A gene SbAIF1 for enhancing sorghum alkali tolerance and its application
By overexpressing the SbAIF1 gene in sorghum, the problem of insufficient alkaline tolerance of sorghum was solved, the alkaline stress tolerance of sorghum was enhanced, and the breeding and agricultural production of salt-alkali resistant transgenic plants were promoted.
Patent Information
- Application Number
- CN202411851811.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-16
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2044-12-16
AI Technical Summary
There is little research on sorghum's alkali-resistance and stress-resistance genes in existing technologies, especially the difficulty in conquering alkaline saline-alkali land, which affects agricultural production and food security.
By cloning the sorghum gene SbAIF1 and overexpressing it in sorghum, and using Agrobacterium-mediated transformation of sorghum, the expression level of the SbAIF1 gene was increased and the alkali tolerance of sorghum was enhanced.
It significantly enhanced the alkali stress tolerance of sorghum, provided new ideas for the cultivation of salt-alkali resistant transgenic plants, and improved the stress resistance and yield of crops.
Smart Images

Figure CN119684420B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a gene SbAIF1 for enhancing sorghum alkali tolerance and an application thereof. Background Art
[0002] Soil salinization, the accumulation of soluble salts in the soil surface in arid, semi-arid, and sub-humid regions, severely impacts plant growth and yield, posing a significant threat to global food security. Due to global climate change and inappropriate fertilization and irrigation practices, soil salinization is intensifying, and the area of land affected by salinization is increasing. Soil salinization has become a significant constraint on agricultural production. Researching the regulatory mechanisms of plants under alkaline stress and breeding salt- and alkali-resistant plants will benefit agricultural production and increase yields, and contribute to the management, improvement, and utilization of saline-alkali land.
[0003] Sorghum grows rapidly, produces high yields, and can adapt to infertile soils and various adverse environments. Therefore, studying its stress-resistance-related genes and clarifying their molecular mechanisms are crucial for the development of new sorghum varieties and agricultural development. With the advancement of molecular biology techniques, increasing the expression of stress-resistance genes in target crops to enhance their stress tolerance, yield, and quality has become a research priority. However, while research on sorghum's salt tolerance has been relatively limited, studies on sorghum's alkali-resistance genes have been relatively slow, leading to slow progress in developing new sorghum varieties using molecular breeding. Saline-alkali land is primarily divided into two types: neutral and alkaline. Alkaline saline-alkali land (high-pH soda-alkali land) is more challenging to develop than saline land with a neutral pH. Therefore, identifying alkali-resistance genes and cultivating salt- and alkali-resistant transgenic plants are of great significance for crop breeding and production applications.
[0004] Summary of the invention
[0005] To address these issues, the present invention provides a gene, SbAIF1, that enhances alkali tolerance in sorghum and its application. The present invention uses the CDS fragment of the sorghum gene SORBI_3003G428800 (designated SbAIF1) as an application gene, which is forward-transferred into sorghum. This increases the expression level of the SbAIF1 gene, resulting in transgenic sorghum plants with enhanced expression of the SbAIF1 gene. This provides a new approach for cultivating salt- and alkali-resistant transgenic plants.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] In a first aspect, the present invention provides use of at least one of the following (a1) to (a5) in enhancing plant alkaloid tolerance:
[0008] (a1), SbAIF1 protein;
[0009] (a2) Proteins in which one or more amino acids are substituted, deleted, or added in the amino acid sequence of the SbAIF1 protein and which have the same or similar functions as SbAIF1;
[0010] (a3), a nucleic acid molecule encoding the protein described in (a1) or (a2);
[0011] (a4) A nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule of (a3) and which can encode a protein with the same or similar functions;
[0012] (a5) a substance capable of regulating the level or activity of at least one of (a1) to (a4);
[0013] Wherein, the amino acid sequence of the SbAIF1 protein is shown as SEQ ID NO.1.
[0014] Furthermore, the plant is sorghum.
[0015] Furthermore, the sequence of the nucleic acid molecule encoding the protein shown in SEQ ID NO.1 is shown in SEQ ID NO.2; the nucleotide sequence of the SbAIF1 gene is shown in SEQ ID NO.3.
