Application of POK erythroid myelogenic factor ZBTB7A in resisting hepatitis B virus

Abstract

The invention discloses an application of a POK erythroid myelogenic factor ZBTB7A in resisting hepatitis B virus. Experiments prove that the overexpression of the ZBTB7A can significantly reduce the level of secreted HBV-related virus protein and significantly inhibit HBV transcription and replication, and a new potential target is provided for treatment of hepatitis B. The research prompts that the ZBTB7A can be used as a novel HBV host limiting factor, lays a foundation for developing novel antiviral drugs, provides more effective treatment schemes for clinical treatment, and has wide application prospects and market potential.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to application of POK erythroid myeloid carcinogenic factor ZBTB7A in resisting hepatitis B virus. Background Art

[0002] Hepatitis B virus (HBV) infection is a common chronic viral infection that can progress to severe end-stage liver diseases such as cirrhosis and hepatocellular carcinoma. HBV is a hepatotropic DNA virus. The mature HBV virus particle contains a nucleocapsid composed of hepatitis B core protein (HBcAg), viral polymerase and viral genomic DNA (relaxed circular DNA, rcDNA), and is wrapped by HBV surface antigen (HBsAg). After HBV invades hepatocytes, rcDNA is repaired to cccDNA and used as a template to transcribe into four different HBV mRNAs, encoding HBV core antigen (HBcAg), surface antigen (HBsAg) and e antigen (HBeAg) as well as polymerase (P) involved in viral replication, and then continuously replicates in hepatocytes. At present, clinical antiviral treatment for HBV is mainly based on nucleotide analogs and pegylated interferon-α, but it is difficult to achieve functional cure. Therefore, finding new targets for the treatment of HBV infection is of great practical significance.

[0003] ZBTB7A (Zinc finger and BTB domain-containing protein 7A), also known as POK erythroid myeloid carcinogen, is a member of the POK transcriptional repressor family. The protein encoded by ZBTB7A contains an N-terminal BTB / POZ domain and a C-terminal zinc finger domain. The C-terminal zinc finger structure of the protein can specifically recognize and bind to DNA sequences in gene regulatory regions. On the other hand, the N-terminal BTB / POZ domain is a protein-protein interaction functional region that can recruit a variety of other auxiliary transcriptional repressors to form a transcriptional repression complex and exert a transcriptional repression effect. At present, there are few studies on the relationship between ZBTB7A and viral infection. Previous literature reported that ZBTB7A can regulate the transcription of human immunodeficiency virus (HIV). However, there are no reports on studies related to ZBTB7A and HBV infection or replication. Summary of the invention

[0004] The purpose of the present invention is to provide a use of a POK erythroid myeloid carcinogenic factor ZBTB7A in anti-hepatitis B virus in response to the above problems.

[0005] In order to achieve its purpose, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the use of ZBTB7A in any of the following:

[0007] (1) Application of ZBTB7A as a drug target in screening or preparing anti-hepatitis B virus drugs;

[0008] (2) Application of ZBTB7A as a drug target in screening or preparing drugs for treating diseases associated with hepatitis B virus infection;

[0009] (3) Use of ZBTB7A in the preparation of drugs for treating hepatitis B virus infection or diseases related to hepatitis B virus infection;

[0010] (4) Application of ZBTB7A as a host restriction factor for hepatitis B virus;

[0011] The diseases associated with hepatitis B virus infection include hepatitis B, liver cirrhosis and liver cancer.

[0012] In the above-mentioned application technology scheme, the drug is selected from one of the following: a drug using ZBTB7A protein, or its encoding gene, or a biological material containing its encoding gene as an active ingredient; a drug used to overexpress intrahepatic ZBTB7A or increase the expression level of intrahepatic ZBTB7A.

[0013] In the above-mentioned application technology solution, the biological material includes a recombinant vector and a recombinant cell line containing the ZBTB7A gene.

[0014] The second aspect of the present invention provides the use of a substance targeting ZBTB7A in the preparation of a drug for resisting hepatitis B virus or treating a disease associated with hepatitis B virus infection.

[0015] In any of the above-mentioned application technical solutions, the drug reduces the secretion of HBsAg and HBeAg, reduces the levels of HBcAg, HBV total RNA and pgRNA, and inhibits HBV transcription and replication.

[0016] In any of the above-mentioned application technical solutions, the drug promotes the expression of ZBTB7A.

[0017] A third aspect of the present invention provides a drug inhibitor for hepatitis B virus, wherein the active ingredient of the drug inhibitor comprises ZBTB7A protein, or a gene encoding the ZBTB7A protein, or a biological material containing a gene encoding the ZBTB7A protein.

[0018] In the above-mentioned drug inhibitor, the biological material is a recombinant plasmid expressing ZBTB7A, and the recombinant plasmid expressing ZBTB7A is obtained by inserting a gene encoding the ZBTB7A protein into an expression vector.

