Primer and probe combination for detecting Graisseria parasuis and application of primer and probe combination
By designing the combination of primers and probes used to detect Glaseria parasoporia, combined with RAA detection method, the problem of rapid clinical on-site detection is solved, and high sensitivity and specific detection effects are achieved, suitable for clinical and on-site conditions.
Patent Information
- Application Number
- CN202411638094.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-16
- Publication Date
- 2025-03-21
AI Technical Summary
The prior art is difficult to detect Glaseria parasopora quickly and easily in clinical field, and requires expensive instrumentation and professional staff.
A combination of primers and probes for detecting Glaseria parasoporia was designed, combining fluorescent RAA and test stripe RAA detection methods, using the rpoB gene as a target gene, and can be detected without the need for a specific device.
The rapid detection of Glaseria parasop is achieved, with high sensitivity and specificity, and can be tested in less than an hour, suitable for clinical and on-site conditions.
Smart Images
Figure CN119662860A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of rapid detection of pathogenic bacteria, and in particular to a primer and probe combination for detecting Glasserella parasuis and an application thereof. Background Art
[0002] Glaesserella parasuis (G. parasuis) is the causative agent of Glaesserella parasuis disease in swine and is one of the important bacteria that affect the pathogenesis of swine. G. parasuis is an opportunistic pathogen that can colonize the upper respiratory tract of healthy pigs. Glaesserella disease caused by this bacterium is characterized by polyserositis, pneumonia, meningitis, and arthritis in pigs. In addition, the bacteria is mainly transmitted through the air, direct contact, and contaminated objects. Weaned piglets are most susceptible to infection with this bacterium. Co-infection with other bacteria is also common, which has caused huge economic losses to the global pig industry.
[0003] Pneumonia and arthritis are two common symptoms of pigs caused by some respiratory pathogens, including Glasserella parasuis, Actinobacillus pleuropneumoniae (A. pleuropneumoniae), Pasteurella multocida (P. multocida), Bordetella bronchiseptica (B. bronchiseptica), and Actinobacillus indolicus (A. indolicus). These bacteria can cause co-infections, but it is difficult to distinguish them from each other. Therefore, early and rapid diagnosis is crucial for the prevention and control of Glasserella parasuis infection. At present, the preliminary clinical diagnosis based on clinical characteristics and pathological changes is not enough for a definitive diagnosis. More accurate detection methods are needed, including bacterial isolation and identification, and molecular detection. Several molecular detection methods, including PCR, real-time fluorescence PCR, and loop-mediated isothermal amplification (LAMP), have been developed for the diagnosis of Glasserella parasuis. However, these techniques require expensive instruments and skilled professionals, which limits their application in veterinary clinics. Under clinical field conditions, simpler and more convenient techniques are urgently needed for the clinical diagnosis of this pathogen. Summary of the invention
[0004] The object of the present invention is to provide a primer and probe combination for detecting Glasserella parasuis, which can be used for rapid clinical detection of Glasserella parasuis and has high sensitivity and specificity.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The invention provides a primer and probe combination for detecting Glasserella parasuis, the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the probe is shown in SEQ ID NO.3.
[0007] The present invention also provides application of the primer and probe combination in preparing a detection product for detecting Glasera parasuis.
[0008] Preferably, the detection products include a fluorescent RAA kit and a test paper RAA kit.
[0009] Preferably, the probe in the fluorescent RAA kit is labeled with fluorescein FAM at the 31st base from the 5' end, the 32nd base is replaced with tetrahydrofuran THF, the 33rd base is modified with a quenching group BHQ1, and the 3' end is modified with C3-spacer.
[0010] Preferably, the 5' end of the reverse primer in the test paper type RAA kit is modified with a biotin residue, the 5' end of the probe is labeled with fluorescein FAM, the 33rd base from the 5' end is labeled with tetrahydrofuran THF, and the 3' end is modified with C3-spacer.
[0011] Preferably, the reaction system of the fluorescent RAA kit or the test paper RAA kit is: 25 μL of buffer A, 2 μL of each 10 μM primer, 0.6 μL of 10 μM fluorescent RAA kit probe or 0.6 μL of 2 μM test paper RAA kit probe, 12.9 μL of distilled water, 0.01 g of RAA amplification enzyme dry powder, 5 μL of DNA template, and 1.5 μL of buffer B.
