Application of QTL locus Qsdss.saas.6A in identification of wheat SDS sedimentation value genotype and identification kit

Abstract

The present invention belongs to the field of biotechnology and specifically relates to QTL loci Qsdss.saas.6A Application and identification kit for identifying wheat SDS sedimentation value genotype. The QTL locus Qsdss.saas.6A Located on the short arm of wheat chromosome 6A, the genetic interval is 28.14-48.75 cM, and the corresponding molecular markers on both sides are AX‑110002278 and AX‑111581648 At the same time, a KASP primer set is also provided. The KASP primer set of the present invention is used to prepare a detection kit for the detection of SDS sedimentation value of wheat grains, which can quickly screen wheat strains with high SDS sedimentation values ​​and greatly improve breeding efficiency. The identification method provided by the present invention has simple steps, is reliable and practical, has important application value in wheat breeding, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to QTL loci Qsdss.saas.6A Application and identification kit for identifying wheat SDS sedimentation value genotype. Background Art

[0002] With the growth of the global population and the improvement of living standards in developed and developing countries, people's demand for high-quality wheat is gradually increasing. However, most of my country's wheat production relies on imports for common wheat, less high-quality wheat, and high-quality special wheat. Therefore, quality improvement is one of the main directions of wheat breeding. The detection methods of traditional wheat quality evaluation indicators are complex and time-consuming, and have a large demand for seeds and low efficiency. SDS sedimentation value (SDS sedimentation value, SDS-SV) is closely related to gluten content and strength and wheat flour baking quality. It requires a small amount of detection samples and has high efficiency. It has been widely used in wheat genetic research.

[0003] The study showed that QTL loci related to SDS sedimentation value were found on almost all chromosomes, but most of them were concentrated in the segments encoding HMW-GSs and alcohol-soluble protein genes, such as the high molecular weight glutenin subunit (HMW-GS) locus. Glu-1 ( Glu-A1 , Glu-B1 , Glu-D1 ), low molecular weight gluten Glu-A3 and Glu-B3 Prolamin site Gli-B1(Chen H, Bemister DH, Iqbal M, Strelkov SE, Spaner DM (2020)Mapping genomic regions controlling agronomic traits in spring wheat underconventional and organic managements. Crop Sci 60:2038–2052; Semagn K, IqbalM, Chen H, Perez-Lara E, Bemister DH, Xiang R, Zou J, Asif M, Kamran A, N'Diaye A, Randhawa H, Beres BL, Pozniak C, Spaner D (2021) Physical mapping of QTL associated with agronomic and end-use quality traits in spring wheatunder conventional and organic management systems. Theor Appl Genet 134:3699–3719); Some studies have also shown that wheat grain hardness alleles Pinb-D1b and Pinb-D1p It has a positive effect on the SDS sedimentation value of wheat (Bhave M, Morris CF (2008) Molecular genetics of puroindolines and related genes: allelic diversity in wheat and other grasses. Plant Mol Biol66:205–219; Chang S, Chen Q, Yang T, Li B, Xin M, Su Z, Du J, Guo W, Hu Z,Liu J, Peng H, Ni Z, Sun Q, Yao Y (2022) Pinb-D1pis an elite allele for improving end-use quality in wheat (Triticum aestivum L.). Theor Appl Genet135: 4469-4481). However, most studies have remained on the basis of the initial positioning of SDS sedimentation value QTL, and the number of molecular markers that can be used to assist in the selection of wheat quality traits is far less than the number of molecular markers for yield traits. Summary of the invention

[0004] In order to overcome the defects and shortcomings of the prior art, one of the objects of the present invention is to provide a QTL locus related to the SDS sedimentation value of wheat grains. Qsdss.saas.6A By developing tightly linked molecular markers for the initially located major QTL loci for SDS sedimentation values, a rapid, accurate and high-throughput identification or auxiliary identification method for wheat grain SDS sedimentation values ​​was established, which can quickly screen wheat lines with high SDS sedimentation values ​​and improve breeding efficiency.

[0005] In the first aspect, the present application provides a QTL locus Qsdss.saas.6A Application in identifying wheat SDS sedimentation value genotypes.

[0006] As a specific embodiment of the present application, the QTL locus associated with the SDS sedimentation value of wheat grains Qsdss.saas.6A Located on the short arm of wheat chromosome 6A, the genetic interval is 28.14-48.75 cM, and the corresponding molecular markers on both sides are AX-110002278 and AX-111581648 , the physical interval is 23.64-39.27 Mb. The QTL locus Qsdss.saas.6A It can explain 8.08-15.96% of the phenotypic variation.

