Agrobacterium tumefaciens-mediated oil palm genetic transformation method

Abstract

The invention provides an agrobacterium tumefaciens-mediated genetic transformation method for oil palm, which comprises the following steps of: screening and using agrobacterium tumefaciens liquid concentration, dip dyeing time, co-culture time, acetosyringone concentration and antibiotic concentration which are most suitable for genetic transformation of the oil palm in a transformation process in an agrobacterium tumefaciens-mediated manner by taking an oil palm embryonic callus as an explant; an expression cassette containing the EPSPS mutant gene is used as a screening marker, and glyphosate is used as a screening agent for screening, so that the glyphosate-resistant callus is successfully obtained. The screening efficiency of the method exceeds that of a traditional hpt / hygromycin screening system. Meanwhile, the effectiveness of the EPSPS / glyphosate screening system in genetic transformation of the oil palm is also proved, the EPSPS / glyphosate screening system is marked to be applied to genetic transformation of the oil palm for the first time, and a valuable tool is provided for promoting research of an important economic crop.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology and provides a genetic transformation method of oil palm embryonic callus mediated by Agrobacterium. Background Art

[0002] Oil palm (Elaeis guineensis Jacq.) is one of the four major woody edible oil plants in the world (the other three include coconut, tea and olive), one of the tropical woody oil crops, one of the most important economic crops in tropical regions, and the most efficient oil-producing plant in the world. It only accounts for 5% of the planting area worldwide, but the palm oil it produces accounts for 33% of all vegetable oils and 45% of edible oils. In 2023, from the perspective of global vegetable oil production, the annual output of palm oil will be 79.26 million tons, accounting for 36% (palm kernel oil accounts for 4%), still occupying the position of the world's largest oil, and the combined share of soybean oil and rapeseed oil will reach 79%.

[0003] Genetic transformation technology is considered to be an extension of oil palm breeding technology. Traditional breeding not only has a long generation cycle (each generation takes 10-15 years), but also species incompatibility limits genetic resources; genetic transformation breaks the limitations of traditional breeding improvement, broadens the source of genes, accelerates breeding, and can produce high-value traits that cannot be obtained through traditional breeding. It can also improve competitiveness and ensure the sustainability of the industry. It is also one of the necessary means for studying the gene function of oil palm. Institutions that conduct research on genetic transformation technology of oil palm are mainly concentrated in Malaysia, Indonesia, Thailand and Latin America, but in the early stage, only the Malaysian Palm Oil Board (MPOB) publicly published the results and new technologies obtained from the exploration of genetic transformation technology for oil palm. The research on genetic transformation of oil palm progressed relatively late, starting in the late 1980s at MPOB, and made significant progress and breakthroughs in the 1990s. Subsequently, a series of studies on factors that can improve the transformation efficiency of oil palm, such as oil palm explants and genetic transformation methods, have been conducted, and some progress has been made, but the progress is relatively slow. At present, oil palm transformation still faces a major problem, that is, how to obtain an efficient and stable genetic transformation method. The stable transformation efficiency obtained by particle bombardment (gene gun method) is 1%-1.5%, and the stable transformation efficiency obtained by Agrobacterium-mediated transformation is 0.7%-1%; while the transient transfection rate of PEG-mediated protoplast transformation is 4.22%, and the transient transfection rate of new DNA microinjection oil palm protoplasts is 14%. Although stable genetics and transient transformation have been used for oil palm transformation, compared with other crops such as rice, corn, and soybeans, their stable transformation efficiency is still relatively low, and it is urgent to further explore how to improve the transformation efficiency or screening efficiency of oil palm. Up to now, there has been no report on the genetic transformation of oil palm in China. Summary of the invention

[0004] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a method for genetic transformation of oil palm, which uses oil palm embryonic callus as a transformation receptor, mediates through Agrobacterium, and screens for new glyphosate to transform exogenous genes and successfully obtain resistant callus tissue.