[0016] In a second aspect, the present invention provides a use of a recombinant vector in enhancing plant alkaloid tolerance, wherein the recombinant vector carries the CDS sequence of the sorghum gene SbAIF1 shown in SEQ ID NO. 2; and the plant is sorghum.
[0017] Furthermore, the sorghum gene SbAIF1 positively regulates the ability of plant alkaloid tolerance, and the plant is sorghum.
[0018] In a third aspect, the present invention provides a preparation for enhancing plant alkaloid tolerance, comprising at least one of the following (b1) to (b6):
[0019] (b1), SbAIF1 protein or a nucleic acid molecule encoding SbAIF1 protein;
[0020] (b2), an expression vector comprising a nucleic acid encoding the SbAIF1 protein;
[0021] (b3), a recombinant host containing (b2);
[0022] (b4), a promoter or enhancer that enhances SbAIF1 gene expression;
[0023] (b5), inducers that promote SbAIF1 gene expression;
[0024] (b6) Preparations for increasing the activity of SbAIF1 protein.
[0025] In a fourth aspect, the present invention provides a method for enhancing plant alkaloid tolerance, using the above-mentioned preparation to increase the level and / or activity of endogenous SbAIF1 protein in plants, or to make plants that do not contain the SbAIF1 gene or have inactivated SbAIF1 gene express SbAIF1 protein; the preparation includes SbAIF1 protein or a nucleic acid molecule encoding SbAIF1 protein; the amino acid sequence of the SbAIF1 protein is shown in SEQ ID NO.1; and the plant is sorghum.
[0026] In a fifth aspect, the present invention provides a breeding method for regulating plant alkali tolerance, wherein the breeding method comprises the following specific steps:
[0027] S1. Use primers to clone the CDS sequence of sorghum gene SbAIF1 to obtain the gene clone sequence;
[0028] S2, connect the gene clone sequence obtained in S1 with the pCAMBIA2300-GFP-BWM vector to obtain a recombinant vector;
[0029] S3, introducing the recombinant vector obtained in S2 into Agrobacterium using the freeze-thaw method to obtain recombinant Agrobacterium;
[0030] S4, infecting plants with the recombinant Agrobacterium obtained in S3 to obtain transgenic plants;
[0031] The CDS sequence of the sorghum gene SbAIF1 in S1 is shown in SEQ ID NO. 2; and the plant in S4 is sorghum.
[0032] The above method first amplifies the full-length CDS coding region of the sorghum SbAIF1 gene by PCR, then connects the CDS sequence of the SbAIF1 gene with pCAMBIA2300-GFP-BWM, and uses Agrobacterium-mediated transformation to improve the expression of the SbAIF1 gene, thereby obtaining sorghum transgenic plants overexpressing the sorghum SbAIF1 gene.
[0033] Furthermore, the nucleotide sequence of the upstream primer in the primers in S1 is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5.
[0034] SbAIF1-F:5‵- TCAATTCGAGCTCGGTACACTAGT ATGGACCATCAGCTGTTCGA-3‵(SEQ IDNO.4);
[0035] SbAIF1-R:5‵- GTTCTTCTCCTTTACTCATCGCCCCTGCTTTCTTCCTG-3‵(SEQ ID NO.5);
[0036] The underlined part is the homology arm, and the restriction enzyme cutting site of pCAMBIA2300-GFP-BWM is SpeⅠ.
[0037] Furthermore, the Agrobacterium in S3 is AGL1.
[0038] Beneficial technical effects of one or more of the above technical solutions:
[0039] (1) The experiments of the present invention have shown that the present invention discovered the sorghum gene SbAIF1 in sorghum, overexpressed the gene in sorghum, and significantly enhanced the alkaline stress tolerance of the transgenic sorghum.
[0040] (2) The present invention isolated and cloned the sorghum gene SbAIF1 for the first time, and overexpressed the SbAIF1 gene in sorghum for the first time, providing a new idea for cultivating salt-alkali resistant transgenic plants, and has important production and life significance for crop breeding and production applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.