[0019] In the above-mentioned drug inhibitor, the ZBTB7A is human ZBTB7A, and its coding sequence is shown in SEQ ID NO.1.

[0020] Preferably, the drug inhibitor further comprises a pharmaceutically acceptable carrier.

[0021] The beneficial effects of the present invention are as follows: the present invention experimentally verifies that overexpression of ZBTB7A can significantly reduce the level of secreted HBV-related viral proteins and significantly inhibit HBV transcription and replication, providing a new potential target for the treatment of hepatitis B. ZBTB7A can be used as a new HBV host restriction factor, laying the foundation for the development of new antiviral drugs, and providing more effective treatment options for clinical treatment, and has broad application prospects and market potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 These are the statistical results of research data on the effect of overexpression of ZBTB7A on HBV replication in HBV-transfected Huh7 cells, including: A: the effect of overexpression of ZBTB7A on the level of HBV core antigen (HBcAg) in Huh7 cells; BC: the effect of overexpression of ZBTB7A on the secretion of HBsAg and HBeAg by Huh7 cells; D: the effect of overexpression of ZBTB7A on the levels of HBV total RNA and pgRNA in Huh7 cells; E: the effect of overexpression of ZBTB7A on the level of HBV DNA in Huh7 cells.

[0023] Figure 2 These are the statistical results of research data on the effect of overexpression of ZBTB7A on HBV replication in HBV-infected HepG2-NTCP cells, including: A: The effect of overexpression of ZBTB7A on the level of HBcAg in HepG2-NTCP cells; BC: The effect of overexpression of ZBTB7A on the secretion of HBsAg and HBeAg by HepG2-NTCP cells; D: The effect of overexpression of ZBTB7A on the levels of HBVtotal RNA and pgRNA in HepG2-NTCP cells; E: The effect of overexpression of ZBTB7A on the level of HBVDNA in HepG2-NTCP cells.

[0024] Figure 3These are the experimental results of the effect of overexpression of ZBTB7A on HBV replication in a chronic HBV replication mouse model, wherein, A: male C57BL / 6J mice were transiently injected with plasmids pAAV-HBV1.2 and Flag-ZBTB7A or empty vector pReceiver-M14 into the mouse liver by high-pressure tail vein injection to establish a chronic HBV replication mouse model; B: mouse serum samples were collected 1, 4, 7, 14 and 21 days after plasmid injection to detect the effect of overexpression of ZBTB7A on serum HBsAg and HBeAg levels at different time points; C: liver tissues were collected on the 7th and 21st days after injection for immunohistochemistry detection, and HBcAg-positive hepatocytes were counted; D: total RNA of liver tissue on the 21st day was isolated and extracted, and the effect of overexpression of ZBTB7A on HBV RNA level in mouse liver tissue was detected; E: viral nucleic acid encapsidated in liver tissue on the 21st day was isolated and extracted, and the effect of overexpression of ZBTB7A on HBV DNA level in mouse liver tissue was detected. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0026] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0027] Example 1

[0028] 1 Experimental Materials and Reagents

[0029] 1.1 Experimental Materials

[0030] Human hepatocellular carcinoma Huh7 cells and HepG2-NTCP cells, pHBV1.3 plasmid (containing 1.3 copies of HBV genome, Genbank accession NO.AY220698.1) and its empty vector control pUC19, Flag-ZBTB7A plasmid (expressing human ZBTB7A gene transcript NM_001317990.2) and its empty vector control pReceiver-M14 were purchased from Yijin Biotechnology (China) Co., Ltd.

[0031] 1.2 Experimental Reagents

[0032] 1.2.1 Preparation of main reagents

[0033] (1) 10× electrophoresis solution (1L)

[0034]

[0035] (2) 10× transfer buffer (1L)

[0036]

[0037]

[0038] (3) 5% milk blocking solution (40 mL)

[0039]

[0040] (4) 10×TBS (1L)

[0041]

[0042] 1.2.2 Main reagent sources

[0043]

[0044]

[0045] 1.2.3 Primer sequences

[0046]

[0047] The human ZBTB7A gene sequence is shown below (SEQ ID NO.1):