[0005] In order to achieve the above purpose, the scheme of the present invention is as follows:

[0006] An Agrobacterium-mediated efficient genetic transformation method for oil palm embryonic callus comprises the following steps:

[0007] (1) Subculture of callus tissue:

[0008] Select light yellow, granular, dry and vigorous callus tissue and place it in subculture proliferation medium for multiplication by subculture;

[0009] The composition of the secondary proliferation medium is MS0, which is: MS medium supplemented with glutamine, vitamin B1, ascorbic acid, sucrose, coconut water, agar and activated carbon;

[0010] (2) Callus pre-culture

[0011] Select light yellow, granular, dry, and vigorous callus tissue, cut it into 8-12 mm small pieces, transfer it into pre-culture medium, and pre-culture it in the dark for 3-4 days;

[0012] The composition of the pre-culture medium is: MS0+100 μM-300 μM acetosyringone (preferably 200 μM)+50-200 mg / L cysteine;

[0013] (3) Preparation of Agrobacterium infection solution

[0014] The Agrobacterium containing the recombinant plasmid of the screening expression cassette of the EPSPS mutant gene is streaked and plated, and incubated for propagation; the propagated Agrobacterium is scraped into the MS0 liquid medium containing 100 μM to 300 μM acetosyringone (preferably 200 μM), the bacteria are suspended, and the cell solution is shaken for 20 min to 1 h. The density of the cell solution is OD 600 The value is adjusted to 0.5-0.7 (preferably 0.5-0.6) for dip dyeing;

[0015] The composition of MS0 liquid medium is: MS medium supplemented with glutamine, vitamin B1, ascorbic acid, sucrose, and coconut water;

[0016] (4) Dyeing

[0017] Wild-type embryonic callus with good growth status was placed in Agrobacterium infection solution and infected for 30min to 1h;

[0018] (5) Co-culture

[0019] The infected embryonic callus was transferred to the co-culture medium and co-cultured in an incubator at 19°C-22°C;

[0020] (6) Degerming and cleaning

[0021] After co-cultivation, wash with sterile water until the sterile water is clear; prepare a solution containing antibacterial antibiotics, transfer the embryonic callus into the solution, and place it on a shaker for shaking; after pouring out the liquid, spread the callus on sterile filter paper, blow it on the workbench for 2-3 hours, and turn it over to dry;

[0022] (7) Screening of resistant callus

[0023] Prepare an oil palm embryonic callus screening medium containing a screening agent (glyphosate), transfer the sterilized, cleaned and dried embryonic callus tissue to the screening medium, and place 9-15 calli per dish; regularly replace the new screening medium, and perform screening and culture 4-5 times to obtain resistant calli.

[0024] Preferably, the composition of the subculture proliferation medium is MS0, which is: MS medium supplemented with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 6 g / L agar and 0.5 g / L activated carbon.

[0025] Preferably, the composition of the MSO liquid culture medium is: 0.05 g / L ascorbic acid, 30 g / L sucrose, and 100 ml / L coconut water are added to the MS culture medium.

[0026] Preferably, the Agrobacterium in step (3) is Agrobacterium tumefaciens EHA105 or LBA4404 or GV3101.

[0027] Preferably, step (4) is: placing the wild-type embryonic callus in good growth condition in an Agrobacterium infection solution for infection for 30 minutes to 1 hour, and then pouring out the bacterial solution; blotting with sterile filter paper, and blowing under a clean bench for 30 to 60 minutes until there is no obvious liquid on the tissue surface.

[0028] Preferably, the nucleotide sequence of the EPSPS mutant gene expression cassette is as shown in SEQ ID NO.1.

[0029] Preferably, the co-culture medium described in step (5) has the same components as the pre-culture medium described in step (2).

[0030] Preferably, the antibacterial antibiotic solution is a 500 mg / L ceftriaxone sodium solution or a 500 mg / L timentin solution.