[0042] Figure 1 This is the result of DNA verification in the T0 generation positive seedling screening in Example 1, wherein the target band length is 729 bp;
[0043] Figure 2 This is a graph showing gene expression levels in sorghum SbAIF1-overexpressing plants in Example 1;
[0044] Figure 3 This is the phenotype of the sorghum gene SbAIF1 overexpression line and the wild type under alkaline stress in Example 2;
[0045] Figure 4 This is a comparison chart of sorghum survival rates under alkaline stress conditions in Example 2. DETAILED DESCRIPTION
[0046] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.
[0047] It should be noted that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.
[0048] The present invention introduces the above-mentioned expression vector into the sorghum variety Wheatland using Agrobacterium-mediated transformation. The above-mentioned expression vector is introduced into plant cells using a highly efficient sorghum transformation system invented by our laboratory.
[0049] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manuals or conventional conditions in this area, or according to the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.
[0050] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.
[0051] Description of experimental materials involved in the examples:
[0052] The sorghum overexpression vector pCAMBIA2300-GFP-BWM was constructed in our laboratory based on the commercial vector pCAMBIA2300-UBI-GFP (purchased from Wuhan Transduction Biological Laboratory Co., Ltd., and its nucleotide sequence can be found on the website). The construction method is as follows:
[0053] 1. Insert the pCAMBIA2300-UBI-GFP vector into the SpeⅠ site
[0054] The pcambia2300-UBI-GFP vector was double-digested with KpnⅠ and Bsp1407I, and the linearized vector was purified and recovered, and its concentration was determined;
[0055] Using the pCAMBIA2300-UBI-GFP vector as a template, a GFP fragment containing the Spe I site was amplified using primers GFP-F: TCAATTCGAGCTCGGTACACTAGTATGAGTAAAGGAGAAGAAC (SEQ ID NO. 8) and GFP-R: GGTCGACTCTAGAGGATCACGCGTCTATTTGTATAGTTCATC (SEQ ID NO. 9). The amplified GFP fragment was purified and recovered, and its concentration was determined.
[0056] Homologous recombination was performed using the homologous recombinase from Novozymes Biotech Co., Ltd. to connect the linearized pCAMBIA2300-UBI-GFP vector and the GFP fragment containing the SpeⅠ site to obtain the pCAMBIA2300-UBI-GFP vector with the SpeⅠ restriction site inserted.
[0057] 2. Construction of pCAMBIA2300-GFP-BWM vector
[0058] The above vector was digested through HindIII restriction site, and the linearized vector was purified and recovered and its concentration was determined;
[0059] Using the vector pG3GB411-BWM (disclosed in the article "A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR / Cas Delivery in Maize," available on the Molecular Cloud platform) as a template, the BMW fragment was amplified using primers BWM-F: GTTCAATTTACTGATTGACCCGGGATAACTTCGTATAGCATACAT (SEQ ID NO. 10) and BWM-R: CGACGGCCAGTGCCAAGCTATAACTTCGTATAGCATA (SEQ ID NO. 11). The amplified BMW fragment was purified and recovered, and its concentration was determined.
[0060] Homologous recombination was performed using the homologous recombinase from Novozymes Biotech Co., Ltd., and the linearized vector and the BMW fragment were ligated to obtain the pCAMBIA2300-GFP-BWM vector.
[0061] The Escherichia coli and Agrobacterium tumefaciens AGL1 used in the examples were purchased from Qingdao LiGe Biotechnology Co., Ltd.
[0062] The main reagents used in the examples are:
[0063] Reverse transcription kit, gel recovery and purification kit, and plasmid extraction kit were purchased from Beijing Juhemei Biotechnology Co., Ltd.
[0064] Example 1
[0065] Construction of sorghum overexpression lines
[0066] The sorghum overexpression vector pCAMBIA2300-GFP-BWM was used, and homologous recombination was used for vector recombinant transformation. Agrobacterium-mediated infection of immature sorghum embryos was performed. To facilitate subsequent screening, sorghum overexpression experiments typically used infected wild-type Wheatland sorghum immature embryos to grow into sorghum seedlings, designated the T0 generation. The seeds obtained from the T0 generation were designated the T1 generation. Genotypes segregated in the T1 generation, and homozygous positive seedlings were selected in the T2 generation. Expression levels of different genes were then measured to identify overexpression lines with varying gene expression levels.
