Application of a Klebsiella pneumoniae surface membrane protein and a vaccine
By preparing mRNA and circRNA vaccines based on Klebsiella pneumoniae surface membrane protein, combined with the lipid nanoparticle delivery system, the problem of time-consuming production of traditional vaccines is solved, and rapid and standardized vaccine production and effective immune prevention are achieved.
Patent Information
- Application Number
- CN202510200494.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-02-24
AI Technical Summary
The prior art is difficult to respond quickly and effectively to the infection of multidrug-resistant Klebsiella pneumoniae. Traditional vaccine production is time-consuming and complex, and it is impossible to respond quickly to pathogen mutations.
mRNA and circRNA vaccines are prepared using the nucleotide sequence of Klebsiella pneumoniae surface membrane protein, and the rapid and standardized vaccine production is achieved through the lipid nanoparticle delivery system (LNP) to stimulate the immune response.
It has achieved rapid, standardized and easy to expand the scale of vaccine production, has good immune effects, effectively prevents Klebsiella pneumoniae infection, and reduces the development and spread of drug resistance.
Smart Images

Figure CN119679930B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of bioengineering, and in particular relates to an application of Klebsiella pneumoniae surface membrane protein and a vaccine. Background Art
[0002] Klebsiella pneumoniae is a major pathogen worldwide, causing widespread nosocomial and community-acquired infections, including pneumonia, liver abscesses, gastrointestinal infections, and urinary tract infections, which can progress to life-threatening sepsis. In recent years, the rapid spread of multidrug-resistant K. pneumoniae (MDR-KP), particularly carbapenem-resistant K. pneumoniae (CRKP) and hypervirulent K. pneumoniae (hvKP), has increasingly limited clinical antibiotic treatment options. Data show that from 2005 to 2018, the detection rate of CRKP increased from 3% to 25%, and resistance to commonly used antibiotics has also shown a significant upward trend. Combination antibiotic regimens have shown limited efficacy and can increase drug resistance and treatment failure. Therefore, the development of new anti-infective and preventive strategies to combat K. pneumoniae is urgently needed.
[0003] Against this backdrop, the development of vaccines targeting Klebsiella pneumoniae offers a promising solution to the antibiotic resistance crisis. Unlike antibiotics, vaccines stimulate the host immune system to recognize and attack specific pathogens, providing a sustainable approach to preventing infection. Developing vaccines against K. pneumoniae could not only reduce the incidence of community-acquired or hospital-acquired infections caused by this pathogen but also reduce its resistance to antibiotics, thereby alleviating the selective pressure for treatment and curbing the development and spread of drug-resistant strains. Recent advances in messenger RNA (mRNA) and circular RNA (circRNA) vaccine technologies have opened up new avenues for the prevention and control of infectious diseases. These technologies involve the introduction of mRNA or circRNA encoding disease-specific antigens into the body, leveraging the host cell's protein synthesis machinery to produce the antigens and trigger an immune response. The rapidity and editability of nucleic acid vaccine technologies make them suitable as vaccine platforms to address the high prevalence and high resistance of difficult-to-treat pathogens.
[0004] Traditional vaccines targeting viral and bacterial pathogens (inactivated vaccines, adenovirus vector vaccines, and recombinant protein vaccines) are time-consuming and complex to produce, typically taking several months. Each new vaccine requires a customized production process, making rapid responses to pathogen mutations impossible. Summary of the Invention
[0005] The purpose of the present invention is to provide an application of Klebsiella pneumoniae surface membrane protein, aiming to solve the problems raised in the background technology.
[0006] In order to solve the above problems, the present invention is implemented in the following embodiments: a surface membrane protein of Klebsiella pneumoniae is used in the preparation of a drug or vaccine for preventing and treating Klebsiella pneumoniae infection.
[0007] Preferably, the target sequence of the Klebsiella pneumoniae surface membrane protein is shown in SEQ ID NO.3 in the sequence listing.
[0008] Another object of the present invention is to provide a vaccine for preventing and treating Klebsiella pneumoniae infection, wherein the vaccine is prepared by the nucleotide sequence of the surface membrane protein of Klebsiella pneumoniae; the vaccine is a combination of any one or more of a DNA vaccine, an RNA vaccine and a protein vaccine.
[0009] Preferably, the target sequence of the Klebsiella pneumoniae surface membrane protein is shown in SEQ ID NO.3 in the sequence listing.
[0010] Preferably, the vaccine is prepared by an mRNA plasmid or a circRNA plasmid constructed based on the nucleotide sequence of the Klebsiella pneumoniae surface membrane protein.
[0011] Preferably, the nucleotide sequence of the mRNA plasmid is shown in SEQ ID NO.4 of the sequence listing; the nucleotide sequence of the circRNA plasmid is shown in SEQ ID NO.5 of the sequence listing.
[0012] Preferably, the method for preparing the vaccine comprises the following steps:
[0013] Inserting the target sequence of the Klebsiella pneumoniae surface membrane protein into the CDS region of an mRNA vector or a circRNA vector to obtain an mRNA plasmid or a circRNA plasmid;
[0014] The mRNA plasmid or circRNA plasmid is transformed into competent cells, the plasmid is extracted, and then the extracted plasmid is linearized to obtain a linearized plasmid;
[0015] The linearized plasmid was transcribed in vitro to generate RNA;
[0016] The RNA is encapsulated with a pharmaceutical carrier to obtain the vaccine.
[0017] Preferably, the nucleotide sequence of the mRNA vector is shown in SEQ ID NO.1.
