, and BR all increased to varying degrees, subsequently decreasing during the coloring process (fruit8).

[0036] 3. RNA extraction, cDNA synthesis, qRT-PCR

[0037] Total RNA was extracted from *Strombus halys* using the FastPure Plant Total RNA Isolation Kit (Vazyme, China). 1st Strand cDNA Synthesis Super Mix (Shanghai Yixian, China) synthesizes cDNA.

[0038] The quantitative PCR reaction system includes 5 μL of SYBR Premix Ex Taq. TM 0.3 μL primers (10 μM), 2 μL cDNA, and 2.4 μL RNase-free water were prepared, with a total volume of 10 μL. The PCR reaction conditions were: 95℃ for 30 s, 95℃ for 5 s (35 cycles), and 58℃ for 35 s. The strawberry ACTIN gene was used as an internal reference gene, and a 2– △Ct method.

[0039] Result: The specific gene sequence is as follows:

[0040] FaHMGR (as shown in SEQ ID NO: 1):

[0041] ATGGACTCTCGCCGTCGGTCCCCCAAACCGCCTCGCCCGACGGCCGTTAACGCTGG

[0042] GACCCACCCTCGAAATGACAAAGCGTCGTCTTCTTCATCAGGAGGAGAAGGACGC

[0043] GGTGGTGGAGCGAAAGCGTCCGACGCGCTGCCGCTGCCTTTTGTATCTGACGAACGC

[0044] CGTGTTCTTTACTCTCTTCTCTCCGTGGCGTACTACCTCCTCCACCGCTGGCGCGAC

[0045] AAGATCCGAACCTCCACGCCGCTCCACGTCGTCAACCTCTCCGAGCTCGCCGCCAT

[0046] TTCCTCCCTCCATCGCCTCCTTCCTACCTCCTCGGCTTCTTCGGCATCGACTTCGTC

[0047] CAGTCCTTCATCTCACGCGCCTCCCACTACGACGACGCCTGGGACGACGACGATGC

[0048] CGACGACGACGTCATCGTTCCGGCGAAATTCGTCGACGCAGACCCGGCATTGTGCT

[0049] CCGAGGAGGACGAGGAGATCATCCAGGCCGTTCTAAACGGCGACGTTCCGTCCTAC

[0050] TCGCTAGAATCGAAGCTCGGCGACTGCAAGAGAGCGGCGGTGATCCGGCGCGAGT

[0051] GGCTCCAGAGAACGACCGGGAGGTCGCTGCAGGGTTTGCCTCTGGAAGGATTCGA

[0052] TTACGGCTCGATTCTAGGGCAGTGCTGCGAGTCGCCGGTCGGATACGTGCAGATTCC

[0053] GGTGGGAATCGCCGGGCCGTTGTTGCTCGACGGGTTCGAGTACATGGTGCCAATGG

[0054] CGACGACGGAGGGGTGCCTTGTGGCGAGCATGAACAGAGGTTGCAAGGCTATTCTC

[0055] CTCTCCGGTGGGGCTGACTCCCGGGTTTATAGGGACGGCATGACCAGAGCTCCGGT

[0056] GGTCAAGTTTGCCTCTGCCGTCAGAGCTTGCGATCTCTTATGCTACTTGGAGAACCG

[0057] TGCCAATTTTGATACTCTCGCCGTCGTTTTCAATAGATCAAGTCGATTTGCGAGGCTA

[0058] CAGAGCATATTTCCTTCTCTTTCTGGGATGACGCTCCACGTAAGATTTAATTGCACCA

[0059] CAGGTGATGCCATGGGGATGAATATGGTCTCCAAAGGGGTTCAGAATGTCCTTGATT

[0060] ATCTGCAAAACGACTTTCCTGATATGGAGGTTATCGGCATATCTGGAAATTTTTGTTC

[0061] GGACAAGAAATCTGCAGCTGTAAACTGGATTCTAGGACGTGGCAAATCAGTTGTTT

[0062] GCGAAGCAGTTATCAAGGAAGAGGTGATCAAAGAAGTGTTGAAAACGAACGTGTC