[0067] (1) Construction of recombinant vector
[0068] (1) Gene amplification and homologous recombination
[0069] Total RNA from wild-type wheatland sorghum was extracted using the TRIZOL method, and cDNA was obtained using a reverse transcription kit. The obtained cDNA was used as a template to amplify the full-length CDS sequence of the gene by PCR. The primer sequences used for gene amplification were:
[0070] SbAIF1-F: TCAATTCGAGCTCGGTACACTAGTATGGACCATCAGCTGTTCGA (SEQ ID NO.4);
[0071] SbAIF1-R: GTTCTCTCCTTTACTCATCGCCCCTGCTTTCTTCCTG (SEQ ID NO.5);
[0072] The homologous fragment of pCAMBIA2300-GFP-BWM was introduced by primer design at the start site (ATG) and the 3' end of the sorghum SbAIF1 gene.
[0073] The resulting amplified product was recovered from the gel and the concentration was determined. The vector was digested using the SpeⅠ restriction site and recovered from the gel. Homologous recombination was performed using the homologous recombinase from Novozymes Biotech, and the target gene was ligated to the overexpression vector pCAMBIA2300-GFP-BWM. The ligation system was as follows:
[0074] System components Volume (μL) Linearized vector 1 SbAIF1 gene amplified fragment 1 5×CE II Buffer 4 Exnase II 2 <![CDATA[ddH2O]]> Replenish to 20
[0075] The reaction solution was placed in a PCR instrument at 37°C for 30 min, then cooled to 4°C or immediately placed on ice to obtain the recombinant vector for transformation of E. coli.
[0076] (2) Preparation of competent E. coli
[0077] Escherichia coli (E. coli) DH5α strains were streaked onto LB medium plates using an inoculation loop and cultured at 37°C overnight.
[0078] Pick a fresh single colony and inoculate it into 5 mL of LB liquid medium, and culture it at 37°C with shaking at 250 rpm overnight;
[0079] Dilute 100-fold and inoculate into 50 mL LB liquid medium. Cultivate at 37°C and 250 rpm for 3-5 h until the bacteria grow into the logarithmic phase.
[0080] Transfer the bacterial solution into a 50 mL centrifuge tube and place it on ice for 10 min;
[0081] Centrifuge at 4000 rpm for 10 min at 4°C and discard the supernatant.
[0082] Resuspend the cells in 50 mL of 0.1 M CaCl2 (pre-cooled at 24°C), centrifuge at 4000 rpm for 10 min at 4°C, and discard the supernatant.
[0083] Add 25 mL of 0.1 M CaCl2 (pre-cooled at 24°C) to the precipitate, resuspend the precipitate, incubate at 4°C, 4000 rpm, for 10 min, and discard the supernatant;
[0084] Add 2.5 mL of 0.1 M CaCl2 (containing 15% glycerol) to each tube and resuspend the precipitate; dispense into 1.5 mL EP centrifuge tubes, 50 μL / tube; and store in a -80°C refrigerator for future use.
[0085] (3) Transformation of recombinant vector
[0086] Thaw competent E. coli cells on ice;
[0087] Add the ligation product to the competent cells. Add about 10 μL of the recombinant vector to 50 μL of the competent cells and gently rotate to mix. Place on ice for 30 minutes.
[0088] Heat shock in a 42°C water bath for 90 seconds without shaking, then immediately return to ice to cool for 2 minutes;
[0089] Add 600 μL LB medium and incubate at 37°C with shaking at 150 rpm for 60-90 min.
[0090] Centrifuge at 4000 rpm for 5 min at room temperature, aspirate part of the LB medium, and leave a volume of about 200 μL;
[0091] Mix the remaining liquid and precipitate, and evenly spread on an LB medium plate containing 50 mg / mL Kan resistance; culture inverted at 37°C for 12-16 hours until colonies appear.
[0092] (4) Positive colony screening and sequencing
[0093] Pick a single colony into a 1.5 mL centrifuge tube containing 0.6 mL LB (Kan resistance) and culture at 37 °C with shaking at 220 rpm for about 6 h;
[0094] Perform PCR amplification using primers SbAIF1-F / R. Take 1 μL of bacterial culture as a template and anneal at 50°C. The PCR product of a positive clone should be around 700 bp. If the clone is a false positive (vector self-ligation), there will be no PCR product.
