Antibody, antibody pair and kit aiming at human MCP-1 protein and application thereof

Abstract

The invention belongs to the technical field of antibody preparation, and particularly relates to an antibody aiming at human MCP-1 protein, an antibody pair, a kit and application thereof. The antibody is a first antibody or a second antibody, amino acid sequences of light chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.3-5, and amino acid sequences of heavy chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.8-10; the amino acid sequences of light chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.13-15, and the amino acid sequences of heavy chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.18-20. The antibody provided by the invention has high affinity and sensitivity to human MCP-1 protein, has the advantages of high sensitivity, good accuracy and credibility and the like when being used for developing a double-antibody sandwich enzyme-linked immunosorbent assay system for detecting the human MCP-1 protein, and has good application value.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and in particular to an antibody, an antibody pair and a kit targeting human MCP-1 protein and uses thereof. Background Art

[0002] Monocyte Chemoattractant Protein-1 (MCP-1), also known as chemokine ligand 2 (C-Cmotifligand 2, CCL2), is a member of the CC subfamily of chemokines. Its precursor molecule structure includes a signal peptide consisting of 23 amino acids and a mature peptide consisting of 76 amino acids. The signal peptide is removed during the maturation process to form an active mature protein. The structural feature of MCP-1 is that it contains a conserved CC motif, that is, four conserved cysteines at positions 33, 34, 57, and 73. These residues are interconnected by two intrachain disulfide bonds, and this structure is crucial for its function. The main biological function of MCP-1 is to induce and promote inflammatory responses by chemotaxis and activation of immune cells, causing them to migrate to the site of inflammatory response. For example, at the site of infection, MCP-1 released by inflammatory cells forms a concentration gradient, and monocytes can move along this gradient to the infection focus to participate in inflammatory responses and the clearance of pathogens. In addition, MCP-1 can also activate intracellular signal transduction pathways, leading to the release of oxygen free radicals and cytotoxic enzymes, as well as inducing the expression of adhesion molecules and various inflammatory mediators such as IL-1, IL-6 and TNF-α, promoting the release of histamine from basophils and mast cells, regulating phagocytic function, and promoting cell apoptosis. MCP-1 can also chemotactic and activate monocytes / macrophages to secrete IL-12, thereby inducing the differentiation of initial CD4+T cells into helper T cells type 1 (Th1), thereby enhancing cellular immunity. At the same time, MCP-1 is also involved in the differentiation of neutrophils and the activation of nuclear transcription factor NF-κB, which is an important signal molecule involved in cell activation and upregulation of amyloid protein. Therefore, MCP-1 plays a key role in the occurrence and development of many diseases.

[0003] MCP-1 levels increase during inflammation and injury in a variety of diseases and can be used as an auxiliary marker for disease diagnosis. For example, in the early diagnosis of certain kidney diseases, detecting the level of MCP-1 in urine may help detect inflammation and kidney damage. In a variety of cancers, MCP-1 signals have a tumor-promoting effect; increased levels of CCL2 in patients with breast cancer, colorectal cancer, prostate cancer, etc. are usually associated with disease progression. Autoimmune diseases are often accompanied by infiltration of target tissues by lymphomyeloid cells, leading to inflammation and tissue damage, and MCP-1 and its receptor CCR2 play a key role in this process; in neurological diseases, MCP-1 and its receptor CCR2 play an important role in neurological diseases such as stroke, Alzheimer's disease, and multiple sclerosis. In addition to the above diseases, MCP-1 is also involved in the pathogenesis of a variety of diseases such as bone remodeling, hepatitis, hypertension, and diabetes. Therefore, the concentration of MCP-1 can be used as a clinical indicator to indicate the activity and prognosis of diseases such as inflammatory reactions, infections, malignancies, and autoimmune diseases.