[0063] TAAGCTGGTACAACTCCAGCAGAATAAGATCTTTGTAGGTACTGCCATGGCCGGAAC

[0064] TGTGGGTGGGTATAATGCCCATGCCAGCAACATTGTATCTGCAATATTTATAGCCACC

[0065] GGCCAAGATCCTGCACAGAATGTTGAGAGTTCTCACTGTCTAACGAATATTGTATCC

[0066] ATCAATGACGGGAAGGACATTCATGCTTCCATCACAATGCCTTGTATCGAGGTTGGT

[0067] ACAATTGGTGGTGGGACTCAACTTGCATCTCAATCTGCTTGCTTGAATATGCTTGGC

[0068] GTAAAAGGTGCAAGCCAAGGGTCCCCTGGATCAAACTCGAGGAGGTTGGCCACCA

[0069] TTATAGCCGGTTCAGTACTGGCCGGAGAACTCAGCCTCCTATCCGCCATGGCTGCTG

[0070] GTGATATGGTCAAGAGTCACATGAAATACAACAGATCCAGCAAAGATATTTCTAATG

[0071] CTGCATCT

[0072] The restriction enzyme sites are: BglII (AGATCT) - SpeI (ACTAGT)

[0073] The primers adding protective bases for the restriction enzyme sites are:

[0074] GAAGATCTATGGACTCTCGCCGTCGGTCCCC

[0075] GGACTAGTAGATGCAGCATTAGAAATATCTT;

[0076] As shown in SEQ ID NO: 3 and 4.

[0077] FaHMGRi (as shown in SEQ ID NO: 2):

[0078] AGATCTCCGTAATCGAATCCTTCCAGAGGCAAACCCTGCAGCGACCTCCCGGTCGT

[0079] TCTCTGGAGCCACTCGCGCCGGATCACCGCCGCTCTCTTGCAGTCGCCGAGCTTCG

[0080] ATTCTAGCGAGTAGGACGGAACGTCGCCGTTTAGAACGGCCTGGATGATCTCCTCGT

[0081] CCTCCTCGGAGCACAATGCCGGGTCTGCGTCGACGAATTTCGCCGGAACGATGACG

[0082] TCGTCGTCGGCATCGTCGTCGTCCCAGGCGTCGTCGTAGTGGGAGGCGCGTGAGAT

[0083] GAAGGACTGGACGAAGTCGATGCCGAAGAAGCCGAGGAGGTAGATGAAGGAGGC

[0084] GATGAGGGAGAGAATGGCGGCGAGCTCGGAGAGGTTGACGACGTGGAGCGGCGT

[0085] GGAGGTTCGGATCTTGTCGCGCCAGCGGTGGAGGAGGTAGTACGCCACGGAGAAG

[0086] AAGAGAGTAAAGAACACGGCGTTCGTCAGATACAAAGGCAGCGGCAGCGCGTCGG

[0087] ACGCTTTCGCTCCACCACCGCGTCCTTCTCCTCCTGATGAAGAAGACGACGCTTTGT

[0088] CATTTCGAGGGTGGGTCCCAGCGTTAACGGCCGTCGGGCGAGGCGGTTTGGGGGA

[0089] CCGACGGCGAGAGTCCATCGGCATCGACTTCGTCCAGTCCTTCATCTCACGCGCCTC

[0090] CCACTACGACGACGCCTGGGACGACGACGATGCCGACGACGACGTCATCGTTCCGG

[0091] CGAAATTCGTCGACGCAGACCCGGCATTGTGCTCCGAGGAGGACGAGGAGATCATC

[0092] CAGGCCGTTCTAAACGGCGACGTTCCGTCCTACTCGCTAGAATCGAAGCTCGGCGA

[0093] CTGCAAGAGAGCGGCGGTGATCCGGCGCGAGTGGCTCCAGAGAACGACCGGGAG

[0094] GTCGCTGCAGGGTTTGCCTCTGGAAGGATTCGATTACGGACTAGT

[0095] The restriction enzyme site is: BglII(AGATCT)-SpeI(ACTAGT)

[0096] The primer with added enzyme cleavage site protection bases is:

[0097] GAAGATCTAGATCTCCGTAATCGAATCCTTC

[0098] GGACTAGTACTAGTCCGTAATCGAATCCTTC;

[0099] As shown in SEQ ID NO: 5 and 6.

