Yuxianglan traditional Chinese medicine compound essential oil and its application in preparing products for preventing and treating obesity

Abstract

The present invention provides a traditional Chinese medicine compound essential oil of yuxianglan and its application in the preparation of products for preventing and treating obesity, and relates to the technical field of traditional Chinese medicine essential oils. The traditional Chinese medicine compound essential oil is made of turmeric essential oil, cyperus rotundus essential oil and gynostemma pentaphyllum essential oil. The traditional Chinese medicine compound essential oil of yuxianglan provided by the present invention, which is administered by inhalation, can significantly reduce the weight gain of obese mice induced by a high-fat diet and inhibit fat production; it can effectively reduce the levels of triglycerides, cholesterol and HDL in obese mice induced by a high-fat diet, and increase the level of LDL, and has the effect of improving the hyperlipidemia symptoms of obese mice, improving the liver's ability to transport phospholipids and cholesterol, and eliminating cholesterol in peripheral blood vessels, thereby regulating lipid metabolism function; at the same time, the traditional Chinese medicine compound essential oil of yuxianglan provided by the present invention can achieve the effect of repairing the intestinal flora disorder caused by a high-fat diet, and restore the intestinal ecological balance of obese mice. The traditional Chinese medicine compound essential oil of yuxianglan provided by the present invention has great application prospects in the treatment or prevention of obesity-related diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of traditional Chinese medicine essential oils, and in particular to a traditional Chinese medicine compound essential oil of euphorbia milii and an application thereof in preparing products for preventing and treating obesity. Background Art

[0002] Overweight and obese patients experience excessive accumulation of triglycerides (TG) in their serum, leading to mild or severe liver inflammation, which increases their risk of coronary artery disease, hypertension, respiratory problems, obstructive sleep apnea, osteoarthritis, and gallstones. Currently, most FDA-approved obesity treatments are administered by injection, resulting in poor patient compliance and side effects such as gastrointestinal discomfort, vomiting, anxiety, and depression. Therefore, the search for new medications that can combat obesity while minimizing side effects has been a research hotspot.

[0003] Traditional Chinese medicine essential oils are volatile, aromatic, and fat-soluble substances extracted from traditional Chinese medicinal plants. They typically exist as small molecules such as terpenes, alcohols, ketones, aldehydes, and esters. They possess low molecular weight, strong lipid solubility, high absorbability, and high permeability, allowing them to easily enter the microcirculation and tissue cells of living organisms. They exhibit biological activities such as anti-tumor, antiviral, tranquilizing, antioxidant, lipid metabolism, and immune regulation. Furthermore, aromatherapy derived from essential oils encompasses a variety of administration methods, including application, rubbing, gargling, bathing, and inhalation. Aromatherapy can influence metabolism through the mouth, nose, and skin, ultimately achieving the therapeutic effect of obesity. Currently, many traditional Chinese medicine essential oils have been shown to have anti-fatty liver and obesity effects. However, most studies have focused on single essential oils, which suffer from limitations such as limited mechanisms of action and limited efficacy. Therefore, it is crucial to identify traditional Chinese medicine essential oil compounds with clear actions, significant efficacy, and measurable effects on weight loss and lipid metabolism. Summary of the Invention

[0004] (1) Technical problems solved

[0005] In view of the deficiencies in the prior art, the present invention provides a traditional Chinese medicine compound essential oil of Yuxianglan and its application in the preparation of products for preventing and treating obesity.

[0006] (2) Technical solution

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0008] On the one hand, the present invention provides a traditional Chinese medicine compound essential oil of Curcuma aromatica. The traditional Chinese medicine compound essential oil is prepared from Curcuma aromatica essential oil, Cyperus rotundus essential oil and Gynostemma pentaphyllum essential oil.

[0009] Furthermore, the traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.1-2 parts of turmeric essential oil, 0.1-3 parts of cyperus rotundus essential oil, and 0.1-3 parts of gynostemma pentaphyllum essential oil.

[0010] Furthermore, the traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.1-1 parts of turmeric essential oil, 0.5-2 parts of cyperus rotundus essential oil, and 0.5-2 parts of gynostemma pentaphyllum essential oil.

