Specific DNA fragment, primer set, kit, detection reagent and application for identifying the sex of Actias heterogyna Mell

Abstract

The present invention belongs to the technical field of molecular biology, and particularly relates to a specific DNA fragment, primer set, kit, detection reagent and application for identifying the gender of *Actias artemis*. The specific DNA fragment is shown as SEQ ID NO.48. The present invention designs primers for this specific fragment and screens a pair of primers highly linked to female individuals. By using these primers and through the method of PCR combined with agarose gel electrophoresis, the genders of *Actias artemis* can be accurately and quickly identified, solving the problem that the gender characteristics of *Actias artemis* larvae are not obvious and cannot be effectively distinguished.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a specific DNA fragment, a primer set, a kit, a detection reagent and an application for identifying the sex of round-end silkworm moth. Background Art

[0002] Rotunda rotundapex is an insect of the genus Rotunda, tribe Bombycini, family Bombycidae. It is named because its front and rear wings are similar and nearly round. It is the species most closely related to the domestic silkworm (Bombyxmori) and the wild silkworm (Bombyx mandarina). The color and shape of their cocoons are very similar. Miyata and Kishida (1990) first collected and described this insect and classified it into the genus Bombyx based on the wing pattern elements and the characteristics of the male external genitalia. Wang Linyao (1998) reported the first discovery of "Bombyx" in China under the title "New Records in my country - Bombyx". The article mentioned that in the process of sorting out the specimens of the Bombyx moth family, he found that the specimens from Guanxian County, Sichuan and other places were obviously different from the silk moth, and identified these specimens as Lemonia taraci, which is distributed in Sichuan, Fujian and Hubei, and drew characteristic maps of male genitalia and wing veins. Since then, the taxonomic status of the round-ended silk moth has been controversial. Some academic opinions believe that this species is an insect of the family Lemonia, and that the round-ended silk moth does not exist in China.

[0003] Until 2015, Wang et al. established the genus Rotunda, which includes the species R.rotundapex, by distinguishing the genus through round wings, narrow and forked penis heads of male genitalia, and the absence of small horns on the eighth abdominal segment of mature larvae. The detailed description is as follows: The claw-shaped process of male external genitalia is bottleneck-shaped, slightly swollen at the top, forked, and the fork end is rounded and blunt; the dorsal vein is underdeveloped; the jaw-shaped process is weakly ossified; the clasperm is slender; the cyst-shaped process is thick and short, with a rounded end; the hymen is thick and short, with a horn-like protrusion at the end. The insect body is smooth, with no obvious protrusions on each segment; the apical angle and hip angle of the front and rear wings of the adult are rounded and blunt, and there are short transverse veins near the outer edge of the wing veins that are connected to each other, forming a serrated shape.

[0004] In 2017, Cui Le re-examined Wang Linyao's named specimens and found that the morphological characteristics of these specimens did not conform to the characteristics of the family of Cyprinidae, but were consistent with the characteristics of the genus Rotunda of the family Bombycidae. He corrected the wrong identification and re-described the morphological characteristics of the misidentified specimens. At the same time, he provided photos of adults, wing veins and external genitalia, and compared and analyzed the main characteristics of the round-end silkworm moth R.rotundapex and the dandelion clam moth L.taraci, canceling the distribution record of Cyprinidae in China.

[0005] The round-ended silkworm moth has important economic and ecological values and is an important part of China's silkworm germplasm resources. Studying the round-ended silkworm moth is of great significance for researching the evolution, ecology, and physiology of insects and is one of the important species that should be protected. The morphological characteristics of the round-ended silkworm moth are similar to those of the domestic silkworm and wild silkworms, so that people have long ignored its species existence, and there are relatively few research reports on the germplasm diversity and population genetics of the round-ended silkworm moth. For the rational development and sustainable utilization of the resources of this species, it is very necessary to study the genetic diversity of its wild population.