[0031] Preferably, the screening medium described in step (7) is: MS0+500 mg / L antibacterial antibiotic solution+1.5-5 mM glyphosate.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention provides a method of using oil palm embryonic callus as a receptor material, adopting an Agrobacterium-mediated method, screening and using the Agrobacterium bacterial liquid concentration, impregnation time, co-cultivation time, acetosyringone concentration and antibiotic concentration most suitable for oil palm genetic transformation in the transformation process, and successfully obtaining glyphosate-resistant callus. The glyphosate screening of the present invention is the first application to the genetic transformation of oil palm, and the obtained screening efficiency is higher than the existing hygromycin screening efficiency. The EPSPS mutant gene provided by the present invention can be efficiently expressed in oil palm, and the oil palm callus has a higher glyphosate resistance. At the same time, the present invention also provides a plant transgenic screening expression cassette using the EPSPS mutant gene as a screening marker and a corresponding genetic transformation screening method. The plant genetic transformation screening vector of the present invention is attached with a red fluorescent gene as a reporter gene to carry out genetic transformation of oil palm. The screening marker of the present invention is a plant-derived gene, and no exogenous screening marker genes such as bacterial sources are introduced in the genetic transformation process, which not only enriches the plant transgenic screening method, but also effectively reduces the potential safety risks of transgenic plants caused by exogenous genes such as bacterial sources and the public's concerns about the safety of transgenic plants, which is conducive to the commercial application of transgenic oil palm, and has good market value and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The minimum inhibitory concentration test of wild-type callus of oil palm against the screening agent in Example 1 of the present invention. a: Tolerance test of wild-type EC of oil palm against glyphosate; b: Tolerance test of wild-type EC of oil palm against hygromycin. The numbers represent different concentrations of the screening agent added to the screening medium.

[0035] Figure 2The transformation of oil palm mediated by Agrobacterium based on pCGlyDESCL-C vector and pCHnDESCLⅠ-C vector in Example 2, Example 10 and Example 11 of the present invention. a~b: T-DNA of pCGlyDESCLI-C vector and pCHnDESCLⅠ-C respectively (Gly represents glyphosate; Hn represents hygromycin; EPSPS expression cassette: glyphosate selection expression cassette; 35SPro represents CaMV35S constitutive promoter; Ltp2pro represents seed-specific promoter; mSCLⅠ represents mScarlet-Ⅰ; AtHSP-Ter represents Arabidopsis heat shock protein terminator; Hpt expression cassette represents hygromycin selection expression cassette; com25 expression cassette represents a fatty acid function gene expression cassette); c: wild-type EC; d: impregnation; e: wild-type EC is selected and cultured on a selection medium containing 3mM glyphosate for about 15 weeks; f: positive callus is cultured on a selection medium containing 3mM glyphosate for 15 weeks. g: Wild-type EC cultured on a selection medium containing 60 mg / L hygromycin for 15 weeks; h: Positive calli were obtained on a selection medium containing 60 mg / L hygromycin about 15 weeks after infection. White arrows indicate suspected resistant calli in f and h.

[0036] Figure 3 The visualization of the RFP and PCR detection results of glyphosate or hygromycin resistant callus in Example 12 of the present invention. a-c, d-f and g-i: bright field, RFP and Merged visualization on wild-type ECs, glyphosate-resistant ECs and hygromycin-resistant ECs, respectively; J and k: PCR detection results of glyphosate-resistant callus and hygromycin-resistant callus (WT: wild-type EC; p: vector pCGlyDESCLⅠ-C or pCHnDESCLⅠ-C plasmid as positive control, respectively; lanes 1-22: independent samples of glyphosate-resistant callus; lanes 1-18: independent samples of hygromycin-resistant callus).

[0037] Figure 4 The efficiency comparison of the two oil palm screening systems mediated by Agrobacterium in Examples 10, 11 and 12 of the present invention is shown in Figure 1. SRCe: suspected resistant callus efficiency; RFPe: red fluorescent protein efficiency; PCR by PRCe: positive callus efficiency of resistant callus detected by PCR.

[0038] Figure 5The transgenic positive and glyphosate-resistant callus tissue was detected by Southern Blot using the EgmSCLⅠ gene as a probe in Example 12 of the present invention. WT: wild-type EC oil palm genomic DNA; P: pCGlyDESCLⅠ-C vector plasmid was used as a positive control, digested with EcoRⅠ, and the arrow indicates the band; 1-5: 5 PCR-positive ECs samples; E and A: ECs sample genomic DNA was digested with EcoRⅠ or AvrⅡ, respectively. DETAILED DESCRIPTION

[0039] The method for efficient genetic transformation of oil palm embryonic callus mediated by Agrobacterium comprises the following steps:

[0040] (1) Subculture of callus tissue:

[0041] Select light yellow, granular, dry and vigorous callus tissue and place it in the subculture proliferation medium EgcSPM, and subculture it once a month for propagation; culture it at (27±1)℃, light intensity of 3000lx, and light time of 12h / d;

[0042] The composition of the subculture proliferation medium is MS0, which is: MS medium supplemented with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 6 g / L agar and 0.5 g / L activated carbon.