[0011] Furthermore, the traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, and 1 part of gynostemma pentaphyllum essential oil.

[0012] The single essential oils of the above ingredients are commercially available or obtained by conventional extraction methods, with a purity of more than 99%.

[0013] On the other hand, the present invention also provides the use of the indigofera traditional Chinese medicine compound essential oil in the preparation of products for preventing and / or improving and / or alleviating and / or treating obesity.

[0014] The product is a medically acceptable external preparation for aromatherapy.

[0015] (3) Beneficial effects

[0016] The present invention provides a traditional Chinese medicine compound essential oil made from turmeric essential oil, cyperus rotundus essential oil, and gynostemma pentaphyllum essential oil, and studies the application prospects of the above-mentioned traditional Chinese medicine compound essential oil in treating or preventing obesity-related diseases. Animal experimental results show that the traditional Chinese medicine compound essential oil of turmeric provided by the present invention, administered by inhalation, can significantly reduce the weight gain of obese mice induced by a high-fat diet and inhibit fat production; it can effectively reduce the levels of triglycerides, cholesterol, and HDL in obese mice induced by a high-fat diet, and increase the level of LDL, which has the effect of improving the hyperlipidemia symptoms of obese mice, improving the liver's ability to transport phospholipids and cholesterol, and eliminating cholesterol in peripheral blood vessels, thereby regulating lipid metabolism function; at the same time, the traditional Chinese medicine compound essential oil of turmeric provided by the present invention can achieve the effect of repairing the intestinal flora disorder caused by a high-fat diet, and restore the intestinal ecological balance of obese mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Effects of different formulas of compound essential oils on the body weight of obese model mice; A is the weight change of mice in each group during the experiment; B is the weight result of mice in each group at the end of the experiment; C is the decimal liver index of each group; compared with the HFD group, *P<0.05, **P<0.01.

[0018] Figure 2 The figure shows the effect of the Chinese herbal compound essential oil of the present invention on the body weight of obese mice; A is the food intake of each group of mice during the experiment; B is the weight gain of each group of mice during the experiment and the weight of each group of mice at the end of the experiment; C is the liver weight and liver index of each group of mice; compared with the HFD group, *P<0.05, **P<0.01, **P<0.001.

[0019] Figure 3 The figures show the effects of the traditional Chinese medicine compound essential oil of the present invention on TC, TG, HDL and LDL in the serum and liver of obese mice; compared with the HFD group, *P<0.05, **P<0.01, **P<0.001.

[0020] Figure 4 The results of HE staining and Oil Red staining of liver tissues of mice in each group.

[0021] Figure 5 The gene expression results of fat metabolism-related factors in the liver tissue of mice in each group; compared with the HFD group, *P<0.05, **P<0.01, ***P<0.001.

[0022] Figure 6 The results show the effect of the indigofera traditional Chinese medicine compound essential oil on the intestinal flora of obesity model mice. DETAILED DESCRIPTION

[0023] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0024] Example 1

[0025] The invention discloses a traditional Chinese medicine compound essential oil of turmeric. The compound essential oil is prepared from the following raw materials in parts by weight: 0.1 part of turmeric essential oil, 0.5 part of cyperus rotundus essential oil, and 0.5 part of gynostemma pentaphyllum essential oil.

[0026] The single essential oils of the above ingredients are commercially available or obtained by conventional extraction methods, with a purity of more than 99%.

[0027] The Yuxianglan traditional Chinese medicine compound essential oil is used to prepare a product for preventing and / or improving and / or alleviating and / or treating obesity. The product is a medically acceptable external preparation for aromatherapy.

[0028] Example 2

[0029] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 2 parts of Curcuma essential oil, 3 parts of Cyperus rotundus essential oil, and 3 parts of Gynostemma pentaphyllum essential oil.

[0030] Example 3

[0031] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 1.2 parts of cyperus rotundus essential oil, and 1.4 parts of gynostemma pentaphyllum essential oil.

[0032] Example 4

[0033] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 1.6 parts of turmeric essential oil, 2.8 parts of cyperus rotundus essential oil, and 2.4 parts of gynostemma pentaphyllum essential oil.