[0006] The sex chromosomes of Lepidoptera insects are unique in the insect world. Their sex chromosomes mainly follow the ZZ / ZW system, where males are ZZ and females are ZW. In 1916, Japanese scholars first discovered the W chromosome in the domestic silkworm. However, the sequence of this chromosome has never been deciphered. The research on the domestic silkworm genome has experienced more than 20 years, completed the "Genome Project of a Thousand Silkworms" for germplasm resources, released the world's first "Super Pan-Genome Map of the Domestic Silkworm", and took the lead in creating the "Digital Domestic Silkworm" gene bank. However, the sequence of the W chromosome that plays a decisive role in gender has never been released. It wasn't until 2024 that it was deciphered, indicating the difficulty of the research. The marker of the W chromosome is not only useful for sex identification but also of great significance for the sequencing of the W chromosome. It can be used to design specific probes for the W chromosome of the round-ended silkworm moth to label this chromosome. Moreover, the homologous fragment of this segment is located on chromosome 2 in the domestic silkworm, which shows that the composition of the W chromosome is very complex and is also of important use for studying the evolution of the W chromosome.

[0007] As a newly discovered insect, the current research on the round-ended silkworm moth only includes descriptions of its morphology and rearing. There are currently only 20 genomic data of the round-ended silkworm moth in NCBI, and there is no information on nuclear genes. The sex identification of insects (agricultural pests and beneficial insects) is of great significance for the effective control of pests and the effective protection of beneficial insects. Although the round-ended silkworm moth, as a Lepidoptera insect, has differences in pupal and adult morphologies between different genders, the existing manual discrimination methods have the defects of being time-consuming, laborious, and unable to be implemented on a large scale, and the morphologies of the larvae of the round-ended silkworm moth are often similar, making it even more difficult to distinguish gender. Summary of the Invention

[0008] Based on the above technical problems, the present invention uses the differences between male and female adults to identify gender. NGS sequencing is performed on different gender individuals of the round-ended silkworm moth, and primers are designed using the fragments that only exist in the female sequencing data for PCR screening, obtaining a female-specific fragment. Further designing primers for this fragment, through the method of PCR combined with agarose gel electrophoresis, can accurately identify the gender of the round-ended silkworm moth.

[0009] The specific technical solutions provided by the present invention are as follows:

[0010] In the first aspect of the present invention, a specific DNA fragment for identifying the gender of *Actias heterogyna* is provided, and the nucleotide sequence of the specific DNA fragment is as shown in SEQ ID NO. 48.

[0011] In the second aspect of the present invention, a primer set for amplifying the specific DNA fragment is provided, and the primer set includes an upstream primer and a downstream primer;

[0012] Upstream primer W20f: 5'-TCACACTATAGCAGACTGTTGAC-3';

[0013] Downstream primer W20r: 5'-TTTGGGTAGGGAGGGTTACGA-3'.

[0014] In the third aspect of the present invention, a kit is provided, which includes the primer set.

[0015] In the fourth aspect of the present invention, a detection reagent is provided, which includes the primer set.

[0016] In the fifth aspect of the present invention, a use of the specific DNA fragment, the primer set, the kit or the detection reagent in identifying the gender of *Actias heterogyna* is provided.

[0017] In the sixth aspect of the present invention, a method for identifying the gender of *Actias heterogyna* is provided, including the following steps;

[0018] Extract the genomic DNA of the sample to be tested;

[0019] Using the genomic DNA as a template, perform PCR amplification with the primer set;

[0020] Detect the amplification product by gel electrophoresis. If a specific band appears at 870 bp, it is determined as a female individual; if no specific band appears at 870 bp, it is determined as a male individual.

[0021] As a preferred embodiment of the present invention, the PCR amplification reaction program is: pre-denaturation at 94°C for 3 - 5 min; denaturation at 94°C for 30 - 45 s, annealing at 52 - 56°C for 30 - 60 s, extension at 72°C for 60 s, for 35 cycles; final extension at 72°C for 7 - 10 min.

[0022] More preferably, the PCR amplification reaction program is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 35 s, extension at 72°C for 60 s, for 35 cycles; final extension at 72°C for 7 min.