[0018] Preferably, the nucleotide sequence of the circRNA vector is shown in SEQ ID NO.2.
[0019] Preferably, the pharmaceutical carrier includes but is not limited to any one or more combinations of lipid nanoparticles, polymer nanoparticles, inorganic nanoparticles, solid lipid nanoparticles, nanoemulsions and exosomes.
[0020] Preferably, the administration of the vaccine includes but is not limited to one or more combinations of intramuscular injection, subcutaneous injection, intradermal injection, intravenous injection, oral administration, intranasal administration, respiratory administration, transdermal administration, and lymph node targeted administration.
[0021] Preferably, the administration dosage form of the vaccine includes but is not limited to one or more combinations of injection dosage form, oral dosage form, nasal dosage form, respiratory dosage form, transdermal dosage form, multiple-dose dosage form, single-dose dosage form, single-dose vial, needle-free dosage form and nanoparticle dosage form.
[0022] Compared with the prior art, the present invention has the following advantages:
[0023] The present invention produces a vaccine against Klebsiella pneumoniae based on the surface membrane protein, mRNA and circRNA of Klebsiella pneumoniae. It has the characteristics of rapidity, standardization, easy scalability and good immune effect, and can realize flexible, rapid and efficient vaccine production. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 A flowchart of the technical solution provided by an embodiment of the present invention.
[0025] Figure 2 1 is a nucleic acid gel electrophoresis experimental result diagram of the RNA prepared in Example 1; in the figure, A is a nucleic acid gel electrophoresis experimental result diagram of the RNA plasmid before and after enzyme digestion; B is a nucleic acid gel electrophoresis experimental result diagram of the RNA obtained by in vitro transcription and purification.
[0026] Figure 3 The expression of mRNA-LNP in cells.
[0027] Figure 4 The expression of circRNA-LNP in cells.
[0028] Figure 5 This is a diagram showing the nucleic acid gel electrophoresis results of the DNA prepared in Example 3.
[0029] Figure 6 This is a diagram showing the nucleic acid gel electrophoresis results of the PCR products in Example 4.
[0030] Figure 7 This is a diagram showing the nucleic acid gel electrophoresis results of the bacterial batch product in Example 4.
[0031] Figure 8 The figure shows the results of SDS-PAGE analysis.
[0032] Figure 9 This is the result of Western blot analysis.
[0033] Figure 10 This is the statistical result of positive cells.
[0034] Figure 11 The graph is a comparison of the absorbance measurement results of different groups.
[0035] Figure 12 The figure shows the comparison of the survival rates of mice in different groups. DETAILED DESCRIPTION
[0036] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0037] The technical solutions provided by the embodiments of the present invention mainly solve the following technical problems:
[0038] 1. Pathogenic mechanism of multidrug-resistant Klebsiella pneumoniae: In-depth study of the role and mechanism of Klebsiella pneumoniae surface membrane proteins in its survival, pathogenicity, and evasion of host immune responses, in order to clarify the key functions of membrane proteins in the bacterial immune process.
[0039] 2. Design and efficacy evaluation of messenger RNA (mRNA) and circular RNA (circRNA) vaccines: Address how to design mRNA and circRNA vaccines based on Klebsiella pneumoniae as a model, and verify their antigen expression efficiency, immunogenicity, and protective efficacy through in vitro and in vivo experiments, providing a scientific basis for the development of bacterial vaccines.
[0040] 3. Optimization of lipid nanoparticle (LNP) delivery systems: To address the challenges of mRNA and circRNA delivery in the lungs, we optimized the LNP delivery system to achieve effective LNP encapsulation of mRNA and circRNA (mRNA-LNP, circRNA-LNP) and stable release, and studied the critical quality attributes of the delivery system.
[0041] 4. New strategies for the prevention and control of Klebsiella pneumoniae infection: Using mRNA-LNP and circRNA-LNP vaccines to enhance lung immune responses and prevent Klebsiella pneumoniae infection, providing a new alternative to traditional antibiotics.
[0042] 5. Acquisition of preclinical safety and efficacy data: Establish comprehensive animal model experiments to evaluate the efficacy, safety, and potential clinical application value of mRNA-LNP and circRNA-LNP vaccines in preventing Klebsiella pneumoniae infection.
[0043] Specifically, such as Figure 1 As shown (taking mRNA as an example), the technical solutions adopted in the embodiments of the present invention are as follows:
[0044] 1. Design and screening of mRNA and circRNA vaccines targeting Klebsiella pneumoniae: This study will use genetic engineering technology to design and synthesize mRNA and circRNA vaccines with high stability and long-lasting antigen expression capabilities against Klebsiella pneumoniae, so as to effectively stimulate the immune response against Klebsiella pneumoniae.
[0045] 2. Design and synthesis of Klebsiella pneumoniae mRNA-LNP and circRNA-LNP vaccine formulations for pulmonary delivery: Using currently available plasmids capable of producing mRNA or circRNA (containing a T7 promoter), any target sequence (i.e., CDS) was inserted into these plasmids to generate complete mRNA or circRNA plasmids. The plasmids were linearized using a single restriction enzyme site. The linearized plasmids were in vitro transcribed using a T7 in vitro transcription kit to generate large amounts of RNA. The RNA was purified using the Zymo RNA Clean & Concentrator kit. The synthesized and purified RNA was verified by gel electrophoresis to ensure its integrity and purity. The ionizable lipid SM-102, DOPE, cholesterol, and PEG were mixed at a molar ratio of 50:10:38.5:1.5, and a certain amount of ethanol was added to form an oily phase encapsulating the RNA, thus forming the lipid nanoparticle (LNP) reagent. The aqueous phase was prepared by mixing the RNA solution with citrate in a vial equipped with a magnetic stirrer. The final concentration of citrate in the aqueous phase was 0.05 M, with a pH between 4.5 and 5.0. The final volume ratio of the aqueous phase to the oil phase was 3:1. LNPs were injected into the aqueous phase via solvent infusion to form the lipid nanoparticle reagent. The resulting lipid nanoparticles were tested for release into the respiratory tract using the luciferase gene to ensure effective penetration of the respiratory barrier and optimal immune response.