[0034] Example 5

[0035] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 0.8 parts of cyperus rotundus essential oil, and 0.6 parts of gynostemma pentaphyllum essential oil.

[0036] Example 6

[0037] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 0.8 parts of turmeric essential oil, 1.2 parts of cyperus rotundus essential oil, and 1.4 parts of gynostemma pentaphyllum essential oil.

[0038] Example 7

[0039] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 0.4 parts of turmeric essential oil, 0.8 parts of cyperus rotundus essential oil, and 1.2 parts of gynostemma pentaphyllum essential oil.

[0040] Example 8

[0041] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 1.5 parts of cyperus rotundus essential oil, and 0.5 parts of gynostemma pentaphyllum essential oil.

[0042] Example 9

[0043] The difference between this embodiment and embodiment 1 is that the Chinese herbal compound essential oil is made from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, and 1 part of gynostemma pentaphyllum essential oil.

[0044] Test Example 1

[0045] 1 Experimental animals

[0046] C57 / Bl6J mice were a standard strain, 7 weeks old, weighing (20 ± 1) g, and housed in a room with controlled temperature and humidity, a 12-h light / dark cycle, free access to food and water, and fed a standard laboratory diet (Cat. No. 1010001, a product of Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.). Experiments were performed after one week of acclimatization.

[0047] 2 Experimental drugs

[0048] Compound essential oil 1: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil

[0049] Compound essential oil 2: 0.5 parts of turmeric essential oil, 1 part of Gynostemma pentaphyllum essential oil

[0050] Compound essential oil 3: 1 part Cyperus rotundus essential oil, 1 part Gynostemma pentaphyllum essential oil

[0051] Compound essential oil 4: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, 1 part of gynostemma pentaphyllum essential oil

[0052] Compound essential oil 5: 0.5 parts of rhubarb essential oil, 1 part of cyperus rotundus essential oil, 1 part of gynostemma pentaphyllum essential oil

[0053] According to the above formula, the single essential oils are mixed evenly and refrigerated for later use; the above single essential oils are obtained by carbon dioxide extraction using Curcuma aromatica, Cyperus rotundus and Gynostemma pentaphyllum as raw materials, and the purity is above 99%.

[0054] 3 Experimental methods

[0055] Forty-two C57 / Bl6J mice, after one week of acclimation, were randomly assigned to cages of six per cage and then divided into seven groups: a control diet (NC), a high-fat diet (HFD), a high-fat diet combined with a compound essential oil (experimental group F1), a high-fat diet combined with a compound essential oil (experimental group F2), a high-fat diet combined with a compound essential oil (experimental group F3), a high-fat diet combined with a compound essential oil (experimental group F4), and a high-fat diet combined with a compound essential oil (experimental group F5). The essential oil group received 10 μL of the corresponding compound essential oil once daily by applying it to the sides of the nose; the HFD group received saline instead. Both the HFD and essential oil groups continued to be fed a high-fat diet (D12492, Research Diets) for the duration of the experiment, with free access to food and water, for 8 weeks.

[0056] 4 Observation indicators

[0057] The weight gain of mice in each group was recorded during the experiment. After the experiment, the mice were killed by cervical dislocation. The livers were weighed and the liver index was calculated.

[0058] 5 Statistical methods

[0059] Data were collected and analyzed using Prism software and presented as mean ± standard error (x ± SEM). One-way ANOVA was used for analysis of significance between groups. P < 0.05 indicated statistical significance, and P < 0.01 indicated statistically significant differences. Quantitative experiments were performed in triplicate, and results were averaged unless otherwise noted.

[0060] 6 Results

[0061] During the experiment, the weight changes of mice in each group were as follows: Figure 1 As shown in A, compared with the NC group, the weight gain rate of mice in the HFD group was significant, indicating that the obesity model was successfully established; compared with the HFD group, the weight gain of mice in the F1-F5 groups slowed down, among which the weight gain rate of mice in the F4 group was the slowest, which was equivalent to the weight gain rate of mice in the NC group; the weight gain rate of mice in the F1-F3 groups was significantly higher than that of the F4 group; the weight gain rate of mice in the F5 group was significantly higher than that of the F4 group, which was equivalent to the weight gain rate of mice in the F3 group.