[0023] As a preferred embodiment of the present invention, the PCR amplification reaction system is as follows: 1 μl of DNA template, 0.5 μl of 10 nmol / L W20f primer, 0.5 μl of 10 nmol / L W20r primer, 12.5 μl of 2×EasyTaq PCR SuperMix, and 10.5 μl of H2O.

[0024] In the seventh aspect of the present invention, there is provided a use of the specific DNA fragment, the primer set, the kit, or the detection reagent in the breeding of Actias dubernardi Oberthur.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] The present invention performs NGS (Next Generation Sequencing) on Actias dubernardi Oberthur individuals of different genders, designs primers using the fragments only present in females, conducts PCR screening, and obtains a female-specific fragment. Further designing primers for the specific fragment located on the W chromosome, through the method of PCR combined with agarose gel electrophoresis, can accurately identify the genders of Actias dubernardi Oberthur, solving the problem that the gender characteristics of Actias dubernardi Oberthur larvae are not obvious and cannot be effectively distinguished. It provides assistance for the gender control breeding, wild resource protection, and the development of the aquaculture industry of Actias dubernardi Oberthur.

[0027] In the identification method provided by the present invention, it includes a pair of gender-specific molecular marker primers (specific to the W chromosome) and a pair of internal reference gene primers (control region of the mitochondrial genome). This method has low cost, is easy to operate, can be used for large-scale and rapid identification, and the results are intuitive and accurate.

[0028] Compared with the traditional method using housekeeping genes (such as actin, etc.), the present invention uses mitochondrial genes as the internal reference for detection because mitochondrial genes are conserved, have good stability, and generally have multiple copies in cells, which is convenient for amplification. In the amplification of Actias dubernardi Oberthur of different individuals using the designed amplification primers F14605 and R95 of the internal reference gene, it was found that among 258 individuals amplified, 256 were successfully amplified in one time, and the success rate in one time was 99.22%. The unsuccessful individuals were successfully amplified after secondary amplification, indicating that the PCR identification method established using the amplification primers provided by the present invention is very stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 For the amplification of the female-specific target fragment, M is the molecular weight standard, C is the female individual, and X is the male individual.

[0030] Figure 2 For the verification of the internal primers of the female-specific fragment, M is the molecular weight standard, C1 - C2 are different female individuals, and X1 - X2 are different male individuals.

[0031] Figure 3 Homology analysis of the female-specific target fragment.

[0032] Figure 4 Amplification of 16 Rotunda rotundapex with known genders, M is the molecular weight standard, C is the female individual, and X is the male individual.

[0033] Figure 5 Gender identification of larvae with unknown genders, M is the molecular weight standard, and 1-16 are 16 different individuals in sequence. Specific implementation manners

[0034] The technical solutions of the present invention and the technical effects produced thereby will be further elaborated below in combination with specific test methods and drawings. The following description is only for explaining the present invention and does not limit the present invention in any way. Any transformation or substitution based on the teachings of the present invention belongs to the protection scope of the present invention.

[0035] The methods used in the present invention are all conventional methods in the art unless otherwise specified. The test materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0036] Rotunda rotundapex is an insect of the genus Rotunda, tribe Bombycini, family Bombycidae. It is named because the forewings and hindwings of this kind of insect are similar and nearly circular, and it is the species most closely related to Bombyx mori and Bombyx mandarina, and its cocoon color and cocoon shape are very close.

[0037] At present, the research on Rotunda rotundapex only includes descriptions of morphology, feeding, etc. There are only 20 genomic data of it in NCBI at present, and there is no information on nuclear genes. The gender identification of insects (agricultural pests and beneficial insects) is of great significance for the effective control of pests and the effective protection of beneficial insects. Insects of different genders in Lepidoptera often have differences in the pupal stage and adult morphology of the insect body, but manual differentiation has the defects of being time-consuming and laborious, and the larval morphology is often similar and difficult to identify.

