An agrobacterium-mediated genetic transformation method of oil palm

By using Agrobacterium-mediated genetic transformation, glyphosate selection markers, and acetylsyringone staining, the stability and efficiency of oil palm genetic transformation were improved. This solved the problem of low transformation efficiency in existing oil palm technologies, reduced the risk of introducing exogenous genes, and enhanced the safety of transgenic plants.

CN119662723BActive Publication Date: 2025-11-28HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411725550.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-28
Publication Date
2025-11-28
Estimated Expiration
2044-11-28

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively address the low genetic transformation efficiency of oil palm, particularly in obtaining efficient and stable genetic transformation methods. Previous studies have shown that particle bombardment and PEG-mediated protoplast transformation methods have low efficiency and poor stability.

Method used

Agrobacterium-mediated genetic transformation was employed, using glyphosate selection markers and acetylsuccinone staining, combined with specific Agrobacterium concentrations, staining times, and co-culture times, to obtain resistant callus tissue.

Benefits of technology

It improves the stability and efficiency of genetic transformation in oil palm, reduces the risk of introducing exogenous genes, enhances the safety of transgenic plants, and is suitable for commercial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662723B_ABST
    Figure CN119662723B_ABST
Patent Text Reader

Abstract

The application provides a method for Agrobacterium-mediated genetic transformation of oil palm, and the method uses embryogenic callus of oil palm as explants, adopts Agrobacterium-mediated mode, and selects the most suitable Agrobacterium liquid concentration, immersion time, co-culture time, acetosyringone concentration and antibiotic concentration in the transformation process. An expression cassette containing an EPSPS mutant gene is used as a screening marker, and glyphosate is used as a screening agent to select glyphosate-resistant callus. The screening efficiency of the application is higher than that of the traditional hpt / hygromycin screening system. Meanwhile, the effectiveness of the EPSPS / glyphosate screening system in the genetic transformation of oil palm is proved, which marks the first application of the system in the genetic transformation of oil palm and provides a valuable tool for promoting the research of the important economic crop.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, and provides a method for Agrobacterium-mediated genetic transformation of oil palm embryogenic callus. BACKGROUND

[0002] Oil palm (Elaeis guineensis Jacq.) is one of the four major woody edible oil plants in the world (the other three include coconut, tea and olive), is one of the woody oil crops in the tropics, is one of the most important economic crops in the tropics, and is currently the most efficient oil-producing plant in the world. Globally, only 5% of the sown area produces palm oil, which accounts for 33% of all plant oils and 45% of edible oils. In 2023, in terms of global plant oil production, palm oil production was 79.26 million tons, accounting for 36% (palm kernel oil accounted for 4%), and still occupying the first position in the world. The total proportion of soybean oil and rapeseed oil is 79%.

[0003] Genetic transformation technology is considered an extension of oil palm breeding technology. Traditional breeding not only has a long generation cycle (10-15 years per generation), but also is limited by species incompatibility; genetic transformation breaks the limitations of traditional breeding improvement, broadens the gene source, accelerates breeding, can produce high-value traits that cannot be obtained through traditional breeding, and can improve competitiveness and ensure the sustainability of the industry. It is also one of the necessary means for oil palm gene function research. The research institutions of oil palm genetic transformation technology are mainly concentrated in Malaysia, Indonesia, Thailand and Latin America, but only the Malaysian Palm Oil Board (MPOB) has published the results and new technologies obtained through the exploration of oil palm genetic transformation technology. The research progress of oil palm genetic transformation is relatively late, and it started in MPOB in the late 1980s, and made significant progress and breakthroughs in the 1990s. Subsequently, a series of studies were conducted on factors that can improve the transformation efficiency of oil palm, such as explants and genetic transformation methods, and some progress was made, but the progress was slow. At present, oil palm transformation still faces a major problem, which is how to obtain a stable and efficient genetic transformation method. The stable transformation efficiency obtained by previous particle bombardment (gene gun method) is 1%-1.5%, and the stable transformation efficiency obtained by Agrobacterium-mediated transformation is 0.7%-1%. The transient transfection rate of PEG-mediated protoplast transformation is 4.22%, and the transient transfection rate of new DNA microinjection of oil palm protoplast is 14%. Stable genetic and transient transformation have been used for oil palm transformation, but compared with other crops such as rice, corn and soybean, the stable transformation efficiency is still low, and it is urgent to further explore how to improve the transformation efficiency or screening efficiency of oil palm. So far, there has been no report on oil palm genetic transformation in China. SUMMARY

[0004] In view of the deficiencies of the prior art, the purpose of the present application is to provide an oil palm embryogenic callus transformation method using oil palm embryogenic callus as a transformation receptor, mediated by Agrobacterium, and using a new type of glyphosate screening to transform exogenous genes and successfully obtain resistant callus.