[0004] At present, enzyme-linked immunosorbent assay (ELISA) is the most commonly used MCP-1 quantitative technology, which is suitable for cell culture supernatant, serum, urine or tissue extracts. In order to improve the sensitivity of ELISA detection, it is necessary to develop high-performance anti-human MCP-1 monoclonal antibodies. However, the anti-human MCP-1 antibodies currently available on the market all use mouse antibodies, which have problems such as poor affinity, resulting in low detection sensitivity. The credibility of the protein content detection results at extremely low concentration levels such as ng / mL to pg / mL needs to be improved. Summary of the invention

[0005] In view of the above problems existing in the prior art, the present invention provides two ideal immunodiagnostic antibodies against human MCP-1 protein and antibody pairs composed thereof, as well as a kit containing the above antibodies or antibody pairs and their uses. The antibodies provided by the present invention have high affinity and sensitivity to human MCP-1 protein. When the double antibody sandwich enzyme-linked immunosorbent assay system developed using the antibodies is used to detect human MCP-1 protein, it has the advantages of high sensitivity, good accuracy and reliability. To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0006] In a first aspect, the present invention provides an antibody against human MCP-1 protein, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementary determining regions CDR1-3 on the light chain variable region of the first antibody are shown as SEQ ID NOs.3-5, respectively, and the amino acid sequences of the complementary determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs.8-10, respectively; the amino acid sequences of the complementary determining regions CDR1-3 on the light chain variable region of the second antibody are shown as SEQ ID NOs.13-15, respectively, and the amino acid sequences of the complementary determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs.18-20, respectively.

[0007] Furthermore, the amino acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.17.

[0008] Furthermore, the amino acid sequence of the light chain of the first antibody is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.6; the amino acid sequence of the light chain of the second antibody is shown as SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.16.

[0009] Furthermore, the first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

[0010] The second aspect of the present invention provides a nucleic acid molecule, which encodes the first antibody or the second antibody as described above.

[0011] Further, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

[0012] Further, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.27 or a sequence complementary thereto.

[0013] The third aspect of the present invention provides an antibody pair against human MCP-1 protein, which consists of the first antibody and the second antibody as described above.

[0014] The fourth aspect of the present invention provides a kit for detecting human MCP-1 protein, the kit comprising the above-mentioned antibody against human MCP-1 protein or the above-mentioned antibody pair against human MCP-1 protein.

[0015] Furthermore, the kit is a double antibody sandwich ELISA kit, which includes a first antibody and a second antibody, wherein the first antibody serves as a capture antibody, the second antibody serves as a detection antibody, and the second antibody is coupled with a detection label.

[0016] The advantages and positive effects of the present invention are as follows: the present invention provides two ideal immune detection antibodies for human MCP-1 protein, which have the advantages of high affinity and sensitivity, and the affinity constant is at the level of 0.1-0.01 nM, and the two antibodies bind to different antigenic epitopes of the human MCP-1 protein. When the double antibody sandwich enzyme-linked immunosorbent assay system is developed by using the two antibodies to detect human MCP-1 protein, the antigen concentration range of 0-2000 pg / mL can be covered, and the detection limit is as low as 10.85 pg / mL. The system has the advantages of high sensitivity, good accuracy and reliability, and has good application value in the early diagnosis, long-term monitoring and prognosis evaluation of diseases related to abnormal expression of MCP-1 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 The vector map used to construct the rabbit monoclonal antibody expression vector in Example 1 of the present invention, from left to right are the pRB322 vector maps carrying the light chain constant region and the heavy chain constant region;

[0019] Figure 2This is an affinity curve diagram of the monoclonal antibody 4C2 binding to human MCP-1 protein in Example 1 of the present invention;

[0020] Figure 3 This is an affinity curve diagram of the binding of monoclonal antibody 1A5 to human MCP-1 protein in Example 1 of the present invention;

[0021] Figure 4 This is a graph showing the antigen epitope recognition of human MCP-1 protein by monoclonal antibodies 4C2 and 1A5 in Example 1 of the present invention;

[0022] Figure 5 This is the standard curve of the human MCP-1 protein double antibody sandwich ELISA system established based on monoclonal antibodies 4C2 and 1A5 in Example 2 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0025] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in the present invention to express the amount, percentage, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained according to the reported significant figures and by conventional rounding methods.

[0026] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those of ordinary skill in the art.

[0027] The terms "include", "comprising", "containing", "having" and the like are not limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0028] The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0029] The terms "first", "second", etc. are used to distinguish similar objects and are not necessarily used to describe a particular order or sequence, and it should be understood that such usage can be interchangeable under appropriate circumstances.

[0030] The terms "rabbit monoclonal antibody", "rabbit antibody" and "rabbit monoclonal antibody" and other similar terms have the same meaning. Unless otherwise specified, they all refer to rabbit antibodies that specifically bind to human monocyte chemoattractant protein-1 (MCP-1). The modifier "rabbit" indicates that the complementary determining region (CDR) of the antibody is derived from a rabbit immunoglobulin sequence. The terms "monocyte chemoattractant protein-1", "MCP-1", "CCL2", "MCP-1 / CCL2" and other similar terms have the same meaning and can be used interchangeably.