[0038] Based on this, the present invention provides a specific DNA fragment for identifying the gender of Rotunda rotundapex, and the specific DNA fragment is shown in SEQ ID NO.48.

[0039] Further design primers for this fragment. By the method of PCR combined with agarose gel electrophoresis, the genders of Rotunda rotundapex can be accurately identified, solving the problem that the gender characteristics of Rotunda rotundapex larvae are not obvious and cannot be effectively distinguished.

[0040] When collecting tissue samples of *Actias artemis*, for larvae, tissues that do not contact the outside world such as individuals, blood, and silk glands can be taken. For adult females, only the thorax can be taken, and for adult males, the thorax or the whole body can be taken. This is because the abdomen of female individuals will interfere with the detection results due to fertilization. For eggs and pupae, any part without the outer shell can be taken.

[0041] Although individuals in the pupal stage and adult (moth) stage can be morphologically identified manually, molecular identification reduces the cumbersome manual identification and can be implemented on a large scale.

[0042] Example 1

[0043] Establishment of PCR identification method

[0044] 1. Sequencing

[0045] 1.1 RNA samples

[0046] Take 2 male adult *Actias artemis*, respectively cut an appropriate amount of samples with dissecting scissors (female takes the thorax, male takes the whole body), put them into cryotubes containing RNAhold preservation solution for storage, and send them to Sangon Biotech (Shanghai) Co., Ltd. for cDNA library construction and transcriptome sequencing based on the Illumina HiSeqTM2000 high-throughput sequencing platform.

[0047] 1.2 DNA samples

[0048] Use a rapid DNA extraction kit (DP304, Tiangen Biochemical Technology (Beijing) Co., Ltd.) to extract the total genomic DNA of *Actias artemis*. The specific operation steps are as follows:

[0049] Take 1 male and 1 female adult samples of Antheraea rotundata (take the chest for female and the whole body for male), and use a high-speed oscillating grinder to break them into suspensions respectively; centrifuge the suspension at 10,000 rpm for 1 min, discard the supernatant, add 200 μL of buffer GA to the precipitate, add 20 μL of Proteinase K after shaking and suspending, place it in a 56 °C constant temperature water bath to dissolve the tissue, add 200 μL of GB buffer, and continue to water bath at 70 °C for 10 min; add 200 μL of absolute ethanol, mix well by shaking, transfer the obtained solution and flocculent precipitate to the adsorption column CB3 embedded in the collection tube, centrifuge at 12,000 rpm for 60 s, and discard the waste liquid in the collection tube; add 500 μL of GD buffer to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s to remove the waste liquid; add 600 μL of PW buffer, centrifuge at 12,000 rpm for 30 s and discard the waste liquid, repeat once; finally, centrifuge at 12,000 rpm for 2 min to remove the waste liquid, and let the adsorption column stand at room temperature for several minutes to dry; transfer the adsorption column to a new centrifuge tube, add 100 μL of ddH2O for elution, let it stand at room temperature for 2 - 5 min, centrifuge at 12,000 rpm for 2 min, and the obtained in the centrifuge tube is the extracted genomic DNA.

[0050] The qualified genomic DNA was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequence determination on the MGISEQ - 200RS high-throughput sequencing platform. The fastp software was used to quality control the raw data of the transcriptome and genome of the high-throughput sequencing, and remove the adapters and low-quality sequences. Specifically:

[0051] First, remove the adapter sequences and sequences containing N bases, then remove the low-quality bases (bases with Q value less than 20) from the 3' to 5' direction, and use the sliding window method to remove the bases with quality below 20 at the end of the sequence. The data after quality control is shown in Table 1.

[0052] Table 1 Data of each sample after sequencing quality control

[0053]

[0054] 2. Assembly

[0055] 2.1 Assemble the clean data of the DNA - sequence No. 4 (male individual) using the spades v3.15 software with default parameters. The obtained fasta-formatted sequence after assembly is named male4.fasta.

[0056] Process RNA - 1 and RNA - 2 in the same way to obtain male1.fasta and male2.fasta.