[0046] 3. In vitro and in vivo experiments were conducted to evaluate the antigen expression and efficacy of the Klebsiella pneumoniae circRNA-LNP vaccine: In vitro experiments: The RNA and RNA-LNP preparations synthesized above were transfected into Hela cells, and their intracellular proteins were stained to evaluate the vaccine's antigen expression. In vivo experiments: The RNA and RNA-LNP preparations synthesized above were inoculated into mice according to the standard immunization process. Two weeks after the last immunization, blood, lungs, spleen, and lymph nodes were obtained from the mice to evaluate the humoral and cellular immune responses of the RNA vaccine. The mice were also monitored for changes in body weight, temperature, and biochemical parameters such as liver and kidney function to further evaluate the safety and efficacy of the vaccine.
[0047] 4. Verify the effectiveness of mRNA-LNP and circRNA-LNP vaccines against Klebsiella pneumoniae in preventing Klebsiella pneumoniae in mice: Evaluate the protective effect of mRNA-LNP and circRNA-LNP vaccines against Klebsiella pneumoniae infection in a mouse model to determine their effectiveness under actual pathogen challenges.
[0048] In the following examples, the experimental methods without specific experimental conditions are generally carried out under conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents, raw materials, and equipment used in the present invention can be obtained from commercial sources.
[0049] Example 1: This example provides a vaccine for preventing and treating Klebsiella pneumoniae infection, including two vaccines: mRNA-LNP and circRNA-LNP. The preparation method of the vaccine comprises the following steps:
[0050] S1, inserting the target sequence of the Klebsiella pneumoniae surface membrane protein into the CDS region of the mRNA vector or circRNA vector to obtain an mRNA plasmid or a circRNA plasmid;
[0051] S2. Transform the mRNA plasmid or circRNA plasmid into competent cells, extract the plasmid, and then linearize the extracted plasmid to obtain a linearized plasmid;
[0052] S3, the linearized plasmid is transcribed in vitro to generate RNA;
[0053] S4. Encapsulating the RNA with a lipid nanoparticle reagent to obtain the vaccine.
[0054] Among them, the nucleotide sequence of the mRNA vector (plasmid backbone) is shown in SEQ ID NO.1 of the sequence listing; the nucleotide sequence of the circRNA vector (plasmid backbone) is shown in SEQ ID NO.2 of the sequence listing; the target sequence of the Klebsiella pneumoniae surface membrane protein (KPompA) is located in the DNA sequence at positions 3097823-3098590 in the standard strain 35657 of Klebsiella pneumoniae, specifically as shown in SEQ ID NO.3 of the sequence listing; the nucleotide sequence of the mRNA plasmid (containing the mRNA plasmid backbone + KPompA CDS region) is shown in SEQ ID NO.4 of the sequence listing; the nucleotide sequence of the circRNA plasmid (containing the circRNA plasmid backbone + KPompA CDS region) is shown in SEQ ID NO.5 of the sequence listing.
[0055] In practical application, the vaccine is prepared as follows:
[0056] (1) The double-stranded DNA molecule of the target sequence of the Klebsiella pneumoniae surface membrane protein was inserted into the CDS region of the nucleotide sequence of the mRNA vector and the nucleotide sequence of the circRNA vector, respectively, to obtain mRNA and circRNA plasmids, which were named Plasmid-mRNA and Plasmid-circRNA. They were sent to GenScript Biotech Co., Ltd. for synthesis. After synthesis, the obtained plasmids were transformed into DH5α competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.); the transformation method is as follows:
[0057] Add 100 ng of plasmid-mRNA or plasmid-circRNA to 50 μL of DH5α, let it sit on ice for 30 minutes, heat it in a 42°C waterbath for 1 minute, and immediately place it on ice for 2 minutes after heat shock. Add 500 μL of antibiotic-free LB to the EP tube and incubate it in a 37°C shaker. After 1 hour, remove the tube and centrifuge it at 4000 rpm for 2 minutes to obtain a bacterial pellet. Discard the supernatant and resuspend the pellet with the remaining supernatant. Draw the plate onto an agarose plate containing the corresponding resistance of the plasmid. Divide the plate into four sections and place it in an incubator at 37°C overnight.
[0058] (2) Use the plasmid extraction kit from Beijing Tiangen Biochemical Technology Co., Ltd. to extract the plasmid. The plasmid extraction method is as follows: Pick the monoclonal strain obtained by the above transformation and place it in 5 mL of LB containing the corresponding resistance and culture it overnight. The operation steps are as follows:
[0059] 1. Column equilibration step: Add 500 μl of equilibration solution BL to the adsorption column CP3 (place the adsorption column in the collection tube). Centrifuge at 12,000 rpm (~13,400 x g) for 1 minute. Discard the waste liquid in the collection tube and return the adsorption column to the collection tube. (Please use a column that has been treated that day.)