[0095] Pick 3 positive colonies and send them to the company for sequencing. The sequence of sequencing primer 2300-R is: ACAACGTGCACAACA. The strains with correct sequencing are selected for subsequent experiments.
[0096] (5) Plasmid extraction
[0097] Pick a single E. coli colony containing the vector plasmid and culture it in LB liquid medium containing Kan resistance at 37°C with shaking at 200 rpm overnight;
[0098] Pour the bacterial solution into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, discard the supernatant, and collect the bacterial precipitate;
[0099] Remove the supernatant with a pipette, add 250 μL of Solution I (with RNase A) to the tube, and shake thoroughly.
[0100] Add 250 μL of freshly prepared Solution II, cap the tube tightly, and gently invert 2 to 3 times to mix evenly. Do not shake vigorously.
[0101] Add 350 μL of Solution III, mix thoroughly, let stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 5 min;
[0102] Column equilibration: Add 400 μL of equilibration solution BL to the adsorption column (the adsorption column is placed in the collection tube), centrifuge at 12000 rpm for 1 min, discard the filtrate in the collection tube, and put the adsorption column back into the collection tube;
[0103] Carefully transfer the supernatant to a centrifugal adsorption column, let it stand for 2 minutes, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate in the collection tube;
[0104] Add 600 μL of Buffer WB2, centrifuge at 12,000 rpm for 0.5 min at room temperature, discard the filtrate in the collection tube, and repeat the above steps once;
[0105] Centrifuge at 12000 rpm for 2 min and discard the waste liquid; dry the precipitate at room temperature for 2 min, dissolve the precipitate in 50 μL ddH2O, and store at -20°C.
[0106] (6) Preparation of competent Agrobacterium
[0107] Agrobacterium AGL1 was streaked onto LB plates containing 100 μg / mL Rif and cultured at 28°C for 36–48 h until colonies formed.
[0108] A single colony was picked and inoculated into 5 mL of LB liquid medium containing 100 μg / mL Rif, and cultured with shaking at 28°C and 250 rpm for 16–24 h.
[0109] Transfer 0.5 mL of bacterial suspension to 50 mL of LB liquid medium containing 50 μg / mL Rif and culture at 28°C, 250 rpm, with shaking until the logarithmic phase, OD600 = 0.5, for about 8-16 h.
[0110] The bacterial suspension was transferred to a 50 mL centrifuge tube, placed in an ice bath for 30 min, and centrifuged at 5000 rpm for 10 min to pellet the cells.
[0111] Add 10 mL of pre-chilled 0.15 M NaCl, gently resuspend the cells, centrifuge at 5000 rpm for 5 min at 4°C, remove the supernatant, and repeat the above steps once;
[0112] Resuspend the cells with 1 mL of pre-cooled CaCl2 containing 15% glycerol, dispense into 1.5 mL centrifuge tubes, 50 μL / tube, snap-freeze in liquid nitrogen, and store at -80°C for later use.
[0113] (7) Agrobacterium transformation and positive colony screening
[0114] Take the competent cells AGL1 frozen at -80℃ and thaw on ice; add 2μL of the plasmid to be transformed into 50-100μL competent cells, mix gently, and incubate on ice for 30 minutes;
[0115] Place the centrifuge tube in a 28°C metal bath for 5 min and in liquid nitrogen for 3 min;
[0116] Add 800 mL of LB medium, mix well, and culture at 28°C, 180 rpm, and shake for 3 h;
[0117] Centrifuge at 5000 rpm for 1 min at room temperature to pellet the cells;
[0118] Remove excess culture medium and spread approximately 200 μL onto an LB plate (containing 100 mg / L Rif and 50 mg / L Kan). Incubate the plate upside down at 28°C for 2–3 days until colonies appear.
[0119] The method for screening positive colonies was similar to that for screening positive E. coli colonies, and the positive colony pCAMBIA2300-SbAIF1-GFP-BWM was obtained. The pCAMBIA2300-SbAIF1-GFP-BWM positive Agrobacterium obtained from the above experiment was stored in a -80°C ultra-low temperature freezer for future use.