[0005] In order to achieve the above purpose, the present application is as follows:

[0006] An Agrobacterium-mediated high-efficiency genetic transformation method of oil palm embryogenic callus comprises the following steps:

[0007] (1) Callus subculture:

[0008] Select light yellow, granular, dry, and strong callus and place it in a subculture medium for expansion, and subculture for expansion;

[0009] The composition of the subculture medium is MS0, and MS0 is: MS medium added with glutamine, vitamin B1, ascorbic acid, sucrose, coconut water, agar, and activated carbon;

[0010] (2) Callus pre-culture

[0011] Select light yellow, granular, dry, and strong callus, cut it into small pieces of 8-12 mm, and transfer it into a pre-culture medium for pre-culture in the dark for 3-4 days;

[0012] The composition of the pre-culture medium is: MS0+100-300 μM acetosyringone (preferably 200 μM)+50-200 mg / L cysteine;

[0013] (3) Preparation of Agrobacterium infection solution

[0014] Agrobacterium containing a recombinant plasmid of a selection expression cassette containing an EPSPS mutant gene is streaked and plated, and incubated for expansion; the expanded Agrobacterium is scraped into MS0 liquid medium containing 100-300 μM (preferably 200 μM) acetosyringone, the bacterial cells are suspended, and shaken for 20 min-1 h; the density OD 600 of the bacterial cell solution is adjusted to 0.5-0.7 (preferably 0.5-0.6) for immersion;

[0015] The composition of the MS0 liquid medium is: MS medium added with glutamine, vitamin B1, ascorbic acid, sucrose, and coconut water;

[0016] (4) Immersion

[0017] Place the wild-type embryogenic callus in a good growth state in the Agrobacterium infection solution for 30 min-1 h of infection;

[0018] (5) co-cultivation

[0019] The embryogenic calli after maceration are moved to co-cultivation medium and co-cultivated in an incubator at 19-22°C.

[0020] (6) decontamination

[0021] After co-cultivation, the embryogenic calli are washed with sterile water until the sterile water is clear; a solution containing bacteriostatic antibiotic is prepared and the embryogenic calli are moved to the solution and shaken in a shaker; after the liquid is poured out, the calli are laid on sterile filter paper and blown for 2-3h in a clean bench and dried by turning and airing;

[0022] (7) selection of resistant calli

[0023] An oil palm embryogenic callus selection medium containing a selection agent (glyphosate) is prepared and the decontaminated and dried embryogenic calli are moved to the selection medium, 9-15 calli per dish; new selection medium is changed regularly and the calli are selected for 4-5 times to obtain resistant calli.

[0024] Preferably, the composition of the subculture proliferation medium is MS0, which is MS medium added with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 6 g / L agar and 0.5 g / L activated carbon.

[0025] Preferably, the composition of the liquid subculture medium is MS medium added with 0.05 g / L ascorbic acid, 30 g / L sucrose and 100 ml / L coconut water.

[0026] Preferably, the Agrobacterium in step (3) is Agrobacterium tumefaciens EHA105 or LBA4404 or GV3101.

[0027] Preferably, step (4) is: the wild-type embryogenic calli in good growth state are infected in the Agrobacterium infection solution for 30 min-1h, and then the bacterial solution is poured out; the calli are dried with sterile filter paper and blown for 30-60 min under a clean bench until there is no obvious liquid on the surface of the calli.

[0028] Preferably, the nucleotide sequence of the EPSPS mutant gene expression cassette is as shown in SEQ ID NO. 1.

[0029] Preferably, the co-cultivation medium in step (5) has the same composition as the pre-cultivation medium in step (2).

[0030] Preferably, the solution of bacteriostatic antibiotic is a 500 mg / L cefotaxime sodium solution or a 500 mg / L trimethoprim solution.

[0031] Preferably, the screening medium of step (7) is MS0+500mg / L bacteriostatic antibiotic solution+1.5-5mM glyphosate.