[0007] In a second aspect, the present application provides a kit for identifying wheat SDS sedimentation value genotypes, including the above-mentioned QTL loci. Qsdss.saas.6A Corresponding KASP primer pairs.

[0008] As a specific embodiment of the present application, the KASP primer pair includes an upstream primer and a downstream primer; the upstream primer includes an upstream primer 1 and an upstream primer 2;

[0009] As a specific implementation of the present application, the upstream primer includes upstream primer 1 and upstream primer 2:

[0010] The upstream primer 1 is a nucleotide sequence as shown in SEQ ID No.1 or a DNA molecule in which 1-3 nucleotides of the nucleotide sequence as shown in SEQ ID No.1 are replaced and / or deleted and / or added and have the same function as the nucleotide sequence as shown in SEQ ID No.1;

[0011] The upstream primer 2 is a nucleotide sequence as shown in SEQ ID No. 2 or a DNA molecule in which 1-3 nucleotides of the nucleotide sequence as shown in SEQ ID No. 2 are replaced and / or deleted and / or added and has the same function as the nucleotide sequence as shown in SEQ ID No. 2;

[0012] The downstream primer includes the nucleotide sequence shown in SEQ ID No.3, or a DNA molecule in which 1-3 nucleotides of the nucleotide sequence shown in SEQ ID No.3 are replaced and / or deleted and / or added and has the same function as the nucleotide sequence shown in SEQ ID No.3.

[0013] As a specific implementation of the present application, the nucleotide sequence of the upstream primer 1 is shown as SEQ ID No.1.

[0014] As a specific implementation of the present application, the nucleotide sequence of the upstream primer 2 is shown as SEQ ID No.2.

[0015] As a specific implementation of the present application, the nucleotide sequence of the downstream primer is shown as SEQ ID No.3.

[0016] As a specific implementation of the present application, the molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:5.

[0017] In a third aspect, the present application provides a method for identifying wheat SDS sedimentation value genotypes using the above kit, comprising the following steps:

[0018] (1) Extract the genomic DNA of the wheat to be tested, use it as a template, perform the KASP reaction using the KASP primer pair, and read the fluorescence signal of the reaction product;

[0019] (2) If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of AA genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of aa genotype; the wheat strain with AA genotype is selected as a wheat strain with high SDS sedimentation value.

[0020] As a specific implementation of the present application, the Touchdown PCR reaction program in the KASP reaction in the step (1) is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 64°C for 30 s, extension at 72°C for 30 s, 10 cycles, the annealing temperature of each cycle is 0.8°C lower than that of the previous cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 32 cycles.

[0021] As a specific implementation of the present application, the PCR reaction system is: upstream primer 1, upstream primer 2, mixed primer of downstream primer; 2× PAMRS Pro SNP Gentyping PCR Mix; water; DNA template.

[0022] As a specific embodiment of the present application, the SDS sedimentation value of the wheat grains with the AA genotype to be tested is significantly higher than that of the wheat with the aa genotype.

[0023] In a fourth aspect, the present application provides the use of the above-mentioned kit or the above-mentioned identification method in breeding wheat strains with high SDS sedimentation values.

[0024] Beneficial effects of this application

[0025] The KASP primer pair provided by the present invention is used to perform KASP analysis on 206 wheat strains, and the fluorescence reading results show that the genotypes of 92 wheat strains are AA, and the genotypes of 114 wheat strains are aa, and the SDS sedimentation value of the wheat grains to be tested with the AA genotype is significantly higher than that of the wheat to be tested with the aa genotype, which proves that the primers provided by the present invention can identify or assist in identifying the SDS sedimentation values ​​of wheat grains of different strains, and can quickly screen wheat strains with high SDS sedimentation values, thereby greatly improving breeding efficiency; and the identification method provided by the present invention has simple steps, is reliable, and is practical, has important application value in wheat breeding, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Wheat kernel SDS sedimentation value Qsdss.saas.6A Genetic linkage map;

[0027] Figure 2 Schematic diagram of genotyping results using primer pairs;

[0028] Figure 3 These are the statistical results of SDS sedimentation values ​​of wheat grains with AA genotype and aa genotype under different environments. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments. The given examples are only for illustrating the present invention, but not for limiting the scope of the present invention.

[0030] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] The test material used in the present invention is a RIL population containing 206 strains constructed by hybridizing wheat varieties Jimai 44 and Jimai 229 and self-pollinating them for 5 generations.

[0033] 2× PAMRS Pro SNP Gentyping PCR Mix is ​​a product of Wuhan Jingpeptide Biotechnology Co., Ltd.