[0060] 2. Take 5 mL of overnight culture solution and add it to a centrifuge tube. Use a conventional desktop centrifuge and centrifuge at 12000 rpm (~13400 x g) for 1 min. Aspirate as much supernatant as possible (if the bacterial solution is large, you can collect the bacterial pellet into one centrifuge tube through multiple centrifugations).
[0061] 3. Add 250 μL of Solution P1 (RNase A must be added first) to the centrifuge tube containing the bacterial pellet. Use a pipette or vortex to thoroughly resuspend the bacterial pellet. Note: If there are any bacterial clumps that are not thoroughly mixed, lysis will be affected, resulting in lower extraction yield and purity.
[0062] 4. Add 250 μL of Solution P2 to the centrifuge tube and gently invert the tube 6-8 times to fully lyse the cells. Note: Mix gently; avoid violent shaking to avoid disrupting the genomic DNA and causing fragments to be mixed with the extracted plasmid. The bacterial solution should now be clear and viscous. The incubation time should not exceed 5 minutes to avoid plasmid damage. If it does not become clear, it may be due to an excessive number of cells and incomplete lysis. Reduce the amount of cells.
[0063] 5. Add 350 μL of Solution P3 to the centrifuge tube and immediately and gently invert the tube 6-8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000 rpm (~13,400 x g) for 10 minutes. Note: Mix immediately after adding P3 to avoid localized precipitation. If a small amount of white precipitate remains in the supernatant, centrifuge again and remove the supernatant.
[0064] 6. Use a pipette to transfer the supernatant collected in the previous step to the adsorption column CP3 (place the adsorption column in the collection tube), taking care not to aspirate the precipitate. Centrifuge at 12,000 rpm (~13,400 x g) for 30-60 seconds. Discard the waste liquid in the collection tube and place the adsorption column CP3 in the collection tube.
[0065] 7. Add 600 μL of rinse solution PW (anhydrous ethanol must be added first) to the adsorption column CP3, centrifuge at 12,000 rpm (~13,400 x g) for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.
[0066] 8. Repeat step 7.
[0067] 9. Place the adsorption column CP3 in a collection tube and centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes to remove any residual rinse solution from the column. Note: Residual ethanol in the rinse solution can affect subsequent enzymatic reactions (such as digestion and PCR). To ensure that downstream experiments are not affected by residual ethanol, it is recommended to leave the adsorption column CP3 uncovered and at room temperature for several minutes to completely dry any residual rinse solution from the adsorption material.
[0068] 10. Place the adsorption column CP3 in a clean centrifuge tube. Add 50-100 μL of Elution Buffer EB to the center of the adsorption membrane. Incubate at room temperature for 2 minutes. Centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes to collect the plasmid solution into a centrifuge tube. Note: The volume of elution buffer should not be less than 50 μL. A smaller volume will affect recovery efficiency. The pH of the elution buffer significantly affects elution efficiency. If subsequent sequencing is performed, use ddH2O as the elution buffer and ensure its pH is between 7.0 and 8.5. A pH below 7.0 will reduce elution efficiency. The DNA product should be stored at -20°C to prevent DNA degradation. To increase plasmid recovery, reapply the resulting solution to the adsorption column, incubate at room temperature for 2 minutes, centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes, and collect the plasmid solution into a centrifuge tube.
[0069] (3) The plasmid extracted above was digested with a single enzyme site enzyme (BspQI, purchased from Hongene Biotech) according to the enzyme instructions to linearize the plasmid. The linearization method is as follows:
[0070] 1. In ice water, mix the following reaction components in the given order: 1 μg DNA, 5 μL 10x Cut buffer, 10 units BspQI, and make up the total volume of the reaction components to 50 μL.
[0071] 2. Incubate at 50°C for 60 min.
[0072] 3. Keep warm at 80℃ for 2 minutes to inactivate the enzyme.
[0073] (4) The linearized plasmid was purified and recovered using a common DNA product purification kit (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.). The recovery method is as follows:
[0074] 1. Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400 x g) for 1 min, discard the waste liquid in the collection tube, and return the adsorption column CB2 to the collection tube (use the column treated that day).
[0075] 2. Estimate the volume of the enzyme digestion reaction and add 5 times the volume of Binding Buffer PB to it. Mix thoroughly (no need to remove the paraffin or mineral oil). Note: If the PCR reaction system is 50 μL (excluding the paraffin oil volume), add 250 μL of Binding Buffer PB.
[0076] 3. Add the solution from the previous step to an adsorption column CB2 (place the adsorption column in a collection tube). Incubate at room temperature for 2 minutes. Centrifuge at 12,000 rpm (~13,400 x g) for 30-60 seconds. Discard the waste liquid from the collection tube and place the adsorption column CB2 back in the collection tube. Note: The adsorption column has a volume of 800 μL. If the sample volume is larger than 800 μL, add the sample in batches.
[0077] 4. Add 600 μL of rinse solution PW (add anhydrous ethanol before use) to the adsorption column CB2, centrifuge at 12,000 rpm (~13,400 x g) for 30-60 seconds, discard the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.
[0078] 5. Repeat step 4.
[0079] 6. Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400 x g) for 2 minutes to remove as much rinse solution as possible.
[0080] Place the adsorption column CB2 at room temperature for several minutes to dry thoroughly to prevent the residual rinse solution from affecting the next experiment.