[0062] The body weights of mice in each group at the end of the experiment were as follows: Figure 1 As shown in B, compared with the NC group, the weight of mice in the HFD group was significantly higher than that in the NC group, with a significant difference (P<0.05); compared with the HFD group, the weight of mice in the F1-F5 groups was significantly lower than that in the HFD group, among which the weight of mice in the F4 group was significantly lower than that in the HFD group (P<0.05), and there was no significant difference compared with the NC group (P>0.05). Although the weight of mice in the F1-F3 groups was significantly lower than that in the HFD group, it was still higher than that in the F4 group. In addition, the weight of mice in the F5 group was comparable to that of mice in the F3 group, with no significant difference (P>0.05).

[0063] The liver index results of mice in each group are as follows Figure 1 As shown in C, compared with the NC group, the liver index of mice in the HFD group was significantly higher than that in the NC group, with significant differences (P<0.05); compared with the HFD group, the liver index of mice in groups F1-F5 decreased to varying degrees, among which the liver index of mice in group F4 was significantly lower than that in the HFD group (P<0.05), and had no significant difference compared with NC (P>0.05). Although the liver index of mice in groups F1-F3 was significantly lower than that in the HFD group, it was still higher than that in the F4 group (P<0.05).

[0064] The above results indicate that the Yuxianglan Chinese herbal compound essential oil provided by the present invention can significantly reduce the body weight of obese model mice and reduce the liver index of obese model mice, and has great application prospects in the field of fat and weight loss. In addition, the above experimental results show that the three components of the Chinese herbal compound essential oil provided by the present invention, Curcuma aromatica, Cyperus rotundus, and Gynostemma pentaphyllum, synergistically enhance each other. After reducing any one component and replacing it with another component, the technical effect of reducing the body weight and liver index of obese model mice cannot be achieved.

[0065] Test Example 2

[0066] 1 Experimental animals

[0067] C57 / Bl6J mice were a standard strain, 7 weeks old, weighing (20 ± 1) g, and housed in a room with controlled temperature and humidity, a 12-h light / dark cycle, free access to food and water, and fed a standard laboratory diet (Cat. No. 1010001, a product of Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.). Experiments were performed after one week of acclimatization.

[0068] 2 Experimental Essential Oils

[0069] 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, and 1 part of gynostemma pentaphyllum essential oil are uniformly mixed according to the above parts by weight and refrigerated for later use; the above single essential oils are obtained by carbon dioxide extraction using turmeric, cyperus rotundus, and gynostemma pentaphyllum as raw materials, and the purity is above 99%.

[0070] 3 Animal grouping and treatment

[0071] Thirty-two C57 / Bl6J mice, after one week of acclimation, were randomly assigned to cages of eight mice per cage. The mice were then randomly divided into four groups: a control diet (NC), a high-fat diet (HFD), a high-fat diet combined with a low-dose compound essential oil (YXL-L, 5 μL / mouse), and a high-fat diet combined with a high-dose compound essential oil (YXL-H, 10 μL / mouse). Essential oils were administered once daily by sniffing the nose; saline was used instead in the HFD group. The HFD, essential oil, and positive control groups continued to be fed a high-fat diet (D12492, Research Diets) for the duration of the experiment, with free access to food and water for eight weeks.

[0072] Two days before the end of the experiment, fresh feces were collected from each mouse and immediately frozen at -80°C. Mice were sacrificed by cervical dislocation. Blood was centrifuged to obtain serum. Liver and epididymal fat were collected and immediately placed in liquid nitrogen and stored at -80°C for further analysis. The liver was weighed and divided into three pea-sized portions for subsequent qPCR verification of the expression of genes related to fat metabolism. Portions of the fat and liver were prepared for HE sectioning to observe pathological changes.

[0073] 4 Detection indicators

[0074] 4.1 Determination of serum and liver TC, TG, HDL, LDL, etc.