[0100] 4. Transient expression levels of FaHMGR and FaHMGRi in strawberries

[0101] The full-length coding sequences of FaHMGR and FaHMGRi were cloned from the cDNA of *Strombus haematocephala*. The cloned sequences were then transferred into the pCAMBIA1302 vector (abbreviated as p35S) to generate plasmids p35S-FaHMGR-GFP and p35S-FaHMGRi-GFP.

[0102] Transform the constructed expression vector into Agrobacterium: (1) Add 10 μL of plasmid to 100 μL of EHA105 Agrobacterium competent cells and mix well with a pipette tip; (2) Incubate on ice for 30 min, then quickly freeze in liquid nitrogen for 3 min; (3) After quick freezing, heat shock in a 37℃ water bath for 2 min; (4) Add 800 μL of LB liquid medium without any resistance; (5) Shake and incubate at 150 rpm for 4-6 h; (6) Centrifuge at 5000 rpm for 5 min, leave 100 μL of liquid to resuspend the precipitate, and plate it on LB medium containing 50 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Km). After transformation, pick a single colony for detection; (7) Pick a single colony and shake it in LB liquid medium (50 mg / L Rif, 50 mg / L Km), and then perform PCR identification (the same reaction system and procedure as in step 3).

[0103] Primers for clonal bacteria detection:

[0104] F: GAGGAGGTAGATGAAGGAGG;

[0105] R:ACTCTCGCCGTCGGTCCCCC;

[0106] As shown in SEQ ID NO: 7 and 8.

[0107] After the constructed plasmid vector was transferred into Agrobacterium EHA105, strawberries at the green fruit stage were infected, with the empty vector pCAMBIA-1302 as a control. The specific steps are as follows: (1) Agrobacterium transfected with the vector was activated by streaking on a plate, cultured at 28℃ for 2 days, and then a single colony was picked. After PCR testing showed a positive result, LB medium was added and the culture was shaken at 28℃ for 2 days. The OD was measured. 600 (1) The concentration is about 0.8; (2) Centrifuge at 5000 rpm for 8 min, discard the supernatant, add sterile water to resuspend the bacterial cells, centrifuge again, discard the supernatant, and repeat three times; (3) Prepare an injection buffer containing 100 mM MgCl2, 100 mM 2-morpholine ethanesulfonic acid (MES), and 150 mM acetylsyl syringone (AS); (4) Resuspend the bacterial cells in the injection buffer and let stand at 28℃ for 3 h; (5) Select strawberries with uniform growth and large green fruit stage, inject the bacterial solution into the strawberry from the top of the strawberry using a 1 mL syringe with the needle removed, and try to make the bacterial solution soak the entire fruit; (6) Place the injected strawberries in the dark at 25℃ for 12 h, and then transfer them to a light cycle environment of 16 h light / 8 h dark for cultivation.

[0108] Then, the anthocyanin content, aroma components and expression levels of related genes were detected using the gene-specific primers listed in Table 1 (using the same reaction system and procedure as in step 3).

[0109] Table 1 Primer List

[0110]

[0111]

[0112] As shown in SEQ ID NO: 9-66.

[0113] 5. Determination of anthocyanin and chlorophyll content, and identification of anthocyanin components.

[0114] The contents of anthocyanins, chlorophyll, and carotenoids in Benehop strawberries were determined spectrophotometrically. Anthocyanin components were determined by liquid chromatography-mass spectrometry (μLC-MS). Total anthocyanins were extracted using the methanol-HCl method. Samples (0.1 g) were soaked in 5 mL of methanol containing 0.1% (v / v) HCl and incubated overnight at room temperature in the dark. The anthocyanin content in the samples was determined using a pH differential method. The absorbance of the sample extracts at 520 and 700 nm was measured using a UV-2550 spectrophotometer (Shimadzu). The content of each component was determined by peak area.