[0081] (5) The linearized plasmid was transcribed and capped in vitro using the T7 in vitro transcription kit (purchased from Hongene Biotech) to generate a large amount of RNA. The in vitro transcription method is as follows:
[0082] 1. The following amounts are suitable for a single 22 μL reaction system; the reaction system is as follows: 2 μL of 100 mM ATP solution, 2 μL of 100 mM GTP solution, 2 μL of 100 mM CTP solution, 2 μL of 100 mM N1-Me-pUTP solution (purchased from Hongene Biotech) and 2 μL of 100 mM (3'-OMe-m 7 2 μL of pG)(5') ppp(5')(2'-OMeA)pG solution (purchased from Hongene Biotech), 1 μg of DNA template, 4 μL of 5x Reaction Buffer, 1.5 μL of Enzyme Mix, and nuclease-free water to make up to 22 μL.
[0083] 2. Mix thoroughly and incubate at 37°C for 2 hours.
[0084] 3. Add 1 μL DNase I (RNase-free, purchased from Hongene Biotech), mix thoroughly and incubate at 37°C for 30 minutes.
[0085] (6) Purify RNA using the zymo RNA clean & concentrator kit. The purification method is as follows:
[0086] 1. Add 2 volumes of RNA binding buffer to the RNA EP tube obtained above and mix well.
[0087] 2. Add an equal volume of ethanol (95-100%) and mix well.
[0088] 3. Transfer the sample to Zymo-Spin™ IICR column 3 and centrifuge at 10,000-16,000 g for 30-60 seconds. Discard the flow-through.
[0089] 4. Add 400 μL of RNA Preparation Buffer to the column and centrifuge at 10,000-16,000 g for 30-60 seconds. Discard the flow-through.
[0090] 5. Add 700 μL of RNA wash buffer to the column and centrifuge at 10,000-16,000 g for 30-60 seconds. Discard the flow-through.
[0091] 6. Add 400 μL RNA wash buffer to the column and centrifuge at 10,000-16,000 g for 1 minute to ensure complete removal of the wash buffer. Carefully transfer the column to an RNase-free tube.
[0092] 7. Add 50 μL of DNase / RNase-free water directly to the column matrix and centrifuge.
[0093] The eluted RNA can be used immediately or stored frozen. The synthetic purified RNA was subjected to nucleic acid gel electrophoresis to ensure its integrity and purity. The verification results were as follows: Figure 2 The results showed that the nucleic acid gel electrophoresis experiment showed a single band after enzyme digestion and in vitro transcription and purification.
[0094] (7) Preparation and preparation of LNP reagent: The raw materials SM-102 lipid, DOPE lipid, cholesterol, and PEG lipid (DMG-PEG2000) were all purchased from TargetMol. First, a stock solution of each lipid component was prepared in ethanol. The stock solution concentration of each lipid component except SM-102 was 10 mg / mL, and SM-102 was 25 mg / mL. The molar amount of SM-102 should be determined based on the ratio of N (amine group in ionizable lipid) to P (phosphorus group in RNA) of 6:1. The molar ratio of SM-102 to other lipids was SM-102:DOPE:cholesterol:PEG lipid = 50:10:38.5:1.5; the four lipid components were mixed together and a certain amount of ethanol was added to obtain the LNP reagent. The final volume of the organic phase reached 300 μL in the EP tube.
[0095] (8) The RNA obtained above is encapsulated with LNP reagent as follows:
[0096] Prepare the aqueous phase by mixing the RNA solution with citrate buffer in a 4 mL vial equipped with a magnetic stirrer. The final volume of the aqueous phase should be 900 μL, and the concentration of citrate buffer in the aqueous phase should be 50 mM. Be sure to use RNase-free water to dilute the RNA and citrate buffer.
[0097] 2. Place the 4 mL vial containing the aqueous phase on a magnetic stirrer set at 1000 rpm. Using a 200 μL pipette, flush the lipid mixture prepared above into the center of the turbulent flow generated by stirring. Stir this mixture for 5 minutes and then incubate at room temperature for an additional 5 minutes.
[0098] 3. Transfer the prepared mixture to a dialysis kit. Dialyze the mixture in PBS (>1 L) with magnetic stirring at 4°C for 4 hours. After dialysis, concentrate the preparation using an Amicon ultracentrifugal filter (2 mL MWCO 10 kDa) at 5000 rcf until the desired volume is reached to obtain the mRNA-LNP vaccine or circRNA-LNP vaccine. Store the mRNA-LNP or circRNA-LNP at 4°C until ready for use.
[0099] Example 2: The mRNA-LNP vaccine and circRNA-LNP vaccine prepared above were expressed intracellularly. The specific method is as follows:
[0100] 1. Plate: Hela cells were plated at 1×10 4Cells were plated at a density of 100 μg / well in a 24-well plate mounted on a slide and transfected when the cells reached 60-80% confluence. mRNA was added to each well using the commercially available Lipofectamine MessengerMAX transfection kit at a final dose of 1 μg / well. The cells were incubated at 37°C in a 5% CO2 incubator for 24 hours.
[0101] 2. Discard the culture medium in each well and wash once with PBS. Add 500 μL of 4% paraformaldehyde to each well and fix the cells for 15 minutes at room temperature. Then, wash the cells three times with PBS.
[0102] 3. Add 0.2% TritonX-100 to each well and permeabilize the membrane for 15 minutes at room temperature. Then wash 3 times with PBS.
[0103] 4. Add 500 μL of 4% goat serum to each well for blocking and incubate at room temperature for 30 minutes.
[0104] 5. Add 100 μL of primary antibody (1:500 dilution) to each well and incubate at room temperature for 1 hour. Then wash three times with PBS.
[0105] 6. Add 100 μL of secondary antibody (diluted 1:1000) to each well and incubate at room temperature for 1 hour. Wash three times with PBS.