[0057] 2.2 Using male4.fasta as the reference genome, build a standard library using bowtie2-build. Then, use the bowtie2 command to screen the obtained DNA-3 in very-sensitive mode, and output the sequences that cannot be aligned to male4.fasta, named fem3.fq.gz(1 / 2).

[0058] 2.3 Using male2.fasta as the reference genome, with the same parameters as in step 2.2, screen the sequences in fem3.fq.gz(1 / 2) that cannot be aligned to male2.fasta, named fem3_2.fq.gz(1 / 2).

[0059] 2.4 Using male1.fasta as the reference genome, with the same parameters as in step 2.2, screen the sequences in fem3_2.fq.gz(1 / 2) that cannot be aligned to male1.fasta. Name it fem3_2_1.fq.gz(1 / 2).

[0060] 2.5 Use the spades v3.15 software to assemble fem3_2_1.fq.gz(1 / 2), named fem.fasta.

[0061] 3. Randomly select sequences from the fem.fasta file to design primers. Since high-throughput sequencing is definitely not unbiased and is affected by sequencing technology, genomic repetitive sequences, and assembly technology, female-specificity cannot be obtained simply by differences and must be verified by a large number of PCRs. In this experiment, 21 pairs of primers were designed, and 1 pair was successful. The 21 pairs of primers are shown in Table 2.

[0062] Table 2 Primer sequences

[0063]

[0064]

[0065] 4. PCR amplification

[0066] Use 1 female and 1 male individual to screen the 21 pairs of primers in Table 2.

[0067] PCR reaction program: Pre-denature at 94°C for 3 min; Denature at 94°C for 30 s, anneal at 55°C for 35 s, extend at 72°C for 60 s, for 35 cycles; Final extension at 72°C for 7 min.

[0068] It should be noted that the PCR reaction program can vary within the following ranges: pre-denaturation at 94°C for 3 - 5 min; denaturation at 94°C for 30 - 45 s, annealing at 52 - 56°C for 30 - 60 s, extension at 72°C for 60 s, for 35 cycles; final extension at 72°C for 7 - 10 min.

[0069] The reaction system is as follows: 1 μl of DNA template, 0.5 μl of 10 nmol / L W20f primer, 0.5 μl of 10 nmol / L W20r primer, 12.5 μl of 2×EasyTaq PCR SuperMix, and 10.5 μl of H2O.

[0070] The sequence of the forward primer of the reference gene primer used in the detection process, F14605: 5'-CCTCTAAATAAACTAAAATACCgCC-3', SEQ ID NO.42;

[0071] The sequence of the reverse primer of the reference gene primer, R95: 5'-TTCTTTATATTTgAggTATgAgCCC-3', SEQ ID NO.43.

[0072] It was found that only the W20f / W20r primer pair could be amplified in female individuals, while male individuals could not be amplified ( Figure 1 ). Other primer pairs could be amplified in both male and female individuals. The target band was between 1000 bp and 750 bp, and the actual sequencing was 870 bp. Only female individuals could be amplified, while male individuals could not. The control reference was between 1000 bp and 750 bp, and the actual size was 847 bp by sequencing, and both male and female could be amplified.

[0073] 5. Sequencing verification:

[0074] For the reference gene, since it is only necessary to prove that the amplified band is the target band, the present invention uses direct sequencing of PCR products. For the target female-specific band, since the W chromosome is derived from the Z chromosome, there is homology, so accuracy is required. The present invention uses the method of TA cloning sequencing for verification.

[0075] Using online blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) for homology alignment. The results showed that the sequencing sequence of the amplified fragment of the reference gene was the mitochondrial gene of Antheraea rotundata, which was consistent with SEQ ID NO.49; and the female-specific target fragment was also consistent with the SEQ ID NO.48 sequence, proving that both the F14605 / R95 primer pair and the W20f / r primer pair could be successfully amplified and were not false positives.