[0034] Example 1: Planting of test materials and obtaining SDS sedimentation values ​​of wheat grains to be tested

[0035] 1. Planting of test materials

[0036] The RIL population and its parents, Jimai 44 and Jimai 229, were planted in Jinan, Shandong in 2020 (E1: 2020-JN) and in Jinan, Shandong in 2021 (E2: 2021-JN) and Jiyang, Shandong (E3: 2021-JY). RILs and their parents were planted in randomized complete blocks in each environment. Each line was planted in one row in each environment, with a row length of 3 m and a row spacing of 30 cm. 40 seeds were sown in each row.

[0037] 2. Determination of SDS sedimentation values ​​of grains of different wheat strains

[0038] After the seeds of plants in different environments were harvested, they were ground into flour using a mill. 2 g was weighed and the SDS-sedimentation value was determined by the micro-method. Two technical replicates were performed for each line and the average value was taken (Table 1).

[0039]

[0040] Example 2: QTL location analysis and primer pair development for wheat grain SDS sedimentation value

[0041] 1. QTL analysis

[0042] The genetic map constructed by JoinMap 4.0 was used to locate the QTL of grain SDS sedimentation value in RIL population under different environments by using the composite interval mapping method (CIM) with WinQTLCart 2.5 software. The LOD value of 2.5 was selected as the threshold. A major QTL locus that was stable in all three environments was identified on the short arm of chromosome 6A. Qsdss.saas.6A , explaining 8.08-15.96% of the phenotypic variation, with a genetic interval of 28.14-48.75 cM, a physical interval of 23.64-39.27 Mb, and markers on both sides AX-110002278 and AX-111581648 ( Figure 1 ).

[0043] 2. Primer pair development

[0044] 1. Preparation of primer pairs

[0045] Based on the resequencing data of Jimai 44 and Jimai 229, there is a C / G SNP site at the physical position of 27,004,705 bp on chromosome 6A. Qsdss.saas.6A Linked molecular markers, primer pairs synthesized by Sangon Biotech (Shanghai) Co., Ltd.:

[0046] Upstream Primer 1:

[0047] 5'-GAAGGTGACCAAGTTCATGCTAAGAAGAGAACGGTGAAATTGCTC-3' (SEQ ID No. 1, wherein GAAGGTGACCAAGTTCATGCT is a universal tag sequence);

[0048] Upstream Primer 2:

[0049] 5′-GAAGGTCGGAGTCAACGGATTAAGAAGAGAACGGTGAAATTGCTG-3′ (SEQ ID No. 2, wherein GAAGGTCGGAGTCAACGGATT is a universal tag sequence);

[0050] The 3' ends of the upstream primer 1 and the upstream primer 2 include an allele of a SNP.

[0051] Downstream primer: 5'-AGAACAGCAGAGGAAGAGATTGTT-3' (SEQ ID No. 3, the reverse complementary sequence of positions 109-132 of SEQ ID No. 4).

[0052] The primer pairs were purified by PAGE.

[0053] When used, the molar ratio of upstream primer 1, upstream primer 2 and downstream primer is 2:2:5. The nucleotide sequence of the product amplified using the above primer pair is shown in SEQ ID No. 4, and the specific sequence is:

[0054] 5'-AAGAAGAGAACGGTGAAATTGCTCCAAATGAAGGGAACAACAAGACCTGCCAGCAGTAGTACCTAGAATGAAGCTAGAAGATGTGGTAGAAAGATGTTTTTTTCAGTTAACAATCTCTTCCTCTGCTGTTCT-3';

[0055] Alternatively, the 25th base C from the 5' end of the above sequence may be a G base.

[0056] 2. Genotyping Methods

[0057] 1. Extraction of genomic DNA

[0058] Extracting genomic DNA from wheat leaves to be tested In this embodiment, the wheat to be tested is the 206 wheat strains in Table 1.

[0059] 2. Prepare PCR reaction system

[0060] PCR reaction system (5 μL): mixed primers (SEQ ID No.1: SEQ ID No.2: SEQ ID No.3 =2:2:5) / 10μM 0.25 μL; 2× PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; water 1.25 μL; DNA template (100 ng / μL) 1 μL; total 5 μL.

[0061] 3. KASP and fluorescence detection and analysis

[0062] (1) Take the PCR reaction system in step 2 and place it in a 9600 PCR Thermo Cycler instrument to perform PCR amplification reaction. The PCR program is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 64°C for 30 s, and extension at 72°C for 30 s, for 10 cycles, with the annealing temperature of each cycle lowered by 0.8°C than the previous cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 32 cycles.