[0048] ATGGCCGGCGGCGTGGACGGCCCCATCGGGATCCCGTTCCCCGACCACAGCAGCGACATCCTGA

[0049] GTGGGCTGAACGAGCAGCGGACGCAGGGCCTGCTGTGCGACGTGGTGATCCTGGTGGAGGGCC

[0050] GCGAGTTCCCCACGCACCGCTCGGTGCTGGCCGCCTGCAGCCAGTACTTCAAGAAGCTGTTCAC

[0051] GTCGGGCGCCGTGGTGGACCAGCAGAACGTGTACGAGATCGACTTCGTCAGCGCCGAGGCGCTC

[0052] ACCGCGCTCATGGACTTCGCCTACACGGGCCACGCTCACCGTCAGCACAGCCAACGTGGGTGACA

[0053] TCCTCAGCGCCGCCCGCCTGCTGGAGATCCCCGCCGTGAGCCACGTGTGCGCCGACCTCCTGGA

[0054] CCGGCAGATCCTGGCGGCCGACGCGGGCGCCGACGCCGGGCAGCTGGACCTTGTAGATCAAATT

[0055] GATCAGCGCAACCTCCTCCGCGCCAAGGAGTACCTCGAGTTCTTCCAGAGCAACCCCATGAACA

[0056] GCCTGCCCCCCGCGGCCGCCGCCGCCGCTGCCAGCTTCCCGTGGTCCGCCTTTGGGGCGTCCGAT

[0057] GATGACCTGGATGCCACCAAGGAGGCCGTGGCCGCCGCTGTGGCCGCCGTGGCCGCGGGCGACT

[0058] GCAACGGCTTAGACTTCTATGGGCCGGGCCCCCCGGCCGAGCGGCCCCCGACGGGGGACGGGG

[0059] ACGAGGGCGACAGCAACCCGGGTCTGTGGCCAGAGCGGGATGAGGACGCCCCCACCGGGGGTC

[0060] TCTTTCCGCCGCCGGTGGCCCCGCCGGCCGCCACGCAGAACGGCCACTACGGCCGCGGCGGAGA

[0061] GGAGGAGGCCGCCTCGCTGTCGGAGGCGGCCCCCGAGCCGGGCGACTCTCCGGGCTTCCTGTCG

[0062] GGAGCGGCCGAGGGCGAGGACGGGGACGGGCCCGACGTGGACGGGCTGGCGGCCAGCACGCT

[0063] GCTGCAGCAGATGATGTCATCGGTGGGCCGGGCGGGGGCCGCGGCGGGGGACAGCGACGAGGA

[0064] GTCGCGGGCCGACGACAAGGGCGTCATGGACTACTACCTGAAGTACTTCAGCGGCGCCCACGAC

[0065] GGCGACGTCTACCCGGCCTGGTCGCAGAAGGTGGAGAAGAAGATCCGAGCCAAGGCCTTCCAG

[0066] AAGTGCCCCATCTGCGAGAAGGTCATCCAGGGCGCCGGCAAGCTGCCGCGACACATCCGCACCC

[0067] ACACGGGCGAGAAGCCCTACGAGTGCAACATCTGCAAGGTCCGCTTCACCAGGCAGGACAAGC

[0068] TGAAGGTGCACATGCGGAAGCACACGGGCGAGAAGCCGTACCTGTGCCAGCAGTGCGGCGCCG

[0069] CCTTTGCCCACAACTACGACCTGAAGAACCACATGCGCGTGCACACGGGCCTGCGCCCCTACCA

[0070] GTGCGACAGCTGCTGCAAGACCTTCGTCCGCTCCGACCACCTGCACAGACACCTCAAGAAAGAC

[0071] GGCTGCAACGGCGTCCCCTCGCGCCGCGGCCGCAAGCCCCGCGTCCGGGGCGGGGCGCCCGAC

[0072] CCCAGCCCGGGGGCCACCGCGACCCCCGGCGCCCCCGCCCAGCCCAGCTCCCCCGACGCCCGGC

[0073] GCAACGGCCAGGAGAAGCACTTTAAGGACGAGGACGAGGACGAGGACGTGGCCAGCCCCGAC

[0074] GGCTTGGGCCGGTTGAATGTAGCGGGCGCCGGTGGAGGAGGTGACAGCGGAGGTGGCCCCGGGGCCGCCACCGACGGTAACTTCACAGCCGGACTCGCCTAA。

[0075] 2 Experimental methods

[0076] 2.1 Detection of HBV secreted protein level in supernatant by ELISA

[0077] 2.1.1ELISA detection of supernatant HBsAg level

[0078] (1) Equilibrate the test kit to room temperature and prepare the samples to be tested in advance;

[0079] (2) Sample addition: Dilute the cell supernatant by a corresponding multiple according to the cell type, mix well, add 75 μL of sample to each well, and set up negative control, positive control, and blank control;

[0080] (3) Incubation: Seal the plate, mix well, and place in a 37°C constant temperature incubator for 1 h;

[0081] (4) Enzyme conjugate: Add 50 μL of enzyme conjugate to each well, seal the plate, mix well, and incubate in a 37°C constant temperature incubator for 30 min;

[0082] (5) Washing the plate: prepare washing solution (dilute the concentrated washing solution with ddH2O), remove the sealing film, discard the liquid, pat dry, add washing solution, let it stand for 30 seconds and then discard. Repeat this process 5 times and pat dry.