[0106] 7. Add 300 μL of Hochest (1:5000 dilution) to each well and incubate at room temperature for 10 minutes. Wash three times with PBS.
[0107] 8. Drop a drop of anti-fluorescence quencher on the slide, place the slide on the quencher, and seal the slide with sealing liquid.
[0108] 9. Place the slide under a fluorescence microscope for observation. Figure 3 and Figure 4 The experimental results show the expression of RNA in cells (blue is the nucleus, red is the protein).
[0109] Example 3: This example provides a method for preparing a KP ompA DNA-LNP vaccine:
[0110] (1) Extract genomic DNA of Klebsiella pneumoniae standard strain 35657.
[0111] (2) Design specific primers based on the above-mentioned known Klebsiella pneumoniae surface membrane protein gene sequence.
[0112] The primer sequences are as follows: F1: CAGGGCGTTCAGCTGACC (as shown in the sequence listing SEQ ID NO. 6); R1: TTAAGCCGCCGGCTGAGTTAC (as shown in the sequence listing SEQ ID NO. 7).
[0113] (3) Perform PCR amplification to obtain the target gene fragment, and send it to Kumei Biotechnology Co., Ltd. for sequencing to confirm that the base sequence is correct. The PCR amplification system and procedure are shown in Tables 1 and 2, respectively.
[0114]
[0115] (4) LNP encapsulation. Encapsulate the DNA fragments using the RNA encapsulation method described in Example 2 to obtain a DNA-LNP vaccine. Store the DNA-LNPs at 4°C until they are ready for use.
[0116] Experimental results: The target gene fragment was obtained by PCR amplification and sequenced correctly. The results of nucleic acid gel electrophoresis experiment are as follows Figure 5 shown.
[0117] Example 4: This example provides a method for preparing a KP ompA protein vaccine:
[0118] (1) Extract Klebsiella pneumoniae genomic DNA.
[0119] (2) Based on the above-mentioned known Klebsiella pneumoniae surface membrane protein gene sequence, specific primers were designed (F2 = protective base GA + restriction site bgl II + KP ompA sequence, R2 = protective base ACGC + restriction site SalI + KP ompA sequence).
[0120] The primer sequences are as follows: F2: GAAGATCTCAGGGCGTTCAGCTGACC (as shown in the sequence listing SEQ ID NO. 8); R2: ACGCGTCGACTTAAGCCGCCGGCTGAGTTAC (as shown in the sequence listing SEQ ID NO. 9).
[0121] (3) Perform PCR amplification to obtain the target gene fragment. The implementation method is the same as that of Example 3.
[0122] (4) The target gene fragment is digested by enzymes and then ligated with the prokaryotic vector pet28a that has been double-digested with BamHI and SalI to construct the prokaryotic vector for protein purification. Since the KPompA fragment contains a BamHI restriction site, if BamHI is used for enzyme digestion, the BamHI enzyme will chop up the target gene fragment. To avoid this, the present embodiment uses BglII, which has the same sticky ends as BamHI, instead of BamHI and SalI for double digestion. The target gene fragment after enzyme digestion is recovered using the above-mentioned common DNA product purification kit. After recovery, it is ligated with the double-digested pet28a (BamHI and SalI).
[0123] The enzyme digestion method is as follows: The enzyme should be shaken and mixed before use. The enzyme digestion system can be scaled up as needed. The enzyme digestion system is shown in Table 3 (then incubate at 37°C for 6-18 hours).
[0124] The ligation system is shown in Table 4. The ligation product was placed in a 16°C metal bath overnight for ligation:
[0125]
[0126] (5) Transform the recombinant plasmid KpompA-Pet28a into DH5α. The transformation method is shown in Example 1. On the next day, single clones were selected for colony PCR verification.
[0127] The colony PCR system is shown in Table 5. After mixing and shaking, perform PCR:
[0128]
[0129] The colony PCR program is shown in Table 6:
[0130]
[0131] Positive clones were picked for shaking and culture preservation (200 μL 50% glycerol + 800 μL bacterial solution), and the remaining bacterial solution was used to extract plasmids, which were then sent to Kumei Biotechnology Co., Ltd. for sequencing.
[0132] Experimental results: The results of nucleic acid gel electrophoresis of PCR products are as follows: Figure 6 As shown in the figure, the nucleic acid gel electrophoresis results of the bacterial batch product are as follows Figure 7 shown.
[0133] (6) Transform the correctly sequenced plasmid into Rosetta (DE3) competent cells, pick a single clone and place it into 5 ml of LB containing kanamycin resistance. Add the overnight cultured bacteria to 1 L of LB containing kanamycin resistance at a ratio of 1:200. Add 200 mM IPTG and induce expression overnight at 18°C. Collect the bacterial pellet from the 1 L bacterial solution using a high-speed floor centrifuge and disrupt the bacterial pellet using a cell disruptor. Purify the protein using methods such as his-tag affinity chromatography.
[0134] The protein purification method is as follows:
[0135] Experimental Materials:
[0136] Ni-NTA resin: used for purification of His-tagged proteins (purchased from QIAGEN, cat. no. 124114376).
[0137] Buffer:
[0138] Lysis buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, 1 mg / mL lysozyme.
[0139] Wash Buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 20 mM imidazole.
[0140] Elution buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 250 mM imidazole.
[0141] Dialysis buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10% glycerol.
[0142] Chromatography column: used to pack Ni-NTA resin.
[0143] SDS-PAGE reagent: used to detect protein purity.
[0144] Dialysis bags and dialysis buffer: used to remove imidazole.