[0012] Preferably, the reaction temperature of the fluorescent RAA kit or the test paper RAA kit is 37-39°C.
[0013] The present invention also provides a fluorescent RAA kit or a test paper RAA kit for use.
[0014] The primers and probes designed for the rpoB gene of the present invention are used to detect Glasserella parasuis. The rpoB gene is used as the target gene for RAA determination. The fluorescent RAA (Fluo-RAA) and the test paper RAA (LF-RAA) detection methods have high sensitivity and specificity. The minimum detectable amount of the Fluo-RAA determination is 10 copies, and the minimum amount of the LF-RAA is 100 copies. In order to make the DNA template processing of the RAA determination simpler, the present invention uses a boiling treatment procedure of the sample liquid to prepare the template. It is found that the boiling treatment has the same sensitivity as the kit treatment, avoiding the use of specific equipment, making it possible to perform detection under farm or other field conditions. In addition, the detection method of the present invention can be completed in less than one hour, greatly improving the detection speed and expanding the application field. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The results of fluorescence RAA determination at different temperatures in Example 1 are shown;
[0016] Figure 2 This is a diagram showing the stability test results of Example 1 using the fluorescent Fluo-RAA method;
[0017] Figure 3 A is a sensitivity test result diagram of the fluorescent RAA method of Example 2; B is a sensitivity test result diagram of the test paper RAA method of Example 2 (where test strips 1 to 7 represent 10 5 Copy, 10 4 Copy, 10 3 Copy, 10 2 Copy, 10 1 Copy, 10 0 copy and water template, C represents the control line, and T represents the test line);
[0018] Figure 4 This is a graph showing the specific detection results of the fluorescent RAA method in Example 3;
[0019] Figure 5 Graph showing the specificity test results of the test paper type RAA method of Example 3 (wherein 1 to 6 represent the positive control (standard plasmid), Glasserella parasuis, Actinobacillus pleuropneumoniae, Pasteurella multocida, Bordetella bronchiseptica and Actinobacillus indoliens, respectively, C is the control line, and T is the test line);
[0020] Figure 6A is the detection curve of the fluorescent RAA method for different strains of samples in Example 4 (where S1~S14 represent 14 positive samples, N and P represent negative control and positive control, respectively); B is the test paper LF-RAA method detection result of the positive sample in Example 4 (where 1~4 represent typical examples of Glassera parasuis nucleic acid samples, N and P represent negative control and positive control, respectively); D is the test paper LF-RAA method detection result of the negative sample in Example 4 (where 1~5 represent typical examples of non-Glasera parasuis nucleic acid samples, N and P represent negative control and positive control, respectively) (because C represents the control line in the test paper method detection, the figure in the lower right corner is represented by D). DETAILED DESCRIPTION
[0021] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0022] Bacterial strains and samples
[0023] All bacterial strains, including G. parasuis, A. pleuropneumoniae, P. multocida, B. bronchiseptica, and A. indolicus, were isolated from pigs in pig farms in Fujian Province, China in 2023 and stored in our laboratory. Nasal swabs were collected from pigs in different pig farms in Fujian Province, China. These samples were collected between July 2023 and July 2024. The information of bacterial strains and nasal swabs is listed in Table 1.
[0024] Table 1 Bacterial strains and sample collection information
[0025]
[0026]
[0027] 2. Bacterial isolation and identification and DNA extraction
[0028] The collected nasal swabs were immersed in tryptone soy broth (TSB) (OXOID Ltd, Basingstoke, UK) and then mixed thoroughly. Subsequently, the mixture was spread on tryptone soy broth agar (TSA) (OXOID Ltd, Basingstoke, UK), which contained 0.005% nicotinamide adenine dinucleotide (NAD) (Amresco Inc, Solon, OH, USA), 5% defibrinated sheep blood (Zhengzhou Jiulong Biotechnology Co., Ltd., Zhengzhou, China) and 5% bovine serum (Zhejiang Tianhang Biotechnology Co., Ltd., Hangzhou, China). Individual colonies were purified and then the suspected colonies of G. parasuis were stored for future use (a total of 48 copies). The bacterial strains used in this study were revived according to the conventional method. Bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit according to the instructions (Tiangen Biotechnology Co., Ltd., Beijing, China). A total of 121 porcine nasal swab samples were collected (see Table 1), and the sample DNA was extracted using a bacterial genomic DNA extraction kit. The extracted DNA was stored at -20°C for future use.