[0076] The sequence of the female-specific target fragment is shown in SEQ ID NO.48:

[0077] TCACACTATAGCAGACTGTTGACCCGCACATCAGTTTATTTAAACTTAAGTT

[0078] ACATTAACTAAGGTGCAAAAATCTTTAATAAAATGAAAATTTTGGGTCACCA

[0079] CTTTTAGTGGTAATGTGTAAGGAACCACCACCACCGCTGGTCTGCCTTTTTG

[0080] TGAATGGTATCGTACTAAGTTAATCATATTTCAGCAATCACAGTAAGCCACC

[0081] ACCAATCGCAGTAAGCCACCACTAATCGCAGTATTGCGTTATAATTTGAGAG

[0082] ACCTTATTCGTTCCAGTGTACGAATCTATCTAAACGGAAGGGGGGGGGGGG

[0083] GGTGACGCTTCGCGTTTTCCTAGGTTTAACCAGTTACCCCTATGTGGTGCAG

[0084] CAAAACGGGGGCCGTAAACATAATCGGTGGTAGGACTTTGTCCGACTGGCT

[0085] GGCGACCACCCGCCAACCAAAGTCCGCCGCCAAACAGCCCTACTGTGTTC

[0086] AGGCATGCGGATTGGAGAGCCAGTTCTATTTCTCCCCATTCCTCTTCCTTATT

[0087] ATGAATGAGCCTTGGTGATGCTTGAAACATGCGAAGCAGATGTGTGTGCGA

[0088] GTCCCCGCTACCGCCCGCCGGTCAGTAGGGGATCTGAACCCTGGTGTCACC

[0089] ACATAACTCCGCCCCGAGAAGATGTCCCACTAACCGGTGTAAAATCCTATAG

[0090] TGCCGTCGTCGTGCCAGAGTTGGAGACTGGAGTGGATCGCGGCGACCATAC

[0091] GCAGGGTGGGACTGGGAACCCTTCCGTGCTCCTCGATAGCTTTTAACACAA

[0092] CCCGCGGTCTAGCAGTTCTAGCACTCACTGTGACCCGCGCTTTTGTTTGAGT

[0093] TTGACCTTGATCTCACCTATAGCATCGTAACCCTCCCTACCCAAA

[0094] SEQ ID NO.49:

[0095] CCTCTAAATAAACTAAAATACCGCCAAATTATTTAAGTTTTTATAAATAATTAT

[0096] ATACTATTTTAGTATTATTAATTTAAATTTTTTATAATAGGGTATCTAATCCTAG

[0097] TTTTTAATAAAATTTTTTAACCTCATAATTTAATATAAAATTTTAATTAATTAAA

[0098] ATTTCACCTAATAATTTAAAATTTAATTTTATATTTTAATTAATTATTCATTAATC

[0099] CCTAAAAAAATTTAATTTAATTTTTGTATAACCGCAACTGCTGGCACAAAATT

[0100] AGTTATTAATTAAAATATTACTAAATCTTAATTCCTTAAATTTTTAATTTTAATT

[0101] ACTACCTTAATCAAAATAAAATATTATTTAAATAAAGTAAATATAACACTAAA

[0102] ATTTATATGTAAAATAAACCTATAATAAATTTTTAAACCATAAAAAATTTTATT

[0103] TTATTTAATGTAACTTTTTTTGCATAGATCTTTTTTTTTTTTTTTTTTATAATAA

[0104] AATATTTAATATAAGTTATTAAACTTTTAATATTATCTCTCTCTTATTTTCATAAT

[0105] ATTCTAGTTTAAATAAAAAATCAATATTGAAATTTCAATATTCTTTAAAATTAA

[0106] AAAATAATAATATAATTAATCTTAATTTTTTAATAATTTATTGTATATATATATAT

[0107] ATTAATATAATAAATAATTTAATTTATATATATATATATTAATTAATTAAAAATTT

[0108] AATATGTATATATATAAATTGAATAAAAATTATTTAAATATAACCATAAACCGT

[0109] AGGTAATTTTTTTTCATTAAATAAAAAAAATTAAAAATAAGCTAATATAAGCT

[0110] TTTGGGCTCATACCTCAAATATAAAGAA

[0111] 6. Further verification:

[0112] Redesign 2 pairs of primers within the sequencing range. The primer sequences are shown as SEQ ID NO.44, 45 and SEQ ID NO.46, 47. Take 2 female round-ended silkworm moths and 2 male round-ended silkworm moths, and perform PCR identification using the 2 pairs of primers respectively. The PCR conditions are the same as those in Example 1.