[0031] An antibody is an immunoglobulin molecule that is able to specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, as long as they exhibit the desired antigen-binding activity. An antibody fragment can be one or more parts or fragments of a full-length antibody that retain the ability of the antibody to specifically bind to a target antigen.

[0032] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types, namely κ chain and λ chain; heavy chains can be classified into five types, namely μ, δ, γ, α and ε chains, and antibodies are defined as IgM, IgD, IgG, IgA and IgE, respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences of other parts are relatively constant. The regions near the N-terminus of the light and heavy chains where the amino acid sequences vary greatly are called variable regions (V), and the regions near the C-terminus where the amino acid sequences are relatively stable are called constant regions (C). The heavy chain variable region (VH) and the light chain variable region (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity determining regions (CDRs), which are ring-shaped structures. The heavy chain CDR and the light chain CDR are closely together and cooperate with each other through the FR region, forming a surface that can complement the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the site where the antibody recognizes and binds to the antigen. The FR region is the more conservative part of VH and VL. They are generally in a β-folded configuration and are connected by three CDRs that form a connecting loop. Each VH and VL is usually composed of three CDRs and four FRs, arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0033] CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, the accumulation of both the Kabat definition and the Chothia definition, the AbM definition, the contact definition, the IMGT unique numbering definition and / or the conformational definition, or any CDR determination method known in the art. As used herein, the Kabat numbering system is used to define.

[0034] The light chain constant region (CL) and the heavy chain constant region (CH) are not directly involved in the binding of antibodies to antigens, but they exhibit different effector functions, such as participating in antibody-dependent cytotoxicity of antibodies. The length of CL of different types of Ig (κ or λ) is basically the same, but the length of CH of different classes of Ig is different, such as IgG, IgA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The amino acid sequences of the heavy chain and light chain constant regions of antibodies are well known in the art and can be obtained by querying the IMGT database.

[0035] A full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "complete antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0036] Antibody fragments are one or more parts or fragments of a full-length antibody, which substantially retain the same biological function or activity as the full-length form. Specifically, antibody fragments at least include the same CDR region as the full-length antibody, and more preferably have the same variable region, thereby retaining complete antigen recognition and binding sites, and can bind to the same antigen as the full-length antibody, especially to the same epitope. In typical examples, antibody fragments include: Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, sc(Fv)2, and these antibody fragments can be obtained by conventional techniques in the art.

[0037] (i) Fab: Antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable region and constant region) and a part of the heavy chain (variable region and the first constant region). By proteolytic cleavage of the full-length antibody, fragments such as Fab, F(ab')2, and Fab' can be obtained. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Since Fab has an antigen-binding region and a part of the constant region, it not only has the same antibody-antigen affinity and excellent tissue penetration as scFv, but also has a more stable structure.

[0038] (ii) F(ab)2: A bivalent fragment consisting of two Fabs linked by a disulfide bridge at the hinge region.

[0039] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and is composed of the variable regions of a light chain and a heavy chain. It is a dimer of VH and VL non-covalently bound (VH-VL dimer). The three CDRs of each variable region interact with each other to form an antigen binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind to antigens, although the affinity is lower than that of the intact antibody.

[0040] (iv) (Fv)2: consists of two Fv fragments covalently linked together.

[0041] (v) scFv: Single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, which is composed of a heavy chain variable region (VH) and a light chain variable region (VL) connected by a flexible linker (generally composed of 10-25 amino acids), which retains the binding specificity of the original antibody to the antigen. The linker in the present invention is not particularly limited as long as it does not hinder the expression of the antibody variable regions connected to its two ends. Compared with full-length antibodies, scFv has the characteristics of small molecular weight, so it has higher penetration and lower immune side effects.

[0042] (vi) The sc(Fv)2 fragment is composed of two heavy chain variable regions and two light chain variable regions connected via a linker or the like.

[0043] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementary determining region (CDR) and a framework region (FR) from a rabbit immunoglobulin sequence. In other embodiments, the antibody may include amino acid residues encoded by non-rabbit immunoglobulin sequences, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a portion of an antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody of a non-human antibody such as a rabbit antibody's CDR region and a human FR region. In some cases, the variable region of a non-human antibody is combined with a constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody is combined with a FR region and a constant region derived from a human antibody sequence, that is, the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence, and this framework sequence is derived from a single or multiple FR sequences of other human antibody variable regions. In the present invention, the CDR region in the chimeric antibody or humanized antibody is derived from a rabbit-derived CDR region.