[0032] Compared with the prior art, the present application has the following advantages:

[0033] The present application provides a method for obtaining glyphosate-resistant callus by using oil palm embryogenic callus as the recipient material, using Agrobacterium-mediated transformation, and screening the concentration of Agrobacterium solution, the immersion time, the co-culture time, the concentration of acetosyringone, and the concentration of antibiotics during the transformation process. The present application is the first time to apply glyphosate selection to the genetic transformation of oil palm, and the selection efficiency is higher than that of the existing hygromycin selection. The EPSPS mutant gene provided by the present application can be efficiently expressed in oil palm, and can confer high glyphosate resistance to oil palm callus. The present application also provides a plant transgenic screening expression cassette using the EPSPS mutant gene as a screening marker and a corresponding genetic transformation screening method. The plant genetic transformation screening vector of the present application is additionally provided with a red fluorescent gene as a reporter gene for the genetic transformation of oil palm. The screening marker of the present application is a plant-derived gene, which does not introduce bacterial-derived or other foreign screening marker genes during the transgenic process. The present application not only enriches the plant transgenic screening methods, but also effectively reduces the potential safety risks of transgenic plants caused by bacterial-derived or other foreign genes and the public's concerns about the safety of transgenic plants, which is conducive to the commercialization of transgenic oil palm, and has good market value and social benefits. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 The present application provides a method for obtaining glyphosate-resistant callus by using oil palm embryogenic callus as the recipient material, using Agrobacterium-mediated transformation, and screening the concentration of Agrobacterium solution, the immersion time, the co-culture time, the concentration of acetosyringone, and the concentration of antibiotics during the transformation process. The present application is the first time to apply glyphosate selection to the genetic transformation of oil palm, and the selection efficiency is higher than that of the existing hygromycin selection. The EPSPS mutant gene provided by the present application can be efficiently expressed in oil palm, and can confer high glyphosate resistance to oil palm callus. The present application also provides a plant transgenic screening expression cassette using the EPSPS mutant gene as a screening marker and a corresponding genetic transformation screening method. The plant genetic transformation screening vector of the present application is additionally provided with a red fluorescent gene as a reporter gene for the genetic transformation of oil palm. The screening marker of the present application is a plant-derived gene, which does not introduce bacterial-derived or other foreign screening marker genes during the transgenic process. The present application not only enriches the plant transgenic screening methods, but also effectively reduces the potential safety risks of transgenic plants caused by bacterial-derived or other foreign genes and the public's concerns about the safety of transgenic plants, which is conducive to the commercialization of transgenic oil palm, and has good market value and social benefits.

[0035] Figure 2Bacterial-mediated transformation of Elaeis guineensis based on pCGlyDESCL-C and pCHnDESCL I-C vectors in Example 2, Example 10 and Example 11 of the present application. a~b: T-DNA of pCGlyDESCL I-C and pCHnDESCL I-C vectors, respectively (Gly represents glyphosate; Hn represents hygromycin; EPSPS expression cassette: glyphosate selection expression cassette; 35S Pro represents CaMV 35S constitutive promoter; Ltp2 pro represents seed-specific promoter; mSCL I represents mScarlet-I; AtHSP-Ter represents Arabidopsis thaliana heat shock protein terminator; Hpt expression cassette represents hygromycin selection expression cassette; com25 expression cassette represents a fatty acid functional gene expression cassette); c: wild-type ECs; d: macerated; e: wild-type ECs were selected on selection medium containing 3 mM glyphosate for about 15 weeks; f: positive calli were obtained after about 15 weeks of positive calli on selection medium containing 3 mM glyphosate; g: wild-type ECs were selected on selection medium containing 60 mg / L hygromycin for about 15 weeks; h: positive calli were obtained after about 15 weeks of infection on selection medium containing 60 mg / L hygromycin. White arrows represent suspected resistant calli in f and h.

[0036] Figure 3 Visualization of RFP and PCR detection results of glyphosate or hygromycin resistant calli in Example 12 of the present application. a~c, d~f and g~i: visualization of bright field, RFP and merged on wild-type ECs, glyphosate resistant ECs and hygromycin resistant ECs, respectively; j and k: PCR detection results of glyphosate resistant calli and hygromycin resistant calli (WT: wild-type ECs; p: vector pCGlyDESCL I-C or pCHnDESCL I-C plasmid as positive control, respectively; lanes 1-22: independent samples of glyphosate resistant calli; lanes 1-18: independent samples of hygromycin resistant calli).

[0037] Figure 4 Efficiency comparison of two Agrobacterium-mediated selection systems of Elaeis guineensis in Example 10, 11 and 12 of the present application. SRCe: suspected resistant callus efficiency; RFPe: red fluorescent protein efficiency; PCR by PRCe: positive callus efficiency of PCR detection of resistant calli.