[0029] 3. Design primers and probes
[0030] According to the rpoB gene sequence of Glaseria parasuis, Fluo-RAA and LF-RAA specific primers and probes were designed, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1: GTGAATGCCAAATTCGTGGTACAACCTATGCAGC, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2: GTTGATCACGAAAGTACCGTTGTCGGTCATCAATG, and the nucleotide sequence of the probe is shown in SEQ ID NO.3: CCTTTACGCGTAAAACTTCGT CTTGTGACCTTTGATCGCGAAGCG. The rpoB gene was obtained from GenBank (https: / / www.ncbi.nlm.nih.gov / nucleotide / ) (CP118165.1), and the designed primers were primers rpoB0-F and rpoB0-R in Table 2, and the multiple sequence alignment tool ClustalW was used for alignment. The rpoB probe of Fl uo-RAA was modified with fluorescein FAM, tetrahydrofuran THF and BHQ1-dT (such as rpoB1-P in Table 2), the rpoB reverse primer of LF-RAA was modified with 5′-biotin residue (such as rpoB2-LR in Table 2), the rpoB probe of LF-RAA was modified with fluorescein FAM, tetrahydrofuran THF and C3-spacer (such as rpoB2-LP in Table 2), and the internal probe of LF-RAA was designed under the recommendation of RAA guidelines. All oligonucleotide primers and probes were synthesized by Shangya Biotechnology Co., Ltd. (Fuzhou City). These primers and probes are listed in Table 2.
[0031] Table 2 Primer and probe sequences
[0032]
[0033]
[0034] 4. Construction of standard plasmid
[0035] The target fragment was cloned from the rpoB gene of G. parasuis. The ropB gene of G. parasuis was amplified by PCR in the following system: 25 μL of 2×Taq Mix (Omega, USA), 2 μL of bacterial DNA template, 1 μL of each of 10 μM forward and reverse primers (rpoB0-F and rpoB0-R), 21 μL of distilled water, added to 50 μL. Reaction procedure: 94°C for 5 minutes, denaturation at 94°C for 45 seconds, annealing at 55°C for 45 seconds, extension at 72°C for 1 minute, then extension at 72°C for 10 minutes, a total of 35 cycles, and finally stored at 4°C. Recovered by 1% agarose gel electrophoresis, recovered by gel recovery kit, connected to pMD19-T vector (TaKaRa, Japan), and then transformed into competent cells DH5α (TaKaRa, Japan). After blue-white screening, a single colony was selected for overnight culture and plasmid extraction (Omega, USA). The number of DNA copies of the plasmid per unit volume was calculated according to Moore's law. The calculation formula is as follows: plasmid copy number (copy number / μL) = [plasmid concentration (g / μL) × 6.02 × 10 23 ] / [total fragment length (bp) × 660 g / mol], total fragment length = vector length (bp) + fragment length (bp). The constructed standard plasmid was diluted to 10 by 10-fold dilution method. 5 ~10 0 The gradient concentrations were calculated as 100 copies / μL and stored at -20°C for future use.
[0036] The specificity of Fluo-RAA and LF-RAA was evaluated using DNA of Glassera parasuis, Actinobacillus pleuropneumoniae, Pasteurella multocida, Bordetella bronchiseptica, and Escherichia coli as templates and primers and probe of rpoB gene of Glassera parasuis.
[0037] Example 1 Establishment and Optimization of Fluorescence RAA Method
[0038] 1. Fluorescent RAA (Fluo-RAA) reactions were performed at a constant temperature using a Fluo-RAA kit (Zhongce Biotechnology Co., Ltd., Hangzhou, China). The premixed reagents contained 25 μL of A buffer, 2.0 μL of 10 μM RAA primers (rpoB1-F and rpoB1-R), 0.6 μL of 10 μM probe (rpoB1-P), and 12.9 μL of distilled water. Add the premixed reagents to the dried RAA amplification enzyme powder and mix thoroughly. Then add 5 μL of DNA template (standard plasmid) to the mixture, and add 2.5 μL of B buffer to the reaction tube cap. Finally, the reaction mixture was centrifuged at 12,000 g for 10 seconds, and then subjected to Fluo-RAA at a constant temperature. To obtain the optimized reaction conditions, RAA assay was performed at 25°C, 27°C, 29°C, 31°C, 33°C, 35°C, 37°C, 39°C, 41°C, and 43°C in a fluorescent PCR instrument (BioRad, USA).