[0044] The terms "monoclonal antibody" or "single antibody" and the like are used interchangeably and refer to a homogeneous antibody population, i.e., the individual antibodies constituting the population are identical except for a small amount of mutations and / or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody population and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.

[0045] The term "specific binding" is a well-known term in the art, and a molecule exhibits "specific binding" if it reacts with a specific target antigen or epitope more frequently, more rapidly, longer lastingly, and / or with greater affinity than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0046] In order to make the above-mentioned objects and advantages of the present invention more obvious and understandable, the specific implementation methods of the present invention are described in detail below.

[0047] The embodiment of the present invention provides an antibody against human MCP-1 protein, which is a first antibody or a second antibody, wherein the antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region both comprise three complementary determining regions (CDRs), which are named CDR1, CDR2 and CDR3, respectively; wherein: the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively; the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20, respectively.

[0048] The present invention uses B cell labeling and sorting technology to directly enrich and separate B cells that can recognize human monocyte chemoattractant protein-1 (MCP-1) from the spleen of immunized rabbits, and culture them in the form of single cells to directly obtain monoclonal antibodies, greatly improving the efficiency of monoclonal antibody screening and eliminating the cumbersome steps of multiple subcloning in hybridomas. Afterwards, the antibody gene secreted by B cells is expressed through recombinant technology to mass-produce the target antibody strain, which has the advantages of simple process and good product batch stability.

[0049] The two antibodies provided by the present invention can identify and bind to monoclonal antibodies of human MCP-1 protein, have the advantages of high affinity and sensitivity, and have an affinity constant of 0.1-0.01nM level, can effectively identify low-concentration antigens, and are ideal immunoassay tools. Moreover, these two antibodies bind to different epitopes of human MCP-1 protein, and are used to develop a double-antibody sandwich enzyme-linked immunosorbent (ELISA) detection system, with the first antibody as the capture antibody and the second antibody labeled with biotin as the detection antibody, to quantitatively detect the recombinant human MCP-1 protein, which can cover the antigen concentration range of 0-2000pg / mL, and the detection limit is as low as 10.85pg / mL, and can accurately detect the antigen content at the pg level, which is conducive to early diagnosis of diseases when the antigen level is low, and its wide linear detection range can adapt to the changes in antigen levels in different disease stages and different individuals, and is suitable for the detection needs of multiple scenarios. The method established by the present invention can be used for the efficient detection of MCP-1 protein in biological samples such as human serum, urine, cells, and tissues, and has the advantages of high sensitivity, good accuracy and reliability, and has good application value in the early diagnosis, long-term monitoring and prognosis evaluation of diseases related to abnormal MCP-1 protein expression.

[0050] Optionally, the light chain variable region and the heavy chain variable region each include 4 framework regions (FRs), and the 4 FRs and 3 CDRs are arranged alternately in sequence to form a variable region. The amino acid sequence of the light chain variable region (VL) of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7. The amino acid sequence of the light chain variable region (VL) of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.17.

[0051] Optionally, the rabbit monoclonal antibody of the present invention further comprises a light chain constant region and a heavy chain constant region, CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant region of the antibody is usually obtained by querying the IMGT online database.

[0052] Specifically, the amino acid sequence of the light chain (FL) of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.6. The amino acid sequence of the light chain (FL) of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.16. The light chain constant regions of the first antibody and the second antibody are both κ chains, and the heavy chain constant regions are both IgG type.

[0053] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or an antigen binding region of the full-length antibody; the antigen binding region refers to a polypeptide that substantially maintains the same biological function or activity as the full-length form of the antibody. Specifically, the antigen binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining a complete antigen recognition and binding site, and can bind to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv and sc(Fv)2. These antigen binding regions can be obtained by conventional techniques in the art.

[0054] Yet another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector comprising the aforementioned nucleic acid molecule, or a host cell comprising the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody and / or the second antibody as described above.

[0055] The nucleic acid molecule can be in the form of DNA (such as cDNA or genomic DNA or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand. The sequence of the nucleic acid molecule can be derived based on the antibody amino acid sequence by conventional means such as codon coding rules.

[0056] The full-length sequence of a nucleic acid molecule or a fragment thereof can usually be obtained by PCR amplification, recombination or artificial synthesis.