[0145] Experimental steps:
[0146] (1) Cell lysis
[0147] Collect cells: Centrifuge cells expressing the target protein (e.g., Rosetta) (4000 rpm, 10 min, 4°C) and discard the supernatant.
[0148] Resuspend cells: Resuspend the cell pellet in lysis buffer.
[0149] Cell lysis: Use a cell disruptor to disrupt cells.
[0150] Centrifugation: Centrifuge the lysate (12,000 rpm, 30 min, 4°C) and collect the supernatant (containing soluble protein).
[0151] (2) Prepare Ni-NTA resin
[0152] Column packing: Load Ni-NTA resin into the chromatography column and equilibrate the column with lysis buffer (at least 5 column volumes).
[0153] Sample loading: Slowly add the supernatant of cell lysate to the chromatography column and control the flow rate (1 mL / min).
[0154] Collect the flow-through: Collect the flow-through for subsequent analysis.
[0155] (3) Washing
[0156] Wash non-specifically bound proteins: Wash the column with wash buffer (at least 10 column volumes) to remove unbound proteins.
[0157] Collect the wash solution: Collect the wash solution for subsequent analysis.
[0158] (4) Elution
[0159] Elution of target protein: Elute the target protein with elution buffer (5 column volumes) and collect the eluate (1 mL per tube).
[0160] Protein detection: Detect the target protein in the eluate by SDS-PAGE.
[0161] (5) Dialysis
[0162] Removal of imidazole: Place the eluate into a dialysis bag and dialyze against dialysis buffer (4°C, 12-24 hours) to remove imidazole.
[0163] Buffer exchange: Change the dialysis buffer every 4-6 hours.
[0164] (6) Protein concentration determination
[0165] Bradford method: Determine the concentration of purified protein.
[0166] SDS-PAGE analysis: to detect protein purity and molecular weight, such as Figure 8 shown.
[0167] Western blot analysis: Use His tag antibody to verify the target protein, such as Figure 9 shown.
[0168] (7) Take 5 μg of purified protein and mix it with an equal volume of complete Freund's adjuvant for the first immunization, and mix it with an equal volume of incomplete Freund's adjuvant for the second and third immunizations to immunize mice.
[0169] Example 5: Animal experiments were conducted on the vaccine prepared above, as follows:
[0170] Animal groups: Control group: received 50 μL of PBS. Vaccine experimental group: received 50 μL of 10 μg DNA-LNP, 50 μL of 10 μg mRNA-LNP, 50 μL of 10 μg circRNA-LNP, and 50 μL of 5 μg purified KP-ompA protein.
[0171] Immunization dose and route: Route: intramuscular injection (im) and / or intranasal inoculation (in).
[0172] Immunization schedule: Standard protocol: First immunization: im, time point is day 0 (prime). Second immunization: im, time point is day 14 (boost). Third immunization: im or in, time point is day 28 (boost). 14 days after the last immunization, collect blood via orbital examination and dissect the mouse lungs and spleen.
[0173] Cellular immunity and humoral immunity experiments were performed. Materials required for cellular immunity were purchased from Thermo Fisher Scientific. The cellular immunity method is as follows:
[0174] 1. Preparation of Lung / Spleen / Blood Single Cell Suspensions
[0175] 1. Obtain all lung / spleen tissue: Wash the mouse lung / spleen in a culture dish containing 5-10 mL of 2% FCS (DPBS + 2% FBS) buffer, then place in a 2% FCS-containing 1 mg / mL collagenase D and 0.1 mg / mL (100 U / mL) DNase I buffer (dissociation medium) on ice. (For spleen processing, skip to step 3; for blood processing, skip to step 4.)
[0176] 2. Place the lung tissue in a six-well plate and mince the lungs into a paste. Use a pipette to transfer the minced lung tissue and dissociation medium to a 15 mL tube. Add dissociation medium to a 5 mL volume. Securely cap the tube and incubate at 37°C (100-150 rpm) for 45 minutes. Add 5 mL of pre-chilled DPBS to terminate the reaction.
[0177] 3. Pre-wet the filter with 5 mL of 2% FCS and a 15 mL centrifuge tube. Place the tissue on a cell strainer placed in a 15 mL centrifuge tube. Gently triturate the cell suspension using the flat side of a 1 mL syringe plunger to create a homogenate. Filter the cell suspension. Rinse the strainer with 5 mL of DPBS.
[0178] 4. Centrifuge at 300 x g for 5 minutes at room temperature. Carefully remove the centrifuge tube and discard the supernatant.
[0179] 5. Resuspend the cells in 2 mL of ice-cold 1X red blood cell lysis buffer. Incubate at room temperature for 5 minutes, shaking occasionally, and then suspend with 10 mL of cold DPBS. Centrifuge at 400g for 5 minutes at 4°C and discard the supernatant.
[0180] 6. Resuspend the cells in 1 mL DPBS in a 1.5 mL EP tube and wash once. Resuspend the cells in 1 mL DPBS and count the cells. Adjust the final cell concentration to 1 × 10 7 cells / mL, transfer the cell suspension to a 1.5mL centrifuge tube, 100uL / tube, the final cell concentration is 1×10 6 Add DPBS to make up to 1 mL and prepare for staining live and dead cells.
[0181] 2. Stain for Live / Dead: Thaw the dye vial and dilute the LIVE / DEAD fixable dead cell stain by adding 50 µL of DMSO to the vial.
[0182] 1. Add 1 µL of diluted stain per 1 mL of cells; mix the cells and stain thoroughly and incubate at 4°C in the dark for 30 minutes.