[0043] (2) Callus pre-culture

[0044] Select light yellow, granular, dry, and vigorous callus tissue, cut it into 8-12 mm small pieces, transfer it into the pre-culture medium EgcPCM, and pre-culture it at 28°C in the dark for 3-4 days;

[0045] The composition of the pre-culture medium is: MS0 + 100 μM to 300 μM acetosyringone + 50 to 200 mg / L cysteine;

[0046] (3) Preparation of Agrobacterium infection solution

[0047] Agrobacterium tumefaciens EHA105 or LBA4404 or GV3101 containing the recombinant plasmid of the screening expression cassette of the EPSPS mutant gene was streaked and incubated at 28°C for propagation; the propagated Agrobacterium was scraped into the MS0 liquid medium containing 100 μM to 300 μM acetosyringone, the cells were suspended, and the cell solution was shaken for 20 min to 1 h. The density of the cell solution was OD 600 The value is adjusted to 0.5-0.7 for dip dyeing;

[0048] The composition of MS0 liquid culture medium is as follows: 0.05 g / L ascorbic acid, 30 g / L sucrose, and 100 ml / L coconut water are added to MS culture medium.

[0049] The nucleotide sequence of the expression cassette is shown in SEQ ID NO.1.

[0050] (4) Dyeing

[0051] Place wild-type embryonic callus tissue with good growth status in the Agrobacterium infection solution for 30 minutes to 1 hour, shake the bacterial solution every 10 minutes, and then pour out the bacterial solution; use sterile filter paper to absorb dryness, and blow under the clean bench for 30 to 60 minutes until there is no obvious liquid on the tissue surface (room temperature, dark);

[0052] (5) Co-culture

[0053] The infected embryonic callus was transferred to the co-culture medium EgPCM (same as the pre-culture medium composition) and co-cultured in an incubator at 19°C-22°C for 72h (darkness);

[0054] (6) Degerming and cleaning

[0055] After co-cultivation, wash with sterile water until the sterile water is clear; prepare a solution containing antibacterial antibiotics, transfer the embryonic callus into the solution, place it on a shaker, and shake it at 140 rpm for 30 minutes; after pouring out the liquid, spread the callus on sterile filter paper, blow it on the workbench for 2-3 hours, and turn it over to dry;

[0056] (7) Screening of resistant callus

[0057] Prepare an oil palm embryonic callus screening medium EgcSM (MS0+500 mg / L antibacterial antibiotic solution+3-5 mM glyphosate) containing a screening agent (glyphosate), transfer the sterilized, washed and dried embryonic callus tissue to the screening medium, and place 9-15 calli per dish; replace the new screening medium every three weeks, and perform screening and culture 4-5 times to obtain resistant calli;

[0058] The solution of the antibacterial antibiotic is a 500 mg / L ceftriaxone sodium solution or a 500 mg / L timentin solution.

[0059] (8) Molecular biological identification of transgenic callus

[0060] The obtained resistant callus was used for transgenic detection by using molecular biological methods such as fluorescence, PCR and southern blot hybridization.

[0061] In order to better understand the technical content of the present invention, specific embodiments are provided below to further illustrate the present invention.

[0062] Unless otherwise specified, the experimental methods used in the embodiments of the present invention are all conventional methods.

[0063] Unless otherwise specified, the materials, reagents, etc. used in the embodiments of the present invention can be obtained from commercial sources.