[0057] Illustratively, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

[0058] Illustratively, the nucleic acid sequence of the light chain of the first antibody is as shown in SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is as shown in SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or a sequence complementary thereto.

[0059] The original vector for constructing the recombinant vector is any conventional vector in the art, as long as it can carry the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and minichromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules to a host and multiply in a host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecules inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule. This is a well-known technology in the art.

[0060] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors, respectively, which can be introduced into the same or different host cells. When the heavy chain and the light chain are expressed in different host cells, each chain can be separated from the host cell expressing it, and the separated heavy chain and light chain are mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules of antibodies FL and FH can also be cloned into a vector, and each nucleic acid sequence is connected to a suitable promoter downstream; for example, each nucleic acid sequence encoding the heavy chain and the light chain can be operably connected to different promoters, or the nucleic acid sequence encoding the heavy chain and the light chain can be operably connected to a single promoter, so that both the heavy chain and the light chain can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibody.

[0061] The recombinant vector is transfected or transformed into the host cell using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA are harvested after the exponential growth period and treated with CaCl2 or MgCl2; they can also be transfected by microinjection, electroporation or liposome packaging. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging or particle bombardment to achieve gene introduction.

[0062] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (e.g., DH5α, JM109, BL21, W3110), Bacillus (e.g., Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (e.g., Salmonella typhimurium, Serratia marcescens), and Pseudomonas. Eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining a host cell transfected or transformed with a recombinant vector as described above, the antibody can be expressed by culturing under suitable conditions, and then separated to obtain a purified antibody.

[0063] In the present invention, the recombinant vector is transfected or transformed into the host cell using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with CaCl2 or MgCl2. If necessary, microinjection, electroporation or liposome packaging can also be used. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, as well as microinjection, electroporation, liposome packaging, etc.

[0064] Preferably, the recombinant vector is the expression vector pBR322, and the host cell is a human kidney epithelial (293F) cell.

[0065] Another embodiment of the present invention provides an antibody pair against human MCP-1 protein, which consists of the first antibody and the second antibody as described above.

[0066] The first antibody and the second antibody provided by the present invention recognize and bind to different epitopes of human MCP-1, and can be used for pairing antibodies to develop a double antibody sandwich ELISA system or a kit, which has the advantages of high sensitivity, low detection limit, wide linear range, and applicability to multiple scenarios when detecting human MCP-1.

[0067] Another embodiment of the present invention provides the use of the above-mentioned antibody or antibody pair against human MCP-1 protein in the preparation of a kit for detecting human MCP-1 protein.

[0068] The advantages of using the antibody or antibody pair against human MCP-1 protein in preparing a kit for detecting human MCP-1 protein are the same as the advantages of the antibody against human MCP-1 protein over the prior art as described above, and will not be repeated here.

[0069] Based on the same inventive concept as above, an embodiment of the present invention further provides a kit for detecting human MCP-1 protein, wherein the kit comprises the first antibody and / or the second antibody as described above.

[0070] It should be emphasized that the first antibody and the second antibody can be used separately, together, or in pairs. When detecting, if used separately or together, the first antibody and / or the second antibody are used as a primary antibody or a capture antibody, the sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be coupled (covalently or non-covalently) to a detection label, and the qualitative or quantitative detection of MCP-1 protein is achieved by analyzing the changes in the identifiable signals generated by the detection label. In other embodiments, the primary antibody of the anti-human MCP-1 protein is not labeled, and the detection label is coupled to a secondary antibody (as a detection antibody) or other molecules that can bind to the capture antibody. For example, if the anti-human MCP-1 protein antibody is a rabbit IgG antibody, the secondary antibody can be an anti-rabbit IgG antibody, thereby generating a change in the identifiable signal by coupling the secondary antibody of the detection label. When used in pairs, one of the first antibody and the second antibody is used as a primary antibody or a capture antibody, and the other is used as a secondary antibody or a detection antibody.

[0071] The detection method adopts common immunological methods, such as: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoblotting (WB), flow cytometry (FC), etc. The detection object includes recombinantly expressed and naturally secreted or expressed human MCP-1 protein by cells or tissues. The detection samples include but are not limited to serum, plasma, urine, cells or cell culture fluid, tissue or tissue homogenate, etc.

[0072] Preferably, the detection kit is a double antibody sandwich ELISA kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody), and the second antibody serves as a detection antibody (or secondary antibody) and is coupled with a detection label.