[0113] FemF1: 5'-TGGTAATGTGTAAGGAACCACCA-3', SEQ ID NO.44;

[0114] FemR1: 5'-GAAATAGAACTGGCTCTCCAATCC-3', SEQ ID NO.45.

[0115] FemF2: 5'-CAGCAATCACAGTAAGCCACCAC-3', SEQ ID NO.46;

[0116] FemR2: 5'-GGCTCATTCATAATAAGGAAGAGGA-3', SEQ ID NO.47.

[0117] The results were as Figure 2 shown. It was found that these 2 pairs of primers could be amplified in female individuals but not in male individuals. The target band was between 500 bp and 250 bp. The sizes of the amplification products of the primers shown in SEQ ID NO.44 and 45 were 385 bp by sequencing, and the sizes of the amplification products of the primers shown in SEQ ID NO.46 and 47 were 341 bp by sequencing. Both were only amplified in female individuals and not in male individuals. The size of the amplification band of the control internal reference was the same as Figure 1 .

[0118] 7. Homologous alignment of the PCR amplification fragment:

[0119] NCBI online (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), with the parameter of Somewhat similar sequences (due to the low homology with the nr database, this parameter was used, and no homology could be found with other parameters). The homology of this fragment, that is, the female-specific target fragment, with all known NCBI fragments was low. 55% of the region (340 - 787) was less than 75%, and there were no homologous fragments at the other 45% positions. 55% of the region (340 - 787) was annotated as the eggshell gene locus sequence, but the similarity was very low, and there was a missing sequence in the middle. See Figure 3 , Figure 3 for the one that is most similar to the NCBI database shown. 55% of the region (340 - 787) was less than 75%, and there were no homologous fragments at the other 45% positions. Figure 3 The Description at the upper end is a general overview. It can be seen that the coverage and the similarity of the covered region are 73.75%, Figure 3 and the lower end shows the differences in specific bases. The homologous fragment of this fragment in the silkworm is located on chromosome 2, not on the W chromosome. Therefore, it is not foreseeable to use this fragment for the sex identification of round-ended silkworm moths.

[0120] Example 2

[0121] Application of amplification primers in the sex identification of round-ended silkworm moths

[0122] Eight female and eight male adult individuals of *Actias heterogyna* (the genders of the 16 adult individuals are known) were taken. W20f and W20r were used as amplification primers, and SEQ ID NO.42 and SEQ ID NO.43 were used as internal reference gene primers at the same time. Verification was carried out according to the PCR conditions in Example 1. The gender identification of adult *Actias heterogyna* is easy. Female individuals have eggs in the abdomen and no paired claspers (commonly known as tail hooks). Male individuals have no eggs in the abdomen and have paired claspers (commonly known as tail hooks). The chest was taken from female individuals, and the whole individual was taken from male individuals. The subsequent steps such as DNA extraction were the same as those in Example 1.

[0123] The PCR products were detected by 2% agarose gel electrophoresis.

[0124] Gender determination method: Bands could be amplified from all samples using the internal reference primers. If a single bright band was shown at around 750 bp by the internal reference primers, the experiment was successful. Then, a pair of gender-specific molecular marker primers, W20f and W20r, were used to perform electrophoresis detection on the PCR products. If a single bright band was shown at around 870 bp (i.e., the female-specific fragment), it was determined as female; if no specific band appeared at 870 bp, it was determined as male.