[0064] Example 1 Minimum inhibitory concentration test of glyphosate during the callus period of oil palm

[0065] Wild-type embryonic calli (ECs) of oil palm were propagated and placed on selection medium containing different concentrations of glyphosate and hygromycin (Table 1). The growth of ECs after 13 weeks of selection culture was shown in Figure 1. Figure 1 , after testing the critical concentration of wild-type oil palm callus with multiple gradients of glyphosate, it can be seen that when no glyphosate is added to the screening medium, the callus tissue grows fast and new callus grows, and the new callus rate is 95.56%±3.85%; when 1mM glyphosate is added to the screening medium, the callus begins to be inhibited, and some callus growth is inhibited and browning occurs, but some callus grow new callus, and the new callus rate is 33.33%±4.44%; when 3mM or 5mM glyphosate is added to the screening medium, most callus are significantly inhibited. Although individual callus grows, their color has begun to change and slowly turns brown. After 16 weeks of screening culture, all callus die, and the new callus rate is 0; glyphosate concentrations higher than 5mM have a significant inhibitory effect on callus growth, and browning is more serious than lower concentrations. All callus die after 15 weeks of screening culture, and the new callus rate is 0. Compared with hygromycin, glyphosate screening causes slower and less browning, but it inhibits the increase in callus volume until the callus slowly loses growth vitality and dies. Combined with the results of three repetitions, 3mM can be selected as the minimum inhibitory concentration of glyphosate screening in genetic transformation of oil palm embryonic callus. The present invention selects EPSPS / glyphosate as a new screening system for genetic transformation of oil palm, and the hpt / hygromycin screening system will be used as a control for subsequent comparison of oil palm transformation.

[0066] Table 1. Minimum inhibitory concentration test of glyphosate and hygromycin on non-transgenic callus

[0067]

[0068] Example 2 Construction of Oil Palm Genetic Transformation Screening Vector

[0069] Based on the pCAMBIA1300 vector, an EPSPS mutant gene expression cassette (SEQ ID NO.1) optimized by the host codon of oil palm (Elaeis guineensis Jacq.), a variant of the red fluorescent protein gene mRed7 mScarlet-Ⅰ (abbreviated as mSCLⅠ) (Bindels DS, Haarbosch L, Van Weeren L, et al. mScarlet: a bright monomeric red fluorescent protein for cellular imaging. [J]. Nature Methods, 2017. DOI: 10.1038 / nmeth.4074.) and a fatty acid function gene com25 (Whittle E, Shanklin J. Engineering delta 9-16:0-acyl carrier protein (ACP) desaturase specificitybased on combinatorial saturation mutagenesis and logical redesign of the castor delta 9-18:0-ACP desaturase. [J]. Journal of Biological Chemistry, 2001, 276(24):21500-21505.DOI:10.1074 / jbc.M102129200.), and the constructed expression vector was named pCGlyDESCLI-C ( Figure 2 , a), where Gly represents glyphosate selection. The pCHnDESCLⅠ-C vector is different from the pCGlyDESCLI-C vector only in terms of the selection marker gene ( Figure 2 , b), this vector will be used as a control for the new glyphosate screening, and the transformation efficiency of the two different screening systems will be compared using Agrobacterium-mediated transformation of oil palm embryonic callus under the same conditions.

[0070] Example 3 Agrobacterium transformation and identification

[0071] Take the competent cells of Agrobacterium EHA105 stored at -80°C and add 1 μl of the correctly sequenced pCGlyDESCLI-C and pCHnDESCLⅠ-C plasmids obtained in Example 2, and transform them by electroporation at 1.8KV. Spread them on YEP culture plates containing kanamycin, rifampicin and streptomycin, and culture them at 28°C for about 48 hours. Pick a single colony and shake it overnight. Use specific primers (mSCLI-F1 and mSCLI-R1) to verify the bacterial solution by PCR. A target fragment of about 400-500 bp can be amplified. Select positive clones (engineered Agrobacterium), shake it for 36-48 hours, and save the bacterial solution for infection.

[0072] Primer sequences:

[0073] mSCLI-F1:ATTCCGCTGATTTCAAGACAACT(SEQ ID NO.2);

[0074] mSCLI-R1:TCCATAGTCCATACCATAGCACA (SEQ ID NO. 3).

[0075] Example 4 TIPS-EiEPSPS / glyphosate genetic transformation system - screening (1)

[0076] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was transformed by Agrobacterium-mediated method, and the Agrobacterium bacterial solution concentration OD of the most suitable for oil palm genetic transformation was screened and used during the transformation process. 600 =0.5-0.6, immersion time 30min-1h, co-cultivation time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, transform oil palm embryonic callus, after co-cultivation for 3d, sterilize and wash, transfer to glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 1.5mM), 27±1℃ in the dark, screening and culture for 80-110d.