[0039] 10 5 ~10 0 The 1000 copies / μL plasmid was used as a template for fluorescence-type RAA assay, and the reaction results were observed by fluorescence signals.
[0040] RAA assays were performed at different temperatures to optimize the reaction conditions. After the Fluo-RAA assay was performed on G. parasuis at a temperature range of 25 to 43°C, the fluorescence amplification curves were evaluated to screen the optimal temperature. The fluorescence curves of the Fluo-RAA assay showed that the DNA yield was highest at 39°C, so all subsequent RAA reactions in this study were performed at 39°C. The results are shown in Figure 1 The three replicate tests of positive samples showed that the Fluo-RAA assay was stable ( Figure 2 ).
[0041] 2. The dipstick RAA (LF-RAA) reaction was performed in a water bath using the LF-RAA kit (Zhongce Biotechnology Co., Ltd., Hangzhou, China). The premixed reagent contained 25 μL of A buffer, 2.0 μL of each 2 μM RAA primer (rpoB2-LF and rpoB2-LR), 0.6 μL of 2 μM probe (rpoB2-LP), and 12.9 μL of distilled water. The premixed reagent was added to the RAA amplification enzyme dry powder and mixed thoroughly. Then 5 μL of DNA template (standard plasmid) was added to the mixture, and 2.5 μL of B buffer was added to the reaction tube cap. Finally, the reaction mixture was centrifuged at 12000g for 10 seconds, and then RAA was performed in a water bath. RAA determination was performed with reference to the optimal reaction temperature of Fluo-RAA, 39°C. The reaction product was diluted to 1:6 with PBS. 100 μL of the diluted reaction product was transferred to a new test tube. The dipstick was then placed vertically in the new tube containing the reaction product. After 15 minutes at room temperature, the results were observed visually.
[0042] 10 5 ~10 0 The 1000 copies / μL plasmid was used as a template for the dipstick-type RAA assay, and the reaction results were observed through the test line of the dipstick.
[0043] Example 2 Sensitivity of Fluorescent and Dipstick RAA Methods
[0044] Serial dilutions of the standard plasmid (10 for each reaction) were used. 5 ~10 0 The results showed that when the concentration of the template DNA was 10 or more copies per reaction, positive detection of Fluo-RAA could be obtained, and when the concentration of the template DNA was 100 or more copies per reaction, positive detection of LF-RAA could be obtained. Therefore, the sensitivity of Fluo-RAA detection and LF-RAA detection were 10 copies and 100 copies, respectively. Figure 3 shown.
[0045] Example 3 Specificity of fluorescent and dipstick RAA methods
[0046] The specificity of Fluo-RAA and LF-RAA detection was determined using the detection method of Example 1 for Glaesserella parasuis, Actinobacillus pleuropneumoniae, Pasteurella multocida, Bordetella bronchiseptica, and Actinobacillus indolicus (the concentration of all bacterial nucleic acids was 1000 copies / μL). Only the Fluo-RAA and LF-RAA test results for Glaesserella parasuis were positive, while the results for the other bacteria were negative. These results indicate that both the Fluo-RAA and LF-RAA detection methods can specifically detect Glaesserella parasuis. The results are shown in Figure 1. Figure 4 and Figure 5 shown.
[0047] Example 4 Simplification and clinical application of fluorescent and test paper RAA methods
[0048] In order to establish a sample processing procedure that can be simplified in clinical practice, a simplified DNA extraction procedure was tested. A known amount of simulated nasal swab fluid samples of G. parasuis were extracted using a commercial kit or boiling treatment as DNA templates, and then tested for Fluo-RAA and LF-RAA. The results showed that all samples of both treatment methods were positive in both detection methods. The results are shown in Table 3. Therefore, this indicates that boiling treatment of samples is a feasible method to replace the DNA extraction method.