[0083] (6) Color development: Add 50 μL of color developer A and 50 μL of color developer B to each well and incubate at 37°C;

[0084] (7) Termination: Add 50 μL of stop solution to each well and mix well. Measure the absorbance (wavelength: 450 nm) using an ELISA reader and record the test data.

[0085] 2.1.2 ELISA detection of HBeAg level in supernatant

[0086] (1) Equilibrate the test kit to room temperature and prepare the samples to be tested in advance;

[0087] (2) Sample addition: Dilute the cell supernatant by a corresponding multiple according to the cell type, mix well, add 50 μL of sample to each well, and set up negative control, positive control, and blank control;

[0088] (3) Enzyme conjugate: Add 50 μL of enzyme conjugate to each well, seal the plate, mix well, and incubate in a 37°C constant temperature incubator for 30 min;

[0089] (4) Washing the plate: prepare washing solution (concentrated washing solution is diluted with ddH2O), remove the sealing film, discard the liquid, pat dry, add washing solution, let stand for 30 seconds and then discard. Repeat this process 5 times and pat dry.

[0090] (5) Color development: Add 50 μL of color developer A and 50 μL of color developer B to each well and incubate at 37°C;

[0091] (6) Stopping: Add 50 μL of stop solution to each well and mix well. Measure the absorbance (wavelength: 450 nm) using an ELISA reader and record the test data.

[0092] 2.2 Western blot assay to detect intracellular HBV protein levels

[0093] 2.2.1 Cell lysis

[0094] (1) Collect cell supernatant and wash once with PBS;

[0095] (2) Add RIPA protein lysis buffer to each well of a 12-well plate, 120 μL, and place on ice for 30 min with shaking;

[0096] (3) Transfer the lysate to a 1.5 mL EP tube and centrifuge at 4°C, 12,000 rpm, for 2 min;

[0097] 2.2.2 Detection of protein concentration by BCA method

[0098] (1) Prepare protein standards: prepare the standards according to the instructions, mix well and centrifuge immediately to a final concentration of 0.5 μg / μL; (2) Prepare BCA working solution: the volume of solution A: the volume of solution B is 50:1, and 200 μL is prepared for each blank;

[0099] (3) In a 96-well plate, add 1 μL, 2 μL, 4 μL, 8 μL, and 16 μL of protein standard to the blank wells in sequence, and make up to 20 μL with PBS. In addition, dilute each sample 5 times with PBS, i.e., add 20 μL PBS to 5 μL of the sample to be tested, and mix thoroughly;

[0100] (4) Color development: After adding the standard and the sample to be tested, add 200 μL BCA working solution to each well and incubate in a 37°C constant temperature incubator for 30 min;

[0101] (5) Detection: Measure the absorbance (wavelength: 562 nm) using an enzyme-labeled instrument and record the test data;

[0102] (6) Draw a standard curve: Draw a standard curve using the absorbance and concentration of the standard sample, calculate the concentration of the sample based on the standard curve, and make concentration adjustments.

[0103] 2.2.3 Western blot assay to detect target protein expression level

[0104] (1) Protein denaturation: Add 5× SDS-PAGE protein loading buffer by volume to the protein sample with adjusted concentration, place in a 95°C metal bath for 10 minutes, and then place on ice for 10 minutes;

[0105] (2) Gel preparation: Clean the glass plates, align and clamp the glass plates, and prepare 10%, 12%, or 15% separation gel and 5% concentration gel according to the molecular size of the target protein. Use them after they are completely solidified.

[0106] (3) Sample loading: Place the gel into the electrophoresis tank, add 1× electrophoresis buffer to the appropriate position, pull out the comb vertically, and add the corresponding protein sample;

[0107] (4) Electrophoresis: 80 V for 30 min, followed by 120 V for 1-1.5 h;

[0108] (5) Transfer: After electrophoresis, cut the gel according to the molecular weight of the target protein, then place the transfer clip with the black side facing down, and place the sponge pad, thick filter paper, gel block, PVDF membrane, thick filter paper, and sponge pad in sequence. Close the transfer clip and place it in the transfer instrument, and keep the constant current of 250 mA for 90 min.

[0109] (6) Blocking: After transfer, wash the membrane with 1× TBST for 5 minutes, add 5% milk blocking solution, and block at room temperature for one hour;

[0110] (7) Primary antibody incubation: After blocking, wash the membrane three times with 1× TBST for 5 minutes each time, cut the bands according to the target protein and add the primary antibody for incubation at 4°C overnight;

[0111] (8) Wash the membrane: Wash the membrane three times with 1× TBST, 5 min each time;

[0112] (9) Secondary antibody incubation: Add the corresponding secondary antibody according to the properties of the primary antibody for incubation at room temperature for 1 h;

[0113] (10) Wash the membrane: Wash the membrane three times with 1× TBST, 5 min each time;

[0114] (11) Development: Add an appropriate amount of ECL developer solution and drop it onto the membrane. Use the Bio-Rad gel imaging system to expose and save the data.