[0077] Example 5 TIPS-EiEPSPS / glyphosate genetic transformation system - screening (2)

[0078] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was transformed by Agrobacterium-mediated method, and the Agrobacterium bacterial solution concentration OD of the most suitable for oil palm genetic transformation was screened and used during the transformation process. 600=0.5-0.6, immersion time 30min-1h, co-cultivation time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, transform oil palm embryonic callus, after co-cultivation for 3d, sterilize and wash, transfer to glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 2mM), 27±1℃ in the dark, screening and culture for 80-110d.

[0079] Example 6 TIPS-EiEPSPS / glyphosate genetic transformation system - screening (3)

[0080] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was transformed by Agrobacterium-mediated method, and the Agrobacterium bacterial solution concentration OD of the most suitable for oil palm genetic transformation was screened and used during the transformation process. 600 =0.5-0.6, immersion time 30min-1h, co-cultivation time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, transform oil palm embryonic callus, after co-cultivation for 3d, sterilize and wash, transfer to glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 2.5mM), 27±1℃ in the dark, screening and culture for 80-110d.

[0081] Example 7 TIPS-EiEPSPS / glyphosate genetic transformation system - screening (4)

[0082] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was transformed by Agrobacterium-mediated method, and the Agrobacterium bacterial solution concentration OD of the most suitable for oil palm genetic transformation was screened and used during the transformation process. 600 =0.5-0.6, immersion time 30min-1h, co-cultivation time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, transform oil palm embryonic callus, after co-cultivation for 3d, sterilize and wash, transfer to glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 3mM), 27±1℃ in the dark, screening and culture for 80-110d.

[0083] Example 8 TIPS-EiEPSPS / glyphosate genetic transformation system - screening (5)

[0084] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was transformed by Agrobacterium-mediated method, and the Agrobacterium bacterial solution concentration OD of the most suitable for oil palm genetic transformation was screened and used during the transformation process. 600=0.5-0.6, immersion time 30min-1h, co-cultivation time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, transform oil palm embryonic callus, after co-cultivation for 3d, sterilize and wash, transfer to glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 4mM), 27±1℃ in the dark, screening and culture for 80-110d.

[0085] Example 9 TIPS-EiEPSPS / glyphosate genetic transformation system - screening (6)

[0086] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was transformed by Agrobacterium-mediated method, and the Agrobacterium bacterial solution concentration OD of the most suitable for oil palm genetic transformation was screened and used during the transformation process. 600 =0.5-0.6, immersion time 30min-1h, co-cultivation time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, transform oil palm embryonic callus, after co-cultivation for 3d, sterilize and wash, transfer to glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 5mM), 27±1℃ in the dark, screening and culture for 80-110d.

[0087] Example 10 TIPS-EiEPSPS / glyphosate genetic transformation system - screening statistics

[0088] By comparing the positive rates of screening with different concentrations of glyphosate in Examples 4-9 (see Table 2), it was found that adding 3-5 mM glyphosate to the screening medium could obtain resistant callus ( Figure 2 e,f), adding low concentrations of glyphosate to the screening medium will reduce the positive callus rate or even make the positive rate zero. Therefore, it is preferred to add 3mM glyphosate to the screening medium to obtain a good screening efficiency ( Figure 4 ).

[0089] Table 2 Statistics of screening results of different concentrations of glyphosate

[0090]

[0091] Example 11 hpt-hygromycin screening system - screening

[0092] Taking oil palm as an example, the same transformation method as above was used to transform the engineered Agrobacterium pCHnDESCLI-C obtained in Example 3 using Agrobacterium-mediated transformation. During the transformation process, the Agrobacterium solution concentration OD of the most suitable for oil palm genetic transformation was selected. 600=0.5-0.6, immersion time 30min-1h, co-culture time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin, oil palm embryonic callus was transformed. After co-culture for 3d, the cells were sterilized and washed, and then transferred to the hygromycin-containing resistance selection medium EgcSM (MS0+500mg / L timentin+60mg / L hygromycin). After selection and culture at 27±1℃ in the dark for 80-120d, resistant callus ( Figure 2 , g, h), according to statistics, the suspected resistance callus rate was 3.21% ± 0.74% ( Figure 4 ).