[0183] 2. Wash cells twice with 1 mL of flow cytometry buffer at 400 g for 5 min.
[0184] 3. Block Fc-mediated nonspecific staining with antibody blockers (before use, quickly centrifuge the antibodies to restore the maximum volume): Pre-incubate the CD16 / CD32 antibody at 1uL / 50μL sample at 4°C / on ice for 15 minutes.
[0185] IV. Surface Antigen Staining (Before use, quickly centrifuge the antibody to recover the maximum volume. All cell staining operations should be performed on ice or at 4°C and protected from light as much as possible.)
[0186] Add 50 μL of cell suspension (1×10 6 cells).
[0187] 1. Cd45, Cd4, Cd8a, Cd69, and Cd103: Add 2.5 μL Cd45 (0.5 μg / test, 0.2 mg / mL), 0.5 μL Cd4 (0.25 μg / test, 0.5 mg / mL), 2.5 μL Cd8a (0.5 μg / test, 0.2 mg / mL), 5 μL Cd103 (1 μg / test, 0.2 mg / mL), and 1.25 μL Cd69 (0.25 μg / test, 0.2 mg / mL). Gently vortex to mix. Incubate on ice at 4°C, protected from light, for 30 minutes.
[0188] 2. Wash the cells with 1 mL / tube of flow cytometry staining buffer. Centrifuge at 500 x g for 5 minutes at room temperature. Discard the supernatant. Wash twice. Discard the supernatant from the final wash, retaining a 100 μL residual volume and pulse-vortexing the sample to completely dissociate cell clumps. Load the sample onto a flow cytometer and count the positive cells.
[0189] The experimental results are as follows Figure 10 As shown: CD62-CD44+ indicates the presence of effector T cells. This experiment proves that vaccine immunization of mice can produce effector T cells against Klebsiella pneumoniae.
[0190] Blood was collected from the eye socket, centrifuged at 12,000 rpm and 4°C, and the supernatant was tested by ELISA. The ELISA method for testing antibody titers is as follows:
[0191] 1. Coating: Dilute the purified antigen to a concentration of 10 μg / well with coating solution. Add 100 μL per well to a 96-well ELISA plate and incubate overnight at 4°C. The next day, discard the coating solution and wash the plate three times with washing solution, soaking for 1-2 minutes each time.
[0192] 2. Blocking: Add 200 μL of blocking solution to each well and incubate at 37°C for 1 hour. Discard the blocking solution and wash the plate three times with washing solution, soaking for 1-2 minutes each time.
[0193] 3. Sample addition: Dilute the antibody serum to be tested by a certain multiple and add 100 μL per well to the blocked ELISA plate. Incubate at 37°C for 1 hour. Wash the plate three times with washing buffer, soaking for 1-2 minutes each time.
[0194] 4. Add enzyme-labeled antibody: Dilute HRP-labeled antibody to 1:2500 with blocking buffer and add 100 μL to each well. Incubate at 37°C for 1 hour. Wash the plate three times with washing buffer, soaking for 1-2 minutes each time.
[0195] 5. Color development: Add 100 μL of TMB substrate solution to each well and incubate at 37°C in the dark for 15-30 minutes. Add 50 μL of stop solution to each well to terminate the color development reaction.
[0196] 6. Determination: Measure the absorbance (OD) value of each well at a wavelength of 450 nm using a microplate reader.
[0197] Elisa tests were performed on the experimental group (adding mRNA-LNP) and the control group (adding PBS) according to the above method. The results are as follows Figure 11 As shown; the results showed that the IgG in the experimental group was significantly higher than that in the control group.
[0198] After immunization, the mice in the above groups were challenged with Klebsiella pneumoniae to observe the protective effect of the vaccine on the mice. The results are as follows: Figure 12 As shown; the results showed that the PBS group had a higher mortality rate after Klebsiella pneumoniae infection than the vaccinated mice.
[0199] The present invention demonstrates that membrane protein-specific antibodies can protect mice from virulent Klebsiella pneumoniae infection and challenge, providing evidence for an mRNA-LNP or circRNA-LNP vaccine platform for the treatment and prevention of Klebsiella pneumoniae. These findings are of great significance given the global antibiotic resistance crisis and the lack of effective vaccine candidates.
[0200] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.
Claims
1. A vaccine for preventing and treating Klebsiella pneumoniae infection, characterized in that, The vaccine is prepared from the nucleotide sequence of the surface membrane protein of Klebsiella pneumoniae; the vaccine is an RNA vaccine; the target sequence of the surface membrane protein of Klebsiella pneumoniae is as shown in SEQ ID NO.3 in the sequence listing; The vaccine is prepared from an mRNA plasmid or a circRNA plasmid constructed based on the nucleotide sequence encoding the surface membrane protein of Klebsiella pneumoniae; the nucleotide sequence of the mRNA plasmid is as shown in SEQ ID NO.4 in the sequence listing; the nucleotide sequence of the circRNA plasmid is as shown in SEQ ID NO.5 in the sequence listing; The preparation method of the vaccine comprises the following steps: Inserting the target sequence of the surface membrane protein of Klebsiella pneumoniae into the CDS region of an mRNA vector or a circRNA vector to obtain an mRNA plasmid or a circRNA plasmid; Transforming the mRNA plasmid or the circRNA plasmid into competent cells, extracting the plasmid, and then linearizing the extracted plasmid to obtain a linearized plasmid; Performing in vitro transcription on the linearized plasmid to generate RNA; Wrapping the RNA with a pharmaceutical carrier to obtain the vaccine; the pharmaceutical carrier is a lipid nanoparticle.