[0049] A total of 121 nasal swab samples and 48 bacterial strains from pigs with respiratory diseases (Table 1) were collected and tested by Fluo-RAA and LF-RAA assays, respectively. Of these nasal swab samples, 26 samples were positive by Fluo-RAA and 24 samples were positive by LF-RAA, with positive rates of 21.5% and 19.8%, respectively. In addition, among these bacterial strains, 12 strains were positive by either Fluo-RAA or LF-RAA, with a positive rate of 25%. Through bacterial isolation and 16S rRNA sequencing, two discordant samples were confirmed to be positive, that is, Fluo-RAA positive but LF-RAA negative, for Glassella parasuis. The two samples were negative by LF-RAA due to the low number of Glassella parasuis. It is worth noting that all samples were boiled to obtain DNA templates. The results are shown in Table 3.
[0050] The positive and negative samples were tested using the fluorescence RAA method and the test paper RAA method, respectively. The results are as follows: Figure 6 As shown (where Figure 6 The positive control used in A was the recombinant plasmid of the rpoB gene of Haemophilus parasuis, and the negative control was nucleic acid-free water. The positive control used in B was the recombinant plasmid of the rpoB gene of Haemophilus parasuis, and the negative control was nucleic acid-free water. The positive control used in D was the recombinant plasmid of the rpoB gene of Haemophilus parasuis, and the negative control was nucleic acid-free water).
[0051] Table 3 Clinical application of Fluo-RAA and test paper RAA methods
[0052]
[0053] As can be seen from the above embodiments, the present invention provides a Fluo-RAA and LF-RAA detection method for detecting G.parparasuisinfection using primers and probes for the rpoB gene. The rpoB gene can be translated into bacterial RNA polymerase and has a high degree of structural and sequence conservation. Therefore, the rpoB gene can be used as a target gene for RAA determination. The sensitivity and specificity of the detection were determined. The minimum detectable amount of the Fluo-RAA assay was 10 copies, while the minimum amount of LF-RAA was 100 copies. In contrast, the sensitivity of Fluo-RAA was higher than that of LF-RAA. G was detected by applying these two detection methods. The sensitivity of Fluo-RAA was further confirmed by directly performing parainfluenza virus detection in boiled positive nasal swab fluid. Specificity tests showed that Fluo-RAA and LF-RAA detection methods could only detect G.parparasuis, indicating that the two methods had good specificity. However, Fluo-RAA detection is more suitable for laboratory diagnosis of G.parparasuis, while LF-RAA detection is more suitable for field situations. In addition, without the need for special instruments and nucleic acid extraction steps, Fluo-RAA and LF-RAA detection can be completed in less than an hour, greatly improving the detection speed and broadening the application fields.
[0054] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A primer and probe combination for detecting Glasserella parasuis, characterized in that: The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the probe is shown in SEQ ID NO.
3.
2. Use of the primer and probe combination according to claim 1 in preparing a detection product for detecting Glasera parasuis.
3. The use according to claim 2, characterized in that The detection products include fluorescent RAA kits and test paper RAA kits.
4. The use according to claim 3, characterized in that The probe in the fluorescent RAA kit is labeled with fluorescein FAM at the 31st base from the 5' end, the 32nd base is replaced with tetrahydrofuran THF, the 33rd base is modified with a quenching group BHQ1, and the 3' end is modified with C3-spacer.
5. The use according to claim 3, characterized in that The 5' end of the reverse primer in the test paper type RAA kit is modified with a biotin residue, the 5' end of the probe is modified with fluorescein FAM, the 33rd base from the 5' end is labeled with tetrahydrofuran THF, and the 3' end is modified with C3-spacer.
6. The use according to claim 5, characterized in that The reaction system of the fluorescent RAA kit or the test paper RAA kit is: 25 μL of buffer A, 2 μL of each 10 μM primer, 0.6 μL of 10 μM fluorescent RAA kit probe or 0.6 μL of 2 μM test paper RAA kit probe, 12.9 μL of distilled water, 0.01 g of RAA amplification enzyme dry powder, 5 μL of DNA template, and 2.5 μL of buffer B.
7. The use according to claim 6, characterized in that The reaction temperature of the fluorescent RAA kit or the test paper RAA kit is 37-39°C.
8. A fluorescent RAA kit or a test paper RAA kit for use according to any one of claims 2 to 7.