[0038] Figure 5Figure 12: Southern Blot analysis of transgenic positive and glyphosate resistant calli using EgmSCL I gene as probe in Example 12 of the present application. WT: genomic DNA of wild type EC; P: pCGlyDESCL I-C vector plasmid as positive control, digested with EcoR I, arrow indicates the band; 1-5: 5 PCR positive ECs samples; E and A: genomic DNA of ECs samples digested with EcoR I or Avr II respectively. DETAILED DESCRIPTION

[0039] The Agrobacterium-mediated high-efficiency genetic transformation method of Elaeis guineensis embryogenic calli comprises the following steps:

[0040] (1) Callus subculture:

[0041] The light yellow, granular, dry and strong calli are selected and placed in subculture medium EgcSPM for expansion, and the expansion is carried out by subculture once a month; the calli are cultured at (27±1) °C under the condition of light intensity of 3000 lx and light time of 12 h / d;

[0042] The composition of the subculture medium is MS0, and the MS0 is: 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 6 g / L agar and 0.5 g / L activated carbon are added in the MS medium.

[0043] (2) Callus pre-culture

[0044] The light yellow, granular, dry and strong calli are selected, cut into small pieces of 8-12 mm and transferred into pre-culture medium EgcPCM, and pre-cultured at 28 °C in the dark for 3-4 d;

[0045] The composition of the pre-culture medium is: MS0+100 μM-300 μM acetosyringone+50-200 mg / L cysteine;

[0046] (3) Preparation of Agrobacterium infection solution

[0047] The Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 or LBA4404 or GV3101 containing the recombinant plasmid of the screening expression cassette of the EPSPS mutant gene is streaked and plated, and incubated at 28 °C for expansion; the expanded Agrobacterium is scraped into MS0 liquid medium containing 100 μM-300 μM concentration range of acetosyringone, the bacterial body is suspended, and shaken for 20 min-1 h; the density OD 600 value of the bacterial solution is adjusted to 0.5-0.7, and used for immersion staining;

[0048] The MS0 liquid culture medium is composed of 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water added in MS culture medium.

[0049] The nucleotide sequence of the expression cassette is shown in SEQ ID NO. 1.

[0050] (4) Immersion and infection

[0051] The wild-type embryogenic callus in good growth state is placed in an Agrobacterium infection solution for 30 min to 1 h, and the bacterial solution is shaken once every 10 min, and then the bacterial solution is poured clean; the callus is dried with sterile filter paper, and is blown for 30-60 min under the clean bench until the surface of the callus is free of obvious liquid (room temperature, dark);

[0052] (5) Co-culture

[0053] The embryogenic callus after immersion and infection is moved to the co-culture medium EgPCM (with the same components as the pre-culture medium), and is co-cultured for 72 h in a culture box at 19-22 ℃ (dark);

[0054] (6) Decontamination and washing

[0055] After co-culture, the embryogenic callus is washed with sterile water until the sterile water is clear; a solution containing bacteriostatic antibiotics is prepared, and the embryogenic callus is moved to the solution and placed on a shaking table for 30 min at 140 rpm; after the liquid is poured clean, the callus is laid on sterile filter paper, and is blown for 2-3 h in the clean bench until it is dried;

[0056] (7) Screening of resistant callus

[0057] An oil palm embryogenic callus screening medium EgcSM (MS0+500 mg / L bacteriostatic antibiotic solution+3-5 mM glyphosate) containing a screening agent (glyphosate) is prepared, and the decontaminated and washed embryogenic callus is transferred to the screening medium, and 9-15 calli are placed in each dish; the screening medium is replaced every three weeks, and the resistant callus is obtained after 4-5 times of screening culture.

[0058] The bacteriostatic antibiotic solution is a 500 mg / L cefotaxime sodium solution or a 500 mg / L timentin solution.

[0059] (8) Molecular biological method identification of transgenic callus

[0060] The obtained resistant callus is detected by fluorescence, PCR and southern blot hybridization and other molecular biological methods.

[0061] In order to better understand the technical content of the present application, the following specific examples are provided to further illustrate the present application.

[0062] The experimental methods used in the embodiments of the present application are all conventional methods unless otherwise specified.

[0063] The materials, reagents, etc. used in the embodiments of the present application can be obtained from commercial channels unless otherwise specified.