[0115] 2.3 Intracellular HBV RNA detection

[0116] 2.3.1 Cell RNA extraction

[0117] (1) Collect the cell supernatant and add PBS to wash the cells.

[0118] (2) Add 1 mL of Trizol reagent to each well of a 6-well plate, lyse the cells on ice for 5 min, and collect the cell lysate into a 1.5 mL EP tube.

[0119] (3) Add 100 μL of chloroform and mix vigorously for 15 seconds.

[0120] (4) Incubate at room temperature for 2-3 min and centrifuge at 12000 g for 15 min at 4°C.

[0121] (5) The aqueous phase (upper layer, about 50% of the total volume) was transferred to a new 1.5 mL EP tube, and 250 μL of isopropanol was added. After mixing, the mixture was incubated at room temperature for 10 min and centrifuged at 12,000 g for 10 min at 4°C.

[0122] (6) Discard the supernatant and add 100 μL 75% ethanol to wash the RNA precipitate twice.

[0123] (7) Centrifuge at 7500 g for 5 min at 4°C, aspirate the supernatant, and allow the pellet to air-dry.

[0124] (8) Add 15 μL of DEPC water to dissolve the precipitate and mix the sample.

[0125] 2.3.2 Real-time RT-qPCR to detect HBV RNA levels

[0126] (1) Sample dilution: Dilute the extracted RNA template to 100 ng / μL.

[0127] (2) Preparation of RT-PCR reaction system:

[0128]

[0129] (3) PCR reaction conditions

[0130]

[0131] (4) Result calculation and analysis: Statistics and calculations were performed based on the Realtime RT-qPCR results.

[0132] 2.4 Intracellular HBV DNA detection

[0133] 2.4.1 Extraction of intracellular HBV EcDNA (encapsidated DNA)

[0134] (1) Collect the cell supernatant and wash once with PBS.

[0135] (2) Add 800 μL of lysis buffer to each well of a 6-well plate and place on ice for 10 min.

[0136] (3) Collect the cell lysate into a 2 mL EP tube (blown away with a pipette tip), vortex on a vortex shaker for 15 seconds, and then incubate on ice for 10 minutes.

[0137] (4) Centrifuge at 13200 rpm for 2 min in a 4°C centrifuge.

[0138] (5) Transfer the supernatant to a new 2 mL EP tube, add 8 μL MgCl2 (1 M) and 8 μL DNase I (10 mg / mL), invert and mix 3-4 times, then centrifuge briefly and incubate in a 37°C water bath for 30 min.

[0139] (6) After incubation, add 40 μL 0.5 M EDTA (pH 8.0) and mix by inversion.

[0140] (7) Centrifuge the sample quickly, add 80 μL 10% SDS, and vortex to mix.

[0141] (8) The sample was centrifuged quickly and 20 μL of proteinase K (20 mg / mL) was added.

[0142] (9) Incubate in a 55°C water bath for 2 h. Mix the sample during the incubation process.

[0143] (10) According to the ratio of 1:1 between the volume of supernatant and DNA extraction solution, 900 μL of DNA extraction reagent was added, vortexed and allowed to stand for 2 min, and then centrifuged at 13000 rpm for 10 min at room temperature.

[0144] (11) Pipette the supernatant into a new 2 mL EP tube, add 0.7 times the volume of isopropanol, 100 μL of 3 M sodium acetate (pH 5.2), and 2 μL of yeast RNA, and place in a -20 °C refrigerator for precipitation overnight.

[0145] (12) After centrifugation at 13200 rpm for 15 min at 4°C, the supernatant was discarded, 1 mL of 75% ethanol was added to gently wash the precipitate twice, and then centrifuged at 8000 rpm for 5 min at room temperature.

[0146] (13) Discard the supernatant and air-dry the DNA pellet for 5 min.

[0147] (14) Add 15 μL of 1× TE buffer to dissolve the extracted DNA precipitate and mix the sample.

[0148] 2.4.2 Quantitative PCR (qPCR) detection of HBV DNA levels

[0149] (1) Sample dilution: prepare a 200 μL EP tube, then add 8 μL 1×TE buffer and 2 μL HBV DNA sample; (2) Prepare standard: prepare a new 1.5 mL EP tube, add 45 μL sterile ddH2O to each tube, and pipette 5 μL standard (10 9 copies / μL) into the first EP tube, oscillate and mix well, and repeat the operation to dilute in multiples of 10 3-10 8 copies / μL concentration gradient;

[0150] (3) Preparation of PCR reaction system

[0151]

[0152] (4) PCR reaction conditions

[0153]

[0154] (5) PCR result calculation: Calculate the sample copy number according to the standard curve and the corresponding dilution factor.