[0093] Example 12 Molecular Biological Identification of Transgenic Resistant Callus

[0094] In order to identify whether the obtained resistant callus is a transgenic callus, this example performed fluorescence, PCR and Southern Blot detection on some positive transgenic callus tissues obtained through screening and culture.

[0095] 1. Red fluorescence identification

[0096] Before using molecular detection methods to detect whether resistant calli are transgenic, we considered using red fluorescence visualization to preliminarily select resistant calli, which can reduce workload and improve work efficiency. In this study, the pCGlyDESCLⅠ-C expression vector containing the red fluorescence gene was constructed and transferred into the embryonic callus of oil palm through Agrobacterium-mediated transfer. After screening 2 to 3 times using the new glyphosate screening system, the glyphosate-resistant calli were irradiated with green light (excitation wavelength of 569nm) in the Leica microscope MZ10F and observed in bright field and fluorescence field respectively. Under the excitation of green light, scattered red dots appeared on the surface of the resistant callus or the entire surface appeared bright red (emission wavelength of 593nm) (such as Figure 3 , e), but the wild-type callus did not produce red fluorescence (e.g. Figure 3 , b). The hygromycin-resistant callus was observed in the bright field and fluorescent field using the same method. Under the excitation of green light, the surface of the newly grown resistant callus showed a faint red fluorescence (such as Figure 3 , h). Although the red fluorescence brightness of each callus is not necessarily the same, preliminary observations have confirmed that the transgene has been integrated into the oil palm callus genome. The intensity of red fluorescence is related to the location of the red fluorescence gene inserted into the callus genome, the copy number and the expression. Combining the data of the fluorescent callus from three transformations, it was statistically found that the red fluorescence rate of the oil palm transgenic callus was 16.00% ± 4.29%; while the red fluorescence rate of the oil palm transgenic callus obtained by hygromycin screening was 2.30% ± 0.33%, and there was a significant difference between the two ( Figure 4 ).

[0097] 2. PCR testing

[0098] Using PCR analysis, the predicted transformed pCGlyDESCLⅠ-C vector resistant callus was preliminarily screened at the molecular level. Genomic DNA was extracted from the resistant callus that survived on the screening medium containing glyphosate, and the presence of the EgmSCLⅠ gene was verified using the mSCLI-F1 / R1 primers. The amplified fragment was 400 to 500 bp long. The results are as follows Figure 3 As shown ( Figure 3 ,j), of the 22 randomly selected samples, 21 samples had correct and obvious primer amplification bands, which were judged as true positive; 1 sample did not amplify the target band and was judged as negative; combined with the PCR test results of three batches of glyphosate-resistant calli, the PCR positive ratio was preliminarily determined to be 90.58%±6.33%. The mSCLI-F1 / R1 primers were also used for PCR testing of hygromycin-resistant calli, and 15 of the 18 samples amplified the correct band ( Figure 3 , k), combined with the PCR test results of three batches of hygromycin-resistant callus, the PCR positive ratio was preliminarily determined to be 83.02%±2.87%. Statistical analysis showed no significant difference between the two ( Figure 4 ).

[0099] 3. Southern Blot Detection

[0100] To further verify whether the exogenous gene was integrated into the oil palm genome, Southern blot analysis was performed using a 556 bp probe amplified from the EgmSCLⅠ gene. Five glyphosate-resistant and PCR-positive callus samples were selected based on sufficient sample weight. The genomic DNA was digested with restriction endonucleases EcoR I or Avr II. The results showed that all three samples produced clear hybridization bands of different sizes, indicating that there were different integration sites within the oil palm genome ( Figure 5 , lanes 1E-3A). The other two samples did not amplify bands, indicating false positive PCR results ( Figure 5 , lanes 4E-5A). Among the three positive samples, sample 1 showed a significant difference in EcoRI ( Figure 5 , Lane 1E) 1 hybridization band appeared when digested with Avr II ( Figure 5 , lane 1A) showed two hybridization bands when digested with EcoR I or Avr II, indicating that two copies may have been integrated into the genome. The other two positive samples showed only one hybridization band ( Figure 5, lanes 2E-2A), indicating that a single copy was integrated into the genome of samples 2 and 3. Overall, the Southern blot results confirmed the successful creation of positive transgenic oil palm calli using the EPSPS / glyphosate selection system, showing considerable selection efficiency.