[0064] Example 1: Test of minimum inhibitory concentration of glyphosate on oil palm callus

[0065] Wild-type embryogenic calli (ECs) of oil palm were proliferated and placed on selection medium containing different concentrations of glyphosate and hygromycin (Table 1). The growth of the ECs after 13 weeks of selection culture was observed as shown in Figure 1 The critical concentration test of wild-type oil palm callus to multiple gradients of glyphosate showed that the calli grew fast and new calli emerged at a rate of 95.56% ± 3.85% when the selection medium did not contain glyphosate; when 1 mM of glyphosate was added to the selection medium, the calli were inhibited and began to brown, but some calli grew new calli at a rate of 33.33% ± 4.44%; when 3 mM or 5 mM of glyphosate was added to the selection medium, most of the calli were significantly inhibited, although some calli grew, their color began to change and brown, and all the calli died after 16 weeks of selection culture, with a new callus rate of 0; glyphosate at a concentration higher than 5 mM significantly inhibited the growth of calli, and the browning was more severe than at lower concentrations, and all the calli died after 15 weeks of selection culture, with a new callus rate of 0. Compared with hygromycin, the browning of calli caused by glyphosate was slower and less, but the calli were inhibited in volume increase, and eventually lost growth activity and died. Based on the results of three repetitions, 3 mM can be selected as the minimum inhibitory concentration of glyphosate for genetic transformation of oil palm embryogenic callus. The present application selects EPSPS / glyphosate as a new selection system for genetic transformation of oil palm, and the hpt / hygromycin selection system will be used as a control for comparison of subsequent oil palm transformation.

[0066] Table 1: Test of minimum inhibitory concentration of glyphosate and hygromycin on non-transgenic callus

[0067]

[0068] Example 2: Construction of selection vector for genetic transformation of oil palm

[0069] Based on pCAMBIA1300 vector, the expression cassette of EPSPS mutant gene (SEQ ID NO. 1) optimized by codon of Elaeis guineensis Jacq. host, the variant mScarlet-I (abbreviation mSCL I) of red fluorescent protein gene mRed7 (Bindels D S, Haarbosch L, Van Weeren L, et al. mScarlet: a bright monomeric red fluorescent protein for cellular imaging. [J]. Nature Methods, 2017. DOI: 10.1038 / nmeth.4074.) and a fatty acid functional gene com25 (Whittle E, Shanklin J. Engineering delta 9-16:0-acyl carrier protein (ACP) desaturase specificity based on combinatorial saturation mutagenesis and logical redesign of the castor delta 9-18:0-ACP desaturase. [J]. Journal of Biological Chemistry, 2001, 276(24): 21500-21505. DOI: 10.1074 / jbc.M102129200.) were added to construct the expression vector named pCGlyDESCLI-C Figure 2 , a), wherein Gly represents glyphosate screening. The pCHnDESCLI-C vector is different from the pCGlyDESCLI-C vector only in the selection marker gene Figure 2 , b), this vector will be used as a new glyphosate screening control, and the transformation efficiency of two different screening systems will be compared under the same conditions by using Agrobacterium-mediated transformation of oil palm embryonic callus.

[0070] Example 3 Agrobacterium transformation and identification

[0071] The Agrobacterium EHA105 competent cells stored at -80°C were added with 1 μl of the sequencing correct pCGlyDESCLI-C and pCHnDESCLl-C plasmids obtained in Example 2, and were transformed by 1.8KV electric shock. They were coated on YEP culture plates containing kanamycin, rifampicin and streptomycin, and were cultured at 28°C for about 48h. Single colonies were picked and shaken overnight, and were verified by bacterial liquid PCR using specific primers (mSCLI-F1 and mSCLI-R1) to amplify about 400-500bp target fragments. Positive clones (engineered Agrobacterium) were selected and shaken for 36-48h, and the bacterial liquid was stored for infection.

[0072] Primer sequences:

[0073] mSCLI-F1: ATCTCGCTGATTTCAAGACAACT (SEQ ID NO. 2);

[0074] mSCLI-R1: TCCATAGTCCATACCATAGCACA (SEQ ID NO. 3).

[0075] Example 4 TIPS-EiEPSPS / Glyphosate genetic transformation system - screening (1)

[0076] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was used in Agrobacterium-mediated transformation, and the Agrobacterium bacterial liquid concentration OD 600 = 0.5-0.6, immersion time 30min-1h, co-culture time 72d, acetosyringone concentration 200μM and antibiotic concentration 500mg / L timentin were screened to be most suitable for genetic transformation of oil palm. The transformed oil palm embryogenic callus was co-cultured for 3d, then was washed and transferred to a glyphosate-containing resistance screening medium EgcSM (MS0+500mg / L timentin+glyphosate 1.5mM), and was screened at 27±1°C in the dark for 80-110d.