[0155] 2.5 Chronic HBV replication mouse model

[0156] 2.5.1 Construction of a chronic HBV replication mouse model

[0157] (1) Preparation of experimental animals: All animal experiments were approved by the Ethics Committee of Chongqing Medical University (ethics number 2022081). This study was conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals and in accordance with the regulations of the People's Republic of China;

[0158] (2) Grouping: Weigh the purchased C57BL / 6J male mice, and select mice weighing about 20 g for the experiment. First, the mice were randomly divided into two groups: a ZBTB7A overexpression experimental group and a pReceiver-M14 control group;

[0159] (3) High-pressure tail vein injection: dilute the constructed pAAV-HBV1.2 plasmid and Flag-ZBTB7A overexpression plasmid or pReceiver-M14 empty vector plasmid with physiological saline, and inject 2 ml of plasmid dilution (containing 10 μg pAAV-HBV1.2 plasmid and 10 μg Flag-ZBTB7A plasmid or pReceiver-M14 empty vector control) into each mouse through high-pressure tail vein injection to establish a chronic HBV replication mouse model overexpressing the ZBTB7A gene;

[0160] (4) Orbital blood collection: Mouse serum was collected on days 1, 4, 7, 14, and 21 after injection. Mouse liver samples were collected at designated time points;

[0161] (5) Sample preservation: Mouse serum was centrifuged at 8000 rpm for 10 min at room temperature, and the supernatant was aspirated and stored in a -20°C refrigerator. In addition, liver tissue samples were preserved in 4% tissue cell fixative (immunohistochemical detection of HBcAg expression in the liver), and the remaining mouse liver tissues were stored in a -80°C refrigerator for future use.

[0162] 2.5.2 Extraction of HBV RNA from hepatocytes

[0163] The total RNA in mouse liver tissue was extracted using RNAprep Pure Animal Tissue Total RNA Extraction Kit (spin column type) (Tiangen Biochemical Technology, DP431).

[0164] 2.5.3 Extraction of HBV DNA from hepatocytes

[0165] (1) Accurately weigh 60 mg of liver tissue and add 600 μL of pre-cooled 1×TE buffer (pH 8.0) and grind thoroughly;

[0166] (2) Add 5 μL NP-40 (final concentration 0.5%) and incubate on ice for 30 min;

[0167] (3) Centrifuge at 14000 rpm for 1 min at 4°C, transfer the supernatant to a new 2 mL EP tube, add 5 μL 1 M MgCl2 (final concentration 5 mM) and 8 μL 10 mg / ml DNase I, and incubate at 37°C for 30 min;

[0168] (4) Add 20 μL 0.5 M EDTA (final concentration 10 mM);

[0169] (5) Add 100 μL 10% SDS (final concentration 1%) and 30 μL 20 mg / mL Proteinase K (final concentration 0.5 mg / mL) and incubate at 55°C for 2 h;

[0170] (6) Add an equal volume of phenol / chloroform (500 μL:500 μL, 1:1) and vortex to mix. Centrifuge at 14,000 rpm for 8 min at room temperature;

[0171] (7) Transfer the upper layer to a new 2 mL EP tube, then add 700 μL of isopropanol, 100 μL of 3 M NaAc (pH 5.2), and 2 μL of tRNA (10 mg / mL), and place in a -20 °C refrigerator for precipitation overnight;

[0172] (8) After taking the sample out of the refrigerator, centrifuge it at 14,000 rpm for 15 min at 4°C and discard the supernatant;

[0173] (9) Add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 14,000 rpm at 4°C for 5 min, and wash twice;

[0174] (10) Discard the supernatant, let the tube air dry for 5 minutes, and then dissolve the precipitate in 15 μL 1× TE buffer.

[0175] 2.5.4 Immunohistochemical staining (Wuhan Sewell Biotechnology)

[0176] (1) Dewaxing of paraffin sections: Place the sections in dewaxing solution I, dewaxing solution II, and dewaxing solution III for 10 min, then place them in anhydrous ethanol I (5 min), anhydrous ethanol II (5 min), and anhydrous ethanol III (5 min), and wash with distilled water;

[0177] (2) Antigen retrieval: After natural cooling, the slides were placed in PBS and washed three times on a decolorizing shaker, each time for 5 min.

[0178] (3) Blocking endogenous peroxidase: Incubate the slides in 3% hydrogen peroxide solution in the dark for 25 min, then decolorize in PBS and wash on a shaker three times, 5 min each time;

[0179] (4) Blocking: Cover the slides with 3% BSA and block at room temperature for 30 min;

[0180] (5) Primary antibody incubation: Drain the blocking solution, add the prepared primary antibody onto the slices, and incubate the slices flat in a humidified chamber at 4°C overnight.