[0120] (II) Agrobacterium-mediated transformation of sorghum
[0121] (1) Configuration of different culture media
[0122] Plant inoculation medium: 4.3 g / L MS salts, 68.5 g / L sucrose, 36 g / L glucose, 0.5 g / L 2-morpholineethanesulfonic acid (MES), 1.5 mL / L 2,4-D solution, and 10 mL / L B5 vitamin mixture. Adjust the pH to 5.2, filter sterilize, and add 1 mL / L acetosyringone stock solution before use.
[0123] Plant co-culture medium: 4.3 g / L MS salts, 20 g / L sucrose, 10 g / L glucose, 0.7 g / L L-proline, 0.5 g / L MES, and 2 mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8 g / L agar powder, 10 mg / L ascorbic acid, and 10 g / L polyvinylpyrrolidone (PVPP), then autoclave. After autoclaving, cool to 50-55°C, then add 10 mL / L B5 vitamin mix and 1 mL / L acetosyringone solution.
[0124] Plant resting medium: 4.3 g / L MS salts, 30 g / L sucrose, 1.0 g / L L-proline, 0.5 g / L MES, and 1.5 mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, then autoclave. After autoclaving, cool to 50°C to 55°C. Add 100 mL / L RC stock solution and 1.6 mL / L cefotaxime solution to the medium.
[0125] Plant callus induction medium: 4.3 g / L MS salts, 30 g / L sucrose, 1.0 g / L L-proline, 0.5 g / L MES, and 1.5 mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, then sterilize by high-temperature and high-pressure sterilization. After high-temperature and high-pressure sterilization, cool it to 50°C to 55°C. Add 100 mL / L RC stock solution, 1.2 mL / L thiosporin solution, and 1 mL / L Kan solution to the medium.
[0126] Plant germination medium: 4.3 g / L MS salts, 30 g / L sucrose, 0.5 g / L MES. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, then sterilize by high-temperature and high-pressure sterilization. After high-temperature and high-pressure sterilization, cool it to 50°C to 55°C. Add 10 mL / L B5 vitamin mixture, 1 mL / L 6-BAP solution, 1 mL / L IAA solution, 1.2 mL / L thiosporin, 1.6 mL / L copper sulfate solution, and 1 mL / L Kan solution to the medium.
[0127] Plant rooting medium: 4.3 g / L MS salts, 30 g / L sucrose, 0.5 g / L MES. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, then sterilize by high temperature and high pressure. After high temperature and high pressure sterilization, cool it to 50°C to 55°C. Add 10 mL / L B5 vitamin mixture, 1.2 mL / L cefotaxime solution, 1.6 mL / L copper sulfate solution, 1 mL / L IBA solution, and 1 mL / L Kan solution to the medium.
[0128] 1 / 2MS medium: 2.4g / L MS medium, 15g / L sucrose, 0.5g / L MES, adjust the pH to 5.8. Add 8g / L agar powder to the solid medium and sterilize it by high temperature and high pressure.
[0129] LB medium: 25 g / L LB Broth, add 15 g / L agar powder to the solid medium, and sterilize at high temperature and high pressure.
[0130] (2) Transformation of sorghum by tissue culture
[0131] Prepare Agrobacterium cultures for transformation. Streak Agrobacterium strain AGL1 carrying the pCAMBIA2300-SbAIF1-GFP-BWM plasmid onto solid LB medium containing Kan and Rif and incubate at 28°C for 2 days to allow colonies to grow. Select a single colony and transfer it to liquid LB medium containing Kan and Rif and incubate overnight at 28°C with a shaker at 200 rpm. The next day, harvest the Agrobacterium cells and dilute them to an optical density (OD600 nm) of 0.4 in inoculation medium.
[0132] Isolate immature embryos. Collect immature seeds from sorghum ears 12-14 days after anthesis and sterilize their surfaces. Treat the seeds in a conical flask with a 50% (vol / vol) bleach solution (with 2-3 drops of Tween 20) for 30 minutes, then rinse 3-5 times with sterile water. Carefully separate the immature embryos from the seeds in a laminar flow hood. Select immature embryos 1.0-1.5 mm in size and place them in inoculation medium for further processing.