[0077] Example 5 TIPS-EiEPSPS / Glyphosate genetic transformation system - screening (2)

[0078] Taking oil palm as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was used in Agrobacterium-mediated transformation, and the Agrobacterium bacterial liquid concentration OD 600= 0.5-0.6, infection time 30 min-1 h, co-cultivation time 72 d, acetosyringone concentration 200 μΜ, and antibiotic concentration 500 mg / L spectinomycin, transformed Elaeis guineensis embryogenic calli, after 3 d of co-cultivation, after sterilization and washing, transferred to resistance screening medium EgcSM (MS0+ 500 mg / L spectinomycin + glyphosate 2.5 mM) containing glyphosate, 27±1°C, dark, screening culture 80-110 d.

[0079] Example 6 TIPS-Ei EPSPS / Glyphosate genetic transformation system - screening (3)

[0080] Taking Elaeis guineensis as an example, the engineering Agrobacterium pCGlyDESCLI-C obtained in Example 3 was used in the Agrobacterium-mediated mode, and the most suitable Agrobacterium liquid concentration OD 600 = 0.5-0.6, infection time 30 min-1 h, co-cultivation time 72 d, acetosyringone concentration 200 μΜ, and antibiotic concentration 500 mg / L spectinomycin, transformed Elaeis guineensis embryogenic calli, after 3 d of co-cultivation, after sterilization and washing, transferred to resistance screening medium EgcSM (MS0+ 500 mg / L spectinomycin + glyphosate 2.5 mM) containing glyphosate, 27±1°C, dark, screening culture 80-110 d.

[0081] Example 7 TIPS-Ei EPSPS / Glyphosate genetic transformation system - screening (4)

[0082] Taking Elaeis guineensis as an example, the engineering Agrobacterium pCGlyDESCLI-C obtained in Example 3 was used in the Agrobacterium-mediated mode, and the most suitable Agrobacterium liquid concentration OD 600 = 0.5-0.6, infection time 30 min-1 h, co-cultivation time 72 d, acetosyringone concentration 200 μΜ, and antibiotic concentration 500 mg / L spectinomycin, transformed Elaeis guineensis embryogenic calli, after 3 d of co-cultivation, after sterilization and washing, transferred to resistance screening medium EgcSM (MS0+ 500 mg / L spectinomycin + glyphosate 2.5 mM) containing glyphosate, 27±1°C, dark, screening culture 80-110 d.

[0083] Example 8 TIPS-Ei EPSPS / Glyphosate genetic transformation system - screening (5)

[0084] Taking Elaeis guineensis as an example, the engineering Agrobacterium pCGlyDESCLI-C obtained in Example 3 was used in the Agrobacterium-mediated mode, and the most suitable Agrobacterium liquid concentration OD 600= 0.5-0.6, infection time 30 min-1 h, co-cultivation time 72 d, acetosyringone concentration 200 μM, and antibiotic concentration 500 mg / L spectinomycin, the transformed Elaeis guineensis embryogenic calli were transferred to the resistance screening medium EgcSM (MS0+ 500 mg / L spectinomycin + glyphosate 5 mM) containing glyphosate after 3 d of co-cultivation and after sterilization and washing, and were screened in the dark at 27±1°C for 80-110 d.

[0085] Example 9 TIPS-EiEPSPS / Glyphosate Genetic Transformation System - Screening (6)

[0086] Taking Elaeis guineensis as an example, the engineered Agrobacterium pCGlyDESCLI-C obtained in Example 3 was used in the Agrobacterium-mediated method, and the most suitable Agrobacterium liquid concentration OD 600 = 0.5-0.6, infection time 30 min-1 h, co-cultivation time 72 d, acetosyringone concentration 200 μM, and antibiotic concentration 500 mg / L spectinomycin, the transformed Elaeis guineensis embryogenic calli were transferred to the resistance screening medium EgcSM (MS0+ 500 mg / L spectinomycin + glyphosate 5 mM) containing glyphosate after 3 d of co-cultivation and after sterilization and washing, and were screened in the dark at 27±1°C for 80-110 d.

[0087] Example 10 TIPS-EiEPSPS / Glyphosate Genetic Transformation System - Screening Statistics

[0088] By comparing the positive rates obtained by using different concentrations of glyphosate for screening in Examples 4-9 (see Table 2), it was found that the addition of 3-5 mM glyphosate in the screening medium could obtain resistant calli Figure 2 e,f), and the addition of a low concentration of screening would reduce the positive callus rate or even result in a zero positive rate. Therefore, the addition of 3 mM glyphosate in the screening medium can obtain good screening efficiency Figure 4 ).