[0181] (6) Secondary antibody incubation: Wash the slides in PBS on a shaker three times for 5 min each, then add a secondary antibody (HRP-labeled) of the same species as the primary antibody and incubate at room temperature for 50 min.

[0182] (7) DAB color development: Wash the slides in PBS three times, 5 min each time. Add freshly prepared DAB color development solution and control the color development time under a microscope. The positive color is brown-yellow. Rinse the slides with tap water to stop the color development.

[0183] (8) Counterstaining of cell nuclei: Counterstain with hematoxylin for about 3 minutes, rinse with tap water, differentiate with hematoxylin differentiation solution for a few seconds, rinse with tap water, blue with hematoxylin bluing solution, and rinse with running water;

[0184] (9) Dehydration and sealing: Place the slices in 75% alcohol for 5 min, 85% alcohol for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, n-butanol for 5 min, and xylene I for 5 min to dehydrate and make them transparent. Take the slices out of xylene, let them dry slightly, and seal them with sealing glue.

[0185] 3 Experimental results

[0186] 3.1 Effect of overexpression of ZBTB7A on HBV replication in HBV-transfected Huh7 cells

[0187] Huh7 cells were co-transfected with 1 μg of HBV expression plasmid pHBV1.3 and 1 μg of Flag-ZBTB7A plasmid or its empty vector control pReceiver-M14.

[0188] 72h after transfection, the total HBcAg expression level in the cell lysate was detected by Western blot using anti-HBc (kindly donated by Professor Cai Xuefei of Chongqing Medical University); the experimental results are shown in Figure 1 As shown in A, overexpression of ZBTB7A can significantly reduce the intracellular HBcAg level. The cell supernatant was collected and the hepatitis B virus surface antigen (HBsAg) diagnostic kit (enzyme-linked immunosorbent assay; Shanghai Kehua, SI0910113) and hepatitis B virus e antigen (HBeAg) diagnostic kit were used to detect the levels of HBsAg and HBeAg secreted in the cell supernatant. The experimental results are shown in Figure 1 B and Figure 1 As shown in Figure C, overexpression of ZBTB7A can significantly inhibit the secretion of HBsAg and HBeAg. The effect of overexpression of ZBTB7A on the levels of intracellular HBV total RNA and pgRNA was detected by Realtime RT-qPCR (TaKaRa, RR086A). Figure 1 As shown in Figure D, overexpression of ZBTB7A can significantly reduce the levels of intracellular HBV total RNA and pgRNA. The effect of overexpression of ZBTB7A on the level of intracellular HBV DNA was detected by Realtime qPCR (TaKaRa, RR820A). Figure 1 As shown in Figure E, overexpression of ZBTB7A can significantly reduce the level of intracellular HBV DNA. The above experimental results show that in the HBV-transfected cell system, ZBTB7A can significantly inhibit HBV transcription and replication. 3.2 Study on the effect of overexpression of ZBTB7A on HBV replication level in HBV-infected HepG2-NTCP cells

[0189] Two days before HBV infection, HepG2-Tet On-NTCP cells pretreated with doxycycline were seeded in 12-well cell culture plates treated with type I collagen. One day before HBV infection, cells were incubated with 700 μL of William's E complete medium (Procell, PM151221) + 4% PEG8000 + HBV virus suspension (MOI: 1000) for 24 h. 24 h after HBV infection, the cells were transfected with Flag-ZBTB7A plasmid or its empty vector control pReceiver-M14. 4-6 h after transfection, the old medium was replaced with 1 ml of fresh William's E complete medium. 72 h after HBV infection, cells were washed 3 times with PBS, and then the old medium was replaced with 1 ml of fresh William's E complete medium.

[0190] On the 5th day after HBV infection, the total HBcAg expression level in the cell lysate was detected by Western blot. Figure 2 As shown in A, overexpression of ZBTB7A can significantly reduce the level of intracellular HBcAg. The cell supernatant was collected and the HBsAg and HBeAg levels secreted in the cell supernatant were detected using the HBsAg diagnostic kit and the HBeAg diagnostic kit. The experimental results are shown in Figure 2 B and Figure 2 As shown in C, overexpression of ZBTB7A can significantly reduce the levels of secreted HBsAg and HBeAg. The effect of overexpression of ZBTB7A on the levels of intracellular HBV total RNA and pgRNA was detected by Realtime RT-qPCR. Figure 2 As shown in Figure D, overexpression of ZBTB7A can significantly reduce the levels of intracellular HBV total RNA and HBV pgRNA. The effect of overexpression of ZBTB7A on the level of intracellular HBV DNA was detected by Realtime qPCR. Figure 2 As shown in E, overexpression of ZBTB7A can significantly reduce the intracellular HBV DNA level. The above experimental results show that in the HBV-infected cell system, ZBTB7A can significantly inhibit HBV transcription and replication.