[0063] (2) After completing step (1), use the KASP genotyping detection device to read the fluorescent signal.

[0064] The experimental results are shown inFigure 2 If the fluorescence detection result shows HEX allele, the genotype of the wheat is AA; if the fluorescence detection result shows FAM allele, the genotype of the wheat is aa.

[0065] The genotypes of 206 wheat lines were typed according to the above method, and the genotyping results are shown in Table 1 (HEXallele is the wheat to be tested with genotype AA, and FAM allele is the wheat to be tested with genotype aa). The results showed that the genotype of 92 wheat lines was AA, and the genotype of 114 wheat lines was aa.

[0066] 4. Correlation analysis between genotype and SDS sedimentation value of wheat grains

[0067] The SDS sedimentation values ​​of two types of wheat grains, genotype AA and genotype aa, were statistically analyzed. The results are shown in Figure 3 The results showed that the SDS sedimentation value of AA genotype wheat grains under different environments was significantly higher than that of aa genotype wheat grains (P<0.01 or P<0.001). This indicated that the primer set and detection system could be used for molecular marker-assisted selection with the goal of improving the SDS sedimentation value of wheat grains.

[0068] Example 3: Application of the primers in breeding wheat lines with high SDS sedimentation values

[0069] The application of the invention in breeding wheat lines with high SDS sedimentation values ​​comprises the following steps:

[0070] 1. Extract the genomic DNA of the wheat to be tested, use it as a template, use the primer pair to perform KASP reaction, and read the fluorescence signal of the reaction product.

[0071] The primer pair includes an upstream primer and a downstream primer; the upstream primer includes an upstream primer 1 and an upstream primer 2: the upstream primer 1 is a nucleotide sequence as shown in SEQ ID No.1, the upstream primer 2 is a nucleotide sequence as shown in SEQ ID No.2, and the downstream primer is a nucleotide sequence as shown in SEQ ID No.3.

[0072] The PCR reaction program in the KASP reaction was as follows: pre-denaturation at 94 °C for 5 min; 10 cycles of denaturation at 94 °C for 30 s, annealing at 64 °C for 30 s, and extension at 72 °C for 30 s, with the annealing temperature of each cycle lowered by 0.8 °C than the previous cycle; 32 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s.

[0073] The PCR reaction system was: 0.25 μL of a 10 μM mixed primer consisting of upstream primer 1: upstream primer 2: downstream primer = 2: 2: 5; 2× PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; water 1.25 μL; 1 μL of DNA template 100 ng / μL, and a total volume of 5 μL.

[0074] 2. If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of AA genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of aa genotype. The SDS sedimentation value of the wheat grains of the AA genotype to be tested is significantly higher than that of the wheat to be tested of the aa genotype, and the wheat strains of the AA genotype are selected as strains for breeding high SDS sedimentation values ​​for molecular marker-assisted selection.

[0075] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. QTL loci Qsdss.saas.6A The application of the corresponding KASP primer pair in identifying wheat SDS sedimentation value genotypes is characterized in that: The QTL loci Qsdss.saas.6A The corresponding KASP primer pair consists of upstream primer 1, upstream primer 2, and downstream primer; The nucleotide sequence of the upstream primer 1 is shown in SEQ ID No. 1; The nucleotide sequence of the upstream primer 2 is shown in SEQ ID No. 2; The nucleotide sequence of the downstream primer is shown in SEQ ID No.

3.

2. The use according to claim 1, characterized in that: The molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:

5.

3. A method for identifying wheat SDS sedimentation value genotype, characterized in that: The following steps are involved: (1) extracting genomic DNA of wheat to be tested, using it as a template, performing a KASP reaction using the KASP primer pair described in claim 1, and reading the fluorescence signal of the reaction product; (2) When the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of AA genotype; when the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of aa genotype; the wheat strain with AA genotype is selected as a wheat strain with high SDS sedimentation value.

4. The identification method according to claim 3, characterized in that The Touchdown PCR reaction program in the KASP reaction in step (1) is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 64°C for 30 s, and extension at 72°C for 30 s, for 10 cycles, wherein the annealing temperature of each cycle is 0.8°C lower than that of the previous cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 32 cycles.

5. The identification method according to claim 4, characterized in that The PCR reaction system is: upstream primer 1, upstream primer 2, mixed primer of downstream primer; 2× PAMRS Pro SNP Gentyping PCR Mix; water; DNA template.

6. Use of the identification method according to any one of claims 3 to 5 in breeding wheat strains with high SDS sedimentation values.

Images