[0089] Table 2 Screening results statistics of different concentrations of glyphosate

[0090]

[0091] Example 11 hpt-Hygromycin Screening System - Screening

[0092] Taking Elaeis guineensis as an example, the engineered Agrobacterium pCHnDESCLI-C obtained in Example 3 was used in the Agrobacterium-mediated method, and the most suitable Agrobacterium liquid concentration OD 600= 0.5-0.6, 30 min-1 h of immersion time, 72 d of co-cultivation time, 200 μM of acetosyringone, and 500 mg / L of antibiotic concentration of Geneticin, the transformed Elaeis guineensis embryogenic calli were obtained. After 3 d of co-cultivation, the calli were transferred to the resistant screening medium EgcSM (MS0+ 500 mg / L Geneticin+ 60 mg / L Hygromycin) after sterilization and washing, and were screened for 80-120 d under dark conditions at 27±1°C to obtain the resistant calli Figure 2 , g, h). According to statistics, the rate of suspected resistant calli was 3.21%±0.74% Figure 4 .

[0093] Example 12 Molecular biological identification of the transgenic resistant calli

[0094] In order to identify whether the obtained resistant calli were transgenic calli, the positive transgenic calli obtained after screening were subjected to fluorescence, PCR, and Southern Blot detection in this example.

[0095] 1. Red fluorescence identification

[0096] Before using molecular detection methods to detect whether the resistant calli were transgenic, we considered using red fluorescence visualization to preliminarily select the resistant calli, which could reduce the workload and improve work efficiency. In this study, the pCGlyDESCL I-C expression vector containing the red fluorescence gene was constructed and was transferred into Elaeis guineensis embryogenic calli by Agrobacterium-mediated transformation. After 2-3 times of screening using the new glyphosate screening system, the glyphosate-resistant calli were irradiated with green excitation light (excitation wavelength of 569 nm) in the Leica microscope MZ10F, and were observed in the bright field and the fluorescence field. Under the excitation of green light, the surfaces of the resistant calli appeared scattered red dots or the entire surface presented bright red (emission wavelength of 593 nm) (as shown in Figure 3 , e), but the wild-type calli did not produce red fluorescence (as shown in Figure 3 , b). In the same way, the hygromycin-resistant calli were observed in the bright field and the fluorescence field, and the surfaces of the newly grown resistant calli presented a light red fluorescence under the excitation of green light (as shown in Figure 3 , h). Although the brightness of the red fluorescence of each callus was not necessarily consistent, it was determined through preliminary observation that the transgene had been integrated into the genome of the Elaeis guineensis callus. The strength of the red fluorescence was related to the position of the red fluorescence gene inserted into the genome of the callus, the copy number, and the expression. According to the data of the fluorescent calli of the three transformations, according to statistics, the red fluorescence rate of the Elaeis guineensis transgenic calli was 16.00%±4.29%; and the red fluorescence rate of the Elaeis guineensis transgenic calli obtained by hygromycin screening was 2.30%±0.33%, which had a significant difference Figure 4 .

[0097] 2. PCR detection

[0098] PCR analysis was used to preliminarily screen predicted pCGlyDESCLⅠ-C vector-transformed resistant calluses at the molecular level. Genomic DNA was extracted from resistant calluses that survived on glyphosate-containing screening medium, and the presence of the EgmSCLⅠ gene was verified using mSCLI-F1 / R1 primers. The amplified fragment was 400–500 bp in length, and the results are as follows. Figure 3 As shown ( Figure 3 Of the 22 randomly selected samples, 21 samples showed correct and relatively clear primer amplification bands, and were judged as true positives; 1 sample did not amplify the target band and was judged as negative. Combined with the PCR test results of three batches of glyphosate-resistant callus, the preliminary PCR positive rate was determined to be 90.58% ± 6.33%. PCR testing was also performed on hygromycin-resistant callus using mSCLI-F1 / R1 primers; 15 out of 18 samples amplified the correct bands. Figure 3 Based on the PCR test results of three batches of hygromycin-resistant callus, the preliminary PCR positive rate was determined to be 83.02% ± 2.87%. Statistical analysis showed no significant difference between the two. Figure 4 ).