[0191] 3.3 Effect of overexpression of ZBTB7A on HBV replication in a chronic HBV infection mouse model

[0192] Plasmids pAAV-HBV1.2 and Flag-ZBTB7A (10 mice in the experimental group) or empty control pReceiver-M14 (10 mice in the control group) were rapidly introduced into 8-week-old C57BL / 6J male mice by high-pressure tail vein injection. Serum samples were collected from mice on days 1, 4, 7, 14 and 21 after plasmid injection, and liver tissue samples were collected from mice on days 7 and 21 after injection.

[0193] like Figure 3 As shown in A, serum samples of mice were collected 1, 4, 7, 14 and 21 days after plasmid injection, and the serum HBsAg and HBeAg levels at each time point were detected by ELISA. Figure 3 As shown in B, overexpression of ZBTB7A significantly reduced the levels of HBsAg and HBeAg secreted in mouse serum. On the 7th and 21st days after plasmid injection, mouse liver tissues were collected for immunohistochemistry detection: mouse liver tissue sections were incubated with rabbit anti-HBc antibody and goat anti-rabbit IgG secondary antibody, and HBcAg-positive hepatocytes were counted (magnification 200). The experimental results are shown in Figure 3As shown in Figure C, overexpression of ZBTB7A significantly reduced the level of HBcAg in mouse liver tissue and the number of HBcAg-positive hepatocytes. The effect of overexpression of ZBTB7A on the levels of HBV total RNA and pgRNA in mouse liver tissue was detected by Realtime RT-qPCR. Figure 3 As shown in D, overexpression of ZBTB7A significantly reduced the levels of HBV total RNA and pgRNA in mouse liver tissue. The effect of overexpression of ZBTB7A on the level of HBV DNA in mouse liver tissue was detected by Realtime qPCR. Figure 3 As shown in E, overexpression of ZBTB7A can significantly reduce the level of HBV DNA in mouse liver tissue.

[0194] The above experimental results show that ZBTB7A can significantly inhibit HBV transcription and replication in the chronic HBV replication mouse model.

[0195] In summary, the present invention has verified in HBV transfection and infection systems and chronic HBV replication mouse models that overexpression of ZBTB7A can significantly reduce the levels of secreted HBsAg and HBeAg, reduce the level of intracellular HBcAg, and significantly inhibit HBV transcription and replication. The present invention provides a new potential target for the treatment of hepatitis B and more effective treatment options for clinical treatment, with broad application prospects and market potential.

Claims

1. Application of ZBTB7A in any of the following: (1) Application of ZBTB7A as a drug target in screening or preparing anti-hepatitis B virus drugs; (2) Application of ZBTB7A as a drug target in screening or preparing drugs for treating diseases associated with hepatitis B virus infection; (3) Use of ZBTB7A in the preparation of drugs for treating hepatitis B virus infection or diseases related to hepatitis B virus infection; (4) Application of ZBTB7A as a host restriction factor for hepatitis B virus; The diseases associated with hepatitis B virus infection include hepatitis B, liver cirrhosis and liver cancer.

2. The use according to claim 1, characterized in that: The drug is selected from one of the following: a drug using ZBTB7A protein, or its encoding gene, or a biological material containing its encoding gene as an active ingredient; a drug used to overexpress ZBTB7A in the liver or to increase the expression level of ZBTB7A in the liver.

3. The use according to claim 2, characterized in that: The biological material includes a recombinant vector and a recombinant cell line containing the ZBTB7A gene.

4. Use of substances targeting ZBTB7A in the preparation of drugs for resisting hepatitis B virus or treating diseases related to hepatitis B virus infection.

5. The use according to any one of claims 1 to 4, characterized in that: The drug reduces the secretion of HBsAg and HBeAg, reduces the levels of HBcAg, HBV total RNA and pgRNA, and inhibits HBV transcription and replication.

6. The use according to any one of claims 1 to 4, characterized in that: The drug promotes the expression of ZBTB7A.

7. A drug inhibitor of hepatitis B virus, characterized in that: The active ingredient of the drug inhibitor comprises ZBTB7A protein, or its encoding gene, or biological material containing its encoding gene.

8. The drug inhibitor according to claim 7, characterized in that The biological material is a recombinant plasmid expressing ZBTB7A, and the recombinant plasmid expressing ZBTB7A is obtained by inserting a gene encoding the ZBTB7A protein into an expression vector.

9. The drug inhibitor according to claim 7, characterized in that The ZBTB7A is human ZBTB7A, and its coding sequence is shown in SEQ ID NO.

1.

10. The drug inhibitor according to claim 7, characterized in that The drug inhibitor also includes a pharmaceutically acceptable carrier.

Images