[0101] The above results indicate that the efficient genetic transformation method for oil palm provided by the present invention can enable oil palm to obtain glyphosate-resistant callus.

[0102] The above results show that the present invention has successfully established a new genetic transformation screening system based on EPSPS / glyphosate screening markers and applied it to oil palm genetic transformation for the first time.

[0103] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for efficient genetic transformation of oil palm embryonic callus mediated by Agrobacterium, characterized in that: The following steps are involved: (1) Subculture of callus tissue: Select light yellow, granular, dry and vigorous callus tissue and place it in subculture proliferation medium for multiplication by subculture; The composition of the secondary proliferation medium is MS0, which is: MS medium supplemented with glutamine, vitamin B1, ascorbic acid, sucrose, coconut water, agar and activated carbon; (2) Callus pre-culture Select light yellow, granular, dry, and vigorous callus tissue, cut it into 8-12 mm small pieces, transfer it into pre-culture medium, and pre-culture it in the dark for 3-4 days; The composition of the pre-culture medium is: MS0 + 100 μM to 300 μM acetosyringone + 50 to 200 mg / L cysteine; (3) Preparation of Agrobacterium infection solution The Agrobacterium containing the recombinant plasmid of the screening expression cassette of the EPSPS mutant gene was streaked and plated, and incubated for propagation; the propagated Agrobacterium was scraped into the MS0 liquid medium containing 100 μM to 300 μM acetosyringone, the bacteria were suspended, and the solution was shaken for 20 min to 1 h. The density of the bacterial solution was OD 600 The value is adjusted to 0.5-0.7 for dip dyeing; The composition of MS0 liquid medium is: MS medium supplemented with glutamine, vitamin B1, ascorbic acid, sucrose, and coconut water; (4) Dyeing Wild-type embryonic callus with good growth status was placed in Agrobacterium infection solution and infected for 30min to 1h; (5) Co-culture The infected embryonic callus was transferred to the co-culture medium and co-cultured in an incubator at 19°C-22°C; (6) Degerming and cleaning After co-cultivation, wash with sterile water until the sterile water is clear; prepare a solution containing antibacterial antibiotics, transfer the embryonic callus into the solution, and place it on a shaker for shaking; after pouring out the liquid, spread the callus on sterile filter paper, blow it on the workbench for 2-3 hours, and turn it over to dry; (7) Screening of resistant callus Prepare an oil palm embryonic callus screening medium containing a screening agent, transfer the sterilized, cleaned and dried embryonic callus tissue to the screening medium, and place 9-15 calli per dish; regularly replace the new screening medium, and perform screening and culturing 4-5 times to obtain resistant calli; The screening agent is glyphosate.

2. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The composition of the subculture proliferation medium is MS0, which is: MS medium supplemented with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 6 g / L agar and 0.5 g / L activated carbon.

3. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The composition of MS0 liquid culture medium is as follows: 0.05 g / L ascorbic acid, 30 g / L sucrose, and 100 ml / L coconut water are added to MS culture medium.

4. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The Agrobacterium described in step (3) is Agrobacterium tumefaciens EHA105 or LBA4404 or GV3101.

5. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: Step (4) is: placing the wild-type embryonic callus tissue in good growth condition in an Agrobacterium infection solution for infection for 30 minutes to 1 hour, shaking the bacterial solution once every 10 minutes, and then pouring out the bacterial solution; blotting with sterile filter paper, and blowing under a clean bench for 30 to 60 minutes until there is no obvious liquid on the tissue surface.

6. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The nucleotide sequence of the EPSPS mutant gene expression cassette is as shown in SEQ ID NO.

1.

7. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The co-culture medium described in step (5) has the same components as the pre-culture medium described in step (2).

8. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The solution of the antibacterial antibiotic is a 500 mg / L ceftriaxone sodium solution or a 500 mg / L timentin solution.

9. The Agrobacterium-mediated oil palm genetic transformation method according to claim 1, characterized in that: The screening culture medium described in step (7) is: MS0+500 mg / L antibacterial antibiotic solution+3-5 mM glyphosate.

Images