[0133] Transformation co-cultivation. Wash the immature embryos with fresh inoculation medium, ensuring that as little inoculation medium as possible covers the embryos. Heat shock the immature embryos in a 43°C water bath for 3 minutes, and then immediately transfer them to a 25°C metal bath for at least 2 minutes to cool them. Then, soak the washed immature embryos in the Agrobacterium suspension prepared in step (1) for 10 minutes. Transfer the treated immature embryos to the co-cultivation medium and incubate them in the dark at 25°C for 3 days.
[0134] Callus induction and selection. After step (3), the treated immature embryos were transferred to a resting medium and placed in a dark environment at 28°C for 10 days. The embryos were then transferred to a callus induction medium and cultured for 10 days under the same conditions to further induce callus formation and select positive transformants.
[0135] Germination. Transfer the surviving callus from the previous step to germination medium and incubate in a 28°C incubator with 16 hours of light and 8 hours of darkness. Transfer the callus to new germination medium every 10 days until seedlings are successfully regenerated.
[0136] Rooting. Regenerated seedlings are transplanted into glass bottles containing rooting medium and grown for 2–3 weeks under the same light conditions used for germination to allow root development. Once roots have formed, harden them for 3 days before transferring them to soil for further growth and verification of transgenic plants.
[0137] (III) Screening of homozygous sorghum overexpression lines
[0138] After the successfully transformed sorghum seeds mature and are harvested, T1 generation seeds can be obtained. The T1 generation seeds are placed in a 40°C oven to dry for 3 days, and then placed in the sun at room temperature for 10 days. The sorghum seeds are germinated after the ripening is completed, which can improve the seed germination rate.
[0139] Screening of T1 generation positive seedlings
[0140] (1) Kan screening
[0141] Sterilize the mature T1 generation seeds by first placing them in 75% ethanol for 1 minute, then using 50% sodium hypochlorite for 30 minutes, and then washing them with ddH2O 4 to 5 times.
[0142] Prepare 1 / 2MS solid culture medium, sterilize it, and when the temperature is about 50-60℃, add Kan to make the final concentration 50mg / L. Mix well and pour into a sterilized culture bottle. Air dry in a clean bench for about 1 hour.
[0143] Sterilized sorghum seeds were placed under the surface of the culture medium, sealed, and placed in an incubator at 28°C for 2 weeks with 16 h of light and 8 h of darkness;
[0144] After 2 weeks, the transgenic sorghum seedlings grew well in Kan medium, with green leaves and normal growth; the leaves of the non-transgenic sorghum seedlings turned white;
[0145] The well-grown transgenic sorghum seedlings were transferred to soft soil for growth.
[0146] (2) DNA verification
[0147] DNA was extracted from the 84 positive seedlings screened. PCR amplification was performed using the DNA as a template using primers 35S-F: ATCCTTCGCAAGACCTTC (SEQ ID NO. 6) and NPTII-R: CCAACGCTATGTCCTGATA (SEQ ID NO. 7) on the pCAMBIA2300-GFP-BWM vector to verify whether the positive seedlings in the initial screening contained the transferred recombinant vector. DNA was extracted using the CTAB method, as follows:
[0148] A small amount of sorghum leaves were placed in a 2 mL centrifuge tube, loaded with 4 mm diameter steel balls, frozen in liquid nitrogen, and crushed into powder using a high-throughput tissue grinder;
[0149] Add 500 mL of CTAB extraction buffer (1.17 M NaCL, 0.0016 M EDTA-8.0, 0.835 M Ttis-7.5, 1.6% CTAB, 1% β-mercaptoethanol) preheated to 65°C and mix well;
[0150] React in a 65°C water bath for 45 min, carefully shaking the centrifuge tube every 15 min;
[0151] Remove the centrifuge tube, cool it to room temperature, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), shake the tube carefully for 10 minutes, and let it stand for 10 minutes;
[0152] Centrifuge at 8000 rpm for 10 min at room temperature. Transfer the supernatant to another 1.5 mL centrifuge tube using a pipette tip with the tip cut off. If the supernatant is still green, repeat the previous step.