[0075] Whole blood was centrifuged at 2500 rpm / min for 10 minutes to collect serum, and the serum was quantified according to the manufacturer's kit (Nanjing Jiancheng Bioengineering Institute).

[0076] 4.2 Pathological examination of mouse liver and adipose tissue

[0077] Mouse liver and epididymal tissues were fixed in formalin for 24 hours, dehydrated, embedded, stained, and finally imaged under a microscope.

[0078] 4.3 Detection of gene expression levels related to fat metabolism in mouse liver

[0079] The liver was taken out and stored in -80℃ ultra-low temperature freezer, 20mg of tissue was weighed, total RNA was extracted, reverse transcribed into cDNA using reverse transcription kit, and fluorescent quantitative PCR amplification was performed using cDNA as template. GAPDH was used as internal reference and 2 -ΔΔCT The mNRA expression of related genes was calculated by the method.

[0080] The primer sequences are as follows

[0081] Gene Upstream primer Downstream primer Ppara TTTCACAAGTGCCTGTCTGTCG TCTTCAGGTAGGCTTCGTGGAT Cyp7a1 GCTAAGGAGGACTTCACTCTACACC TGGTCTTTGCTTTCCCACTTTC Cpt1a GCCTCTATGTGGTGTCCAAGTATC CACCATAGCCGTCATCAGCAA Cox7A1 AACAGGTCTCCCAGGCTCT TCTGCTTCTCTGCCACACG SCD-1 GTTAGCACCTTCTTGCGATACACT GTGAAGTTGATGTGCCAGCG FAS CTGCCTCTGGTGCTTGCT ACCCGCCTCCTCAGCTTT PPAR-γ GACCACTCGCATTCCTTTGA CCACAGACTCGGCACTCAAT Cidea TGCACAGATGACGGGACAG GTGCTAGGCTTGGGGGATG GAPDH CCTCGTCCCGTAGACAAAATG TGAGGTCAATGAAGGGGTCGT

[0082] Note: PPAR-α: peroxisome proliferator-activated receptor α; PPAR-γ: peroxisome proliferator-activated receptor gamma; CYP7A1: cholesterol 7-alpha hydroxylase; CPT-1: carnitine palmitoyltransferase 1; Cox7A1: cytochrome C oxidase subunit 7A1; FAS: fatty acid synthase; SCD-1: stearoyl-CoA desaturase-1; Cidea: apoptosis-inducing DFF45-like effector A; GAPDH: 3-phosphate dehydrogenase.

[0083] 5 Statistical methods

[0084] Data were collected and analyzed using Prism software and presented as mean ± standard error (x ± SEM). One-way ANOVA was used for analysis of significance between groups. P < 0.05 indicated statistical significance, and P < 0.01 indicated statistically significant differences. Quantitative experiments were performed in triplicate, and results were averaged unless otherwise noted.

[0085] 6 Results

[0086] 6.1 Effect of the Traditional Chinese Medicine Essential Oil of the Present Invention on Body Weight in Obese Mice

[0087] like Figure 2 As shown in A, there was no significant difference in the food intake of mice in each group during the experiment (P>0.05). Figure 2 As shown in B, compared with the NC group, the body weight of mice in the HFD group increased significantly, and the difference was extremely significant (P<0.001); compared with the HFD group, the body weight of mice in the YXL-H, YXL-L and EXP groups decreased significantly (P<0.001 or P<0.05).

[0088] like Figure 2 As shown in C, compared with those in the NC group, the liver weight and liver index of mice in the HFD group were significantly increased, with extremely significant differences (P<0.001). Compared with the HFD group, the liver weight of the YXL-H group was significantly decreased (P<0.05), and the liver index was significantly decreased (P<0.01). The liver weight and liver index of the YXL-L group were both significantly decreased (P<0.05).