[0099] 3. Southern Blot Detection

[0100] To further verify whether the exogenous gene was integrated into the oil palm genome, Southern blot analysis was performed using a 556 bp probe amplified from the EgmSCLⅠ gene. Five glyphosate-resistant and PCR-positive callus samples were selected based on sufficient sample weight. Genomic DNA was digested with restriction endonucleases EcoR I or Avr II. The results showed that all three samples produced clear hybridization bands of varying sizes, indicating the existence of different integration sites within the oil palm genome. Figure 5 Lanes 1E-3A). The other two samples did not amplify any bands, indicating false-positive PCR results. Figure 5 Lane 4E-5A). Of the 3 positive samples, sample 1 was in EcoRI ( Figure 5 A hybridization band appeared during enzyme digestion in lane 1E, and in lane Avr II ( Figure 5 The presence of two hybridization bands during digestion with EcoRI (lane 1A) indicates that two copies may have integrated into the genome. The other two positive samples showed only one hybridization band regardless of whether they were digested with EcoRI I or Avr II. Figure 5Southern blot analysis of the transgenic calli (lane 2E-2A) indicated that there was one single copy of the transgene integrated into the genome of samples 2 and 3, respectively. Overall, the Southern blot results confirmed the successful creation of positive transgenic oil palm calli using the EPSPS / glufosinate selection system, showing an appreciable selection efficiency.

[0101] The above results show that the oil palm high-efficiency genetic transformation method provided by the present application can make the oil palm obtain the glufosinate-resistant callus.

[0102] The above results show that the present application has successfully established a new genetic transformation and selection system based on the EPSPS / glufosinate selection marker, and is applied to the oil palm genetic transformation for the first time.

[0103] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method of Agrobacterium-mediated genetic transformation of oil palm embryogenic callus, characterized in that, Comprise the following steps: (1) subculture of callus: Select light yellow, granular, dry, strong vitality callus placed in subculture proliferation medium, subculture for expansion; The composition of subculture proliferation medium is: MS medium added with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 6 g / L agar and 0.5 g / L activated carbon; (2) callus pre-culture Select light yellow, granular, dry, strong vitality callus, cut into 8-12 mm small pieces into pre-culture medium, pre-culture in dark conditions for 3-4 d; The composition of pre-culture medium is: MS medium added with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 100-300 μM acetosyringone, 50-200 mg / L cysteine; (3) preparation of Agrobacterium infection solution will contain EPSPS Agrobacterium was streaked with the recombinant plasmid of the mutant gene selection expression cassette and incubated for propagation. The propagated Agrobacterium was then scraped into MSO liquid medium containing 100 μM–300 μM acetylsuccinone, the cells were suspended, and the medium was shaken for 20 min–1 h. The OD of the bacterial solution was then measured. 600 Adjust the value to 0.5~0.7 for dyeing; The composition of MS0 liquid medium is: MS medium added with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water; The content of the application is described as follows: EPSPS The nucleotide sequence of the screening expression cassette of the mutant gene is shown as SEQ ID NO. 1; The Agrobacterium is Agrobacterium tumefaciens (A. tumefaciens) Agrobacterium tumefaciens ) EHA105 or LBA4404 or GV3101; (4) immersion and infection Place the wild type embryogenic callus in good growth state in Agrobacterium infection solution for 30 min-1 h; (5) co-culture Move the infected embryogenic callus to co-culture medium, and co-culture in a culture box at 19-22 DEG C for 72 h; the co-culture medium is the same as the pre-culture medium in step (2); (6) decontamination and washing After co-culture, wash with sterile water until the sterile water is clear; prepare a solution containing bacteriostatic antibiotic, move the embryogenic callus into the solution, and shake in a shaking bed; after the liquid is poured clean, spread the callus on sterile filter paper, and blow for 2-3 h in the workbench, and dry by turning and airing; The bacteriostatic antibiotic solution is 500 mg / L cefotaxime sodium solution or 500 mg / L temid solution; (7) selection of resistant callus Prepare an oil palm embryogenic callus selection medium containing a screening agent, and transfer the decontaminated and dried embryogenic callus to the selection medium, 9-15 calli per dish; replace the new selection medium regularly, and select for 4-5 times to obtain resistant callus; The selection medium is: MS medium added with 0.05 g / L ascorbic acid, 30 g / L sucrose, 100 ml / L coconut water, 500 mg / L temid solution, 3-5 mM glyphosate.

2. The Agrobacterium-mediated genetic transformation of oil palm embryogenic callus method according to claim 1, characterized in that, Step (4) is: place the wild type embryogenic callus in good growth state in Agrobacterium infection solution for 30 min-1 h, shake the bacterial solution once every 10 min, and then pour the bacterial solution clean; use sterile filter paper to dry, and blow for 30-60 min under the clean bench until there is no obvious liquid on the surface of the tissue.

Citation Information

Patent Citations

  • Glyphosate-resistant EPSPS mutant gene, plant genetic transformation screening vector containing gene, and applications of vector

    CN111394369A

  • Genetic transformation method of agrobacterium tumefaciens-mediated sugarcane complex saccharum saccharum

    CN118147220A