[0153] Add 2 / 3 volume of isopropanol (-20°C), carefully mix by inverting several times, and incubate at 12000 rpm, 4°C, for 10 min;
[0154] Discard the supernatant, add 400 μL of 75% ethanol, wash twice, remove the remaining ethanol with a pipette tip, and dry at room temperature until the ethanol evaporates completely;
[0155] After the DNA was dried to transparency, 20 μL of ddH O (pH 8.0) was added to dissolve the DNA;
[0156] 2 μL DNA was aspirated and added to the loading buffer. The DNA quality was tested using 1.0% agarose gel and the DNA concentration was tested using an ultra-micro spectrophotometer. The DNA was stored in a -20°C refrigerator until use.
[0157] The extracted DNA was used as a template and PCR amplification was performed using primers 35S-F: ATCCTTCGCAAGACCTTC (SEQ ID NO. 6) and NPTII-R: CCAACGCTATGTCCTGATA (SEQ ID NO. 7) on the pCAMBIA2300-GFP-BWM vector. After agarose gel electrophoresis, the target band was obtained. The results are shown in FIG. Figure 1 As shown, the plants with the target band are the plants containing the recombinant vector, and the plants without the recombinant vector are eliminated.
[0158] The plants containing the recombinant vector continue to grow until the seeds mature, and the T0 generation seeds are collected.
[0159] Identification of homozygous strains with different expression levels
[0160] (1) Identification of homozygous strains
[0161] Screening for homozygous non-segregation
[0162] Positive seedling seeds were collected from sorghum with a T1 generation positive to false positive ratio of 3:1. The T2 generation seeds harvested from individual plants were dried for 10 days, disinfected, and germinated in a 1 / 2MS medium containing Kan. 100 seeds were selected for each positive individual plant. After germination, the positive rate on the antibiotic medium was counted (because the T1 generation seeds had already separated at a ratio of 3:1, only all germinated seeds in T2 were homozygous positive strains). The strains with all green T2 generations were selected as candidate homozygous strains.
[0163] (2) Screening of homozygous strains with different expression levels
[0164] Sorghum leaves from 6 homozygous lines were selected, with 10 samples from each line. RNA was extracted from the leaves and reverse transcribed into cDNA. RT-PCR experiments were used to measure the gene expression levels of different lines. Homozygous lines with different expression levels were screened, and two lines with higher expression levels were selected, namely OE1 and OE2.
[0165] Example 2
[0166] The overexpression strain obtained in Example 1 was germinated to a size of 2 weeks and 135 mmol / L alkaline solution (NaHCO3: Na2CO3 = 5:1) with a pH of 9.4-9.6 was added. After 2 weeks of growth, it was observed that the overexpression strain grew better than the wild type, and its survival rate was significantly higher than that of the wild type. Figure 3 、 4 .
[0167] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.
Claims
1. Use of SbAIF1 protein or nucleic acid molecules encoding SbAIF1 protein in enhancing plant alkaloid tolerance; in, The amino acid sequence of the SbAIF1 protein is shown in SEQ ID NO.1; the sequence of the nucleic acid molecule encoding the SbAIF1 protein is shown in SEQ ID NO.2; The plant is sorghum.
2. Use of a recombinant vector in enhancing plant alkaloid tolerance, characterized in that: The recombinant vector carries the sorghum gene shown in SEQ ID NO.2 SbAIF1 CDS sequence; the plant is sorghum.
3. A breeding method for positively regulating plant alkali tolerance, characterized in that: The specific steps of the breeding method are as follows: S1. Use primers to identify sorghum genes SbAIF1 The CDS sequence was cloned to obtain the gene clone sequence; S2, connect the gene clone sequence obtained in S1 with the pCAMBIA2300-GFP-BWM vector to obtain a recombinant vector; S3, introducing the recombinant vector obtained in S2 into Agrobacterium using the freeze-thaw method to obtain recombinant Agrobacterium; S4, infecting plants with the recombinant Agrobacterium obtained in S3 to obtain transgenic plants; Among them, the sorghum gene described in S1 SbAIF1 The CDS sequence is shown in SEQ ID NO. 2; the plant described in S4 is sorghum.
4. The breeding method according to claim 3, wherein The nucleotide sequence of the upstream primer in the primers in S1 is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.
5.
5. The breeding method according to claim 3, wherein The Agrobacterium described in S3 is AGL1.
Citation Information
Patent Citations
Expression of transcription regulators that provide heat tolerance
CN102482683A
Expression of transcription regulators that provide heat tolerance
CN107012167A