[0115] 6. Aroma component determination

[0116] Aroma components transiently expressed in strawberry fruit were determined by gas chromatography-mass spectrometry (GC-MS). Following the method of Zheng et al. (Zheng, T., Lv, JH, Sadeghnezhad, E., Cheng, JH, & Jia, HFT ranscriptomic and metabolomic profiling of strawberry during postharvest cooling and heatstorage. Frontiers in Plant Science. 13, (2022)), 3 g of sample was ground and transferred to a headspace vial (20 mL). 3 mL of saturated NaCl solution and 2 μL of 3-nonanone were added as an internal standard. The sample was analyzed using a gas chromatograph (TRACE 1310, Thermo Scientific) coupled to a triple quadrupole mass spectrometer (TSQ 9000, Thermo Scientific). The column temperature was programmed as follows: initial temperature set at 50 °C, held for 6 min; then increased to 250 °C at 6 °C / min, held for 3 min. MS conditions: EI mode; voltage: 70 eV; ion source temperature: 230 °C; scan rate: 2.88 scans / s1; mass spectrometry detection range: 29–540 m / z -1 Carrier gas: helium; Flow rate: 1.0 mL / min.

[0117] 7. Data Statistical Analysis

[0118] All data (at least 3 replicates, N=3) are presented as mean with standard error (SEMs). Mean SEM values ​​for each treatment were calculated using Microsoft Excel. Analysis of variance (ANOVA) was performed using SPSS 17.0 software, with Duncan's multiple range test, and p < 0.05 was considered acceptable. Figures were generated using OriginPro 9.

[0119] result:

[0120] (1) Effects of transient FaHMGR expression on strawberry coloring and aroma

[0121] from Figures 2-4 It was found that strawberries overexpressing HMGR exhibited inhibited coloring and had the lowest anthocyanin content. Strawberries with inhibited expression promoted coloring, with anthocyanin content 3.33 mg / g higher than the control. Analysis of anthocyanin components revealed the presence of Cyanidin 3-O-(6”-malonyl-3”-glucosyl-glucoside, Cyanidin 3-O-glucoside, Cyanidin 3-O-rutinoside, Cyanidin 3-O-sophoroside, and Delphinidin 3-O-rutinoside in strawberries expressing FaHMGRi, components absent in the control and FaHMGR-expressed strawberries. Besides these newly appearing components, the levels of other components in FaHMGRi were significantly higher than in the control and FaHMGR-expressed strawberries. Cyanidin 3-O-(6” p-acyl glucoside) was present in strawberries expressed with FaHMGR, but not in the control and FaHMGRi. The ABA content in strawberries expressed with FaHMGRi was significantly higher than that in strawberries overexpressed with FaHMGR and the control. The contents of BR, ZR, and GA3 in strawberries overexpressed with FaHMGR were also significantly higher than those in strawberries expressed with FaHMGRi.

[0122] from Figures 5-7It is known that the types and amounts of aroma compounds determine the flavor and varietal typicality of the fruit. In this study, 93, 84, and 120 substances were detected in strawberries expressing CK, FaHMGR, and FaHMGRi, respectively, including esters, ketones, aldehydes, alcohols, terpenes, and small amounts of furans, phenols, and acids. Among them, esters are the main aroma components of strawberries, especially methyl hexanoate, which had a content of 18.96% in the control, but decreased in strawberries expressing FaHMGR and FaHMGRi. Another major component, 2-Hexen-1-ol, acetate, decreased in content in strawberries expressing FaHMGRi, but remained essentially unchanged in strawberries expressing FaHMGR. HMGR is a gene for the terpene metabolic pathway, and the monoterpene linalool is the main terpene aroma compound in strawberries. The linalool content was 0.62% in CK, and decreased in strawberries expressing FaHMGR and FaHMGRi, to 0.13% and 0.37%, respectively. Meanwhile, we also detected other terpenoids in strawberries expressed in CK and FaHMGRi. Limonene (0.16%) was detected in CK, and α-pinene (0.03%), β-pinene (0.05%), terpineol (0.01%), and caryophyllene (0.01%) were detected in FaHMGRi.