[0125] The results showed ( Figure 4 ) that all samples could be amplified using the internal reference primer pair F14605 / R95, indicating that there was no problem with the experimental operation. Both W20f and W20r could be amplified in female individuals but not in male individuals, indicating that the method provided by the present invention could scale the gender identification of *Actias heterogyna*.

[0126] Example 3

[0127] Gender identification and gender ratio investigation of *Actias heterogyna* larvae

[0128] Unknown *Actias heterogyna* larvae were taken for gender ratio analysis (16 individuals of unknown gender). Sixteen newly hatched and unfed surviving newly hatched silkworm larvae were selected. DNA extraction was performed on all of them. The steps were the same as those in Example 1. W20f and W20r were used as amplification primers, and SEQ ID NO.42 and SEQ ID NO.43 were used as internal reference gene primers at the same time. Verification was carried out according to the PCR conditions in Example 1.

[0129] Gender determination method: Bands could be amplified from all samples using the internal reference primers. If a single bright band was shown at around 750 bp by the internal reference primers, the experiment was successful. All internal reference primers could be amplified, indicating that there was no problem with the experimental operation. Then, a pair of gender-specific molecular marker primers, W20f and W20r, were used to perform electrophoresis detection on the PCR products. If a single bright band was shown at around 870 bp, it was determined as female; if no specific band appeared at 870 bp, it was determined as male.

[0130] The results showed that ( Figure 5 ), for the detection of 16 samples of unknown genders, all could be detected using the control internal reference primers, indicating that there was no problem with the experimental operation. Nine were amplified from the 16 individuals, indicating that there were 9 female individuals and 7 male individuals among the 16 samples.

[0131] The chi-square test was further used to determine whether the sex ratio was 1:1. The chi-square test found that P = 0.61 was much greater than P = 0.05, indicating that the difference was not significant and there was no deviation from the sex ratio of 1:1.

[0132] The method provided by the present invention can not only identify the gender of each individual, but also be used to investigate the sex ratio of larvae, determine the change in the sex ratio of male and female individuals, which is of great significance for the prevention and control of pests.

[0133] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A specific DNA fragment for identifying the sex of round-end silkworm moth, characterized in that: The nucleotide sequence of the specific DNA fragment is shown in SEQ ID NO.

48.

2. A primer set for amplifying the specific DNA fragment according to claim 1, characterized in that: The primer set includes an upstream primer and a downstream primer; Upstream primer W20f: 5′-TCACACTATAGCAGACTGTTGAC-3′; Downstream primer W20r: 5′-TTTGGGTAGGGAGGGTTACGA-3′.

3. A kit, characterized in that: It comprises the primer set according to claim 2.

4. A detection reagent, characterized in that: It comprises the primer set according to claim 2.

5. Use of the specific DNA fragment according to claim 1, the primer set according to claim 2, the kit according to claim 3, or the detection reagent according to claim 4 in identifying the sex of the round-end silk moth.

6. A method for identifying the sex of round-ended silkworm moth, characterized in that: The steps include: Extracting whole genome DNA of the sample to be tested; Using the whole genome DNA as a template, PCR amplification is performed using the primer set of claim 2; The amplified product was detected by gel electrophoresis. If a specific band appeared at 870 bp, it was determined to be a female individual; if no specific band appeared at 870 bp, it was determined to be a male individual.

7. The method for identifying the sex of round-end silkworm moth according to claim 6, characterized in that: The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 3-5 min; denaturation at 94°C for 30-45 s, annealing at 52-56°C for 30-60 s, extension at 72°C for 60 s, 35 cycles; final extension at 72°C for 7-10 min.

8. The method for identifying the sex of round-end silkworm moth according to claim 6, characterized in that: The PCR amplification reaction system was: 1 μl DNA template, 0.5 μl 10 nmol / L W20f primer, 0.5 μl 10 nmol / L W20r primer, 12.5 ul 2×EasyTaq PCR SuperMix and 10.5 μl ddH2O.

9. Use of the specific DNA fragment according to claim 1, the primer set according to claim 2, the kit according to claim 3, or the detection reagent according to claim 4 in breeding of round-end silk moth.

Images