[0089] 6.2 Effects of the Traditional Chinese Medicine Essential Oil of the Present Invention on Serum and Liver Biochemical Indices in Obese Mice

[0090] like Figure 3 As shown in the results, compared with the NC group, the HFD group had significantly increased TC and TG levels in the serum and liver, significantly decreased HDL (P<0.001), and significantly increased LDL (P<0.001). Compared with the HFD group, the YXL-H group had significantly decreased TC and TG levels in the serum and liver, significantly increased HDL (P<0.001), and significantly decreased LDL (P<0.001). In the YXL-L group, the serum TC level and the TC and TG levels in the liver were significantly decreased (P<0.001), the serum TG level was significantly decreased (P<0.05), the serum HDL level was significantly increased (P<0.001), and the serum LDL level was significantly decreased.

[0091] The liver was stained with HE and oil red, and the results were as follows Figure 4 As shown in the data, compared with the NC group, the degree of fatty degeneration in the liver of mice in the HFD group was significantly increased, and the diameter of fat droplets was significantly enlarged; compared with the HFD group, the degree of fatty degeneration in the liver of mice in the YXL-H and YXL-L groups was significantly reduced, and the diameter of fat droplets was significantly reduced.

[0092] 6.3 Effects of the Traditional Chinese Medicine Essential Oil of the Present Invention on Fat Metabolism-Related Factors in Obese Mice

[0093] like Figure 5 As shown in the results, compared with the NC group, the lipolysis genes PPAR-α, CPT-1, and CYP7A1 were significantly downregulated in the liver of mice in the HFD group, while the lipolysis genes PPAR-γ, SCD-1, FAS, and Cidea were significantly upregulated. Compared with the HFD group, the lipolysis genes PPAR-α, CPT-1, and CYP7A1 were significantly upregulated in the liver of mice in the YXL-H and YXL-L groups (P<0.01), while the lipolysis genes PPAR-γ, SCD-1, FAS, and Cidea were significantly downregulated (P<0.05 or P<0.01).

[0094] 6.4 Effect of the Traditional Chinese Medicine Essential Oil of the Present Invention on the Intestinal Microflora Structure of Obese Mice

[0095] Figure 6 The results of the changes in the intestinal flora structure of mice in the model group and the group treated with euphorbia pulcherrima essential oil are shown. Figure 6 A) showed that the health of the intestinal flora of mice was improved after treatment with yulan essential oil, and principal coordinate analysis PCOA analysis ( Figure 6 B) It was found that the intestinal flora of mice after treatment was significantly different from that of the model group. Further analysis of the flora composition found that at the genus level, Dubosiella and Acetatifactor bacteria were significantly increased, and at the species level, Dubosiella, Lachnospiraceae bacterium 28-4 and Acetatifactor bacteria were more abundant. These bacteria can produce metabolites such as short-chain fatty acids that help reduce body weight. The above results show that the indigo essential oil provided by the present invention can repair the flora disorder caused by a high-fat diet and restore the intestinal ecological balance of obese model mice.

[0096] 7 Conclusion

[0097] The above results show that the indigofera traditional Chinese medicine compound essential oil provided by the present invention, administered by inhalation, can significantly reduce the weight gain of obese mice induced by a high-fat diet and inhibit fat production; it can effectively reduce the triglyceride, cholesterol and HDL levels of obese mice induced by a high-fat diet, and increase the LDL level, thereby improving the hyperlipidemia symptoms of obese mice, improving the liver's ability to transport phospholipids and cholesterol, and eliminating cholesterol in peripheral blood vessels, thereby regulating lipid metabolism function; at the same time, the indigofera traditional Chinese medicine compound essential oil provided by the present invention can achieve the effect of repairing the intestinal flora disorder caused by a high-fat diet, and restore the intestinal ecological balance of obese mice.

[0098] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A traditional Chinese medicine compound essential oil of Yuxianglan for improving and / or treating obesity, characterized in that: The traditional Chinese medicine compound essential oil is prepared from the following raw materials in parts by weight: 0.5 parts of turmeric essential oil, 1 part of cyperus rotundus essential oil, and 1 part of gynostemma pentaphyllum essential oil; the turmeric essential oil, cyperus rotundus essential oil, and gynostemma pentaphyllum essential oil are commercially available or obtained according to conventional extraction methods, and have a purity of more than 99%.

2. The use of the indigofera traditional Chinese medicine compound essential oil as claimed in claim 1 in preparing a drug for improving and / or treating obesity.

Images