[0123] from Figure 8 The results showed that the expression levels of anthocyanins and aroma-related genes in strawberries expressing CK, FaHMGR, and FaHMGRi were lowest in strawberries expressing FaHMGR. This indicates that FaHMGR expression inhibited the expression of most anthocyanin pathway genes. The expression levels of Fa4CL, Fa4CL2, and FaDFR increased in strawberries expressing FaHMGR. In strawberries expressing FaHMGRi, the expression levels of FaC4H, FaCHS, FaANS, FaUFGT, FaMYB10, FabHLH143, FaWD40, and FaPAL2 were higher than those in strawberries expressing CK and FaHMGR.

[0124] Among the genes related to aroma synthesis, FaCNL, FaPIN, and FaNCED3 were expressed at the highest levels in strawberry fruits expressing FaHMGR, while FaDAHPS1, FaDAHPS2, FaNES1, FaOMT, FaCHP1, FaAAT, FaQR, and FaNCED1 were expressed at the lowest levels in strawberry fruits expressing FaHMGR. After inhibiting FaHMGR expression, the expression levels of FaNES1, FaOMT, FaCHP1, FaAAT, FaQR, and FaNCED1 increased significantly.

[0125] (2) The expression level of HMGR affects the quality of strawberry fruit.

[0126] Few studies have investigated the effects of HMGR on fruit quality changes related to terpenoids. The main impacts of HMGR on fruit quality involve coloring and aroma. The MVA and MEP pathways are not completely separate due to the exchange of unknown transport proteins across the plasma membrane, creating a so-called "metabolic crosstalk." HMGR regulates color formation by affecting the MEP pathway and anthocyanin synthesis. HMGR can encode functional proteins that accelerate carotenoid biosynthesis. Some researchers have also found that the expression levels of VvHMGRs are generally higher in yellow varieties than in red varieties. HMGR can positively regulate terpenoid metabolism, thereby affecting hormone synthesis and indirectly regulating anthocyanin accumulation; the truncated form of HMGR (tHMG) can increase endogenous sesquiterpenes by 37-fold and phytopenic acid by 100-fold. HMGR may also affect anthocyanin synthesis through interaction with PIF3 and negative regulation by phyB and HY5.

[0127] In this invention, the coloring of strawberry fruits overexpressed with HMGR was inhibited, the expression of most anthocyanin pathway genes was inhibited, and the fruit with inhibited HMGR expression promoted strawberry coloring, with anthocyanin content 3.33 mg / g higher than the control.

[0128] Strawberry aroma is beneficial to the quality of fruits and their derivatives, as well as consumer health. Strawberry aroma is one of the most complex and abundant fruit aromas, with over 350 volatile compounds identified to date (Oh Y2021). Strawberries release a rich array of aroma compounds, mainly including esters, terpenes, alkanes, alcohols, acids, aldehydes, and ketones. Terpenes are the primary source of floral aroma (Peng 2019). The terpenes associated with strawberry aroma mainly include monoterpenes (C10), sesquiterpenes (C15), and triterpenes (C30), all of which were monoterpenes detected in this study. The highest variety of terpenes, especially monoterpenes, was detected in strawberries expressing the FaHMGRi gene, indicating that inhibiting HMGR gene expression promotes the expression of the monoterpene synthesis pathway MEP. Studies in grapes have shown a positive correlation between HMGR expression and monoterpene accumulation and aroma intensity in Muscat grapes, which may be related to species differences.

[0129] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Knockout FaHMGR The application of genes in increasing the variety of aroma compounds in strawberries is characterized by, The FaHMGR The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

Images