[0073] The above-mentioned detection labels for generating identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0074] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or usually under the conditions recommended by the manufacturer.

[0075] Example 1 Screening and preparation of rabbit antibodies 4C2 and 1A5 that recognize human MCP-1 protein

[0076] This embodiment is based on B cell labeling and sorting technology, directly enriching and separating B cells that can recognize the target antigen from the spleen of rabbits immunized with human MCP-1 protein, and then culturing the separated B cells in the form of single cells to obtain monoclonal antibodies 4C2 and 1A5, eliminating the cumbersome steps of preparing mouse anti-hybridomas. Finally, monoclonal antibodies 4C2 and 1A5 were mass-produced by genetic engineering recombinant expression technology. Antibody sequencing was completed by Jin Kairui Biotechnology Co., Ltd., and its amino acid (AA) sequence and gene (DNA) sequence are shown in Table 1-2, respectively. For ease of description, light chain CDR1-3 is represented by LCDR1, LCDR2 and LCDR3, respectively, and heavy chain CDR1-3 is represented by HCDR1, HCDR2 and HCDR3, respectively.

[0077] Table 1 Sequence information of rabbit monoclonal antibody 4C2 in this example

[0078]

[0079]

[0080] Table 2 Sequence information of rabbit monoclonal antibody 1A5 in this example

[0081]

[0082] The preparation method of rabbit monoclonal antibodies 4C2 and 1A5 specifically includes the following steps:

[0083] 1. Animal immunization: Human MCP-1 protein (from ABclonal, item number RP01653) was used as the immunogen, and 2 New Zealand white rabbits were immunized at 200μg / rabbit. Before the first immunization, the immunogen was mixed with an equal amount of complete Freund's adjuvant to make an emulsifier, and injected subcutaneously at multiple points in the rabbit's abdomen and back. 100μg of the immunogen was mixed with an equal amount of incomplete Freund's adjuvant to make an emulsifier, and injected subcutaneously at multiple points in the rabbit's abdomen and back at intervals of 3 weeks, and boosted twice. After three immunizations, rabbit serum samples were collected, and the titer against human MCP-1 was determined by ELISA after dilution. Rabbits with high serum titers were selected and boosted once with 200μg of the immunogen at multiple points subcutaneously. The animals were sacrificed three days later and the spleen was taken.

[0084] 2. Isolate B cells from the spleen and sort B cells: Use conventional methods to isolate B cells from the spleen, and sort out antigen-specific B cells. For related methods, please refer to the patents "Method for efficiently separating single antigen-specific B cells from spleen cells (publication number: CN110016462A, publication date: 2019-07-16)" and "A B cell in vitro culture system and application (publication number: CN111518765A, publication date: 2020-08-11)".

[0085] 3. Cloning of monoclonal antibody encoding genes: The cultured rabbit B cell supernatant was used to identify positive clones using antigen-coated ELISA. The cells of the positive clones were collected and lysed and then analyzed using Quick-RNA TM RNA was extracted using a MicroPrep kit (purchased from ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as a template, naturally paired antibody light chain variable regions (VL) and heavy chain variable regions (VH) were amplified from positive clones by PCR. PCR reaction system: 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2×Gloria HiFi (from ABclonal, catalog number RK20717) and 6.5 μL H2O; amplification program: 98°C pre-denaturation for 30 s, followed by 40 cycles of 98°C for 10 s, 64°C for 30 s, and 72°C for 30 s, and finally kept at 72°C for 5 min, and the resulting reaction solution was stored at 4°C. The primer sequences (5'-3') for amplifying VL and VH genes are as follows, where F and R represent forward and reverse primers, respectively:

[0086] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0087] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0088] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0089] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0090] The amplified products were sequenced to obtain the variable region sequence of the antibody and its encoding gene sequence; the heavy chain constant region (CH) was obtained by searching for rabbit IgG gamma C reign in the IMGT online database (www.imgt.org), and the light chain constant region (CL) was obtained by searching for rabbit IgG Kappa C reign.

[0091] 4. Production and purification of rabbit monoclonal antibodies: In order to produce antibodies on a large scale, the obtained CL and CH genes were inserted into the mammalian expression vector pBR322. The resulting vector map is shown in Figure 1 , where pBR322 origin and f1 origin are replication promoters, Ampcillin is a resistance gene, CMV promoter is a transcription promoter, SV40 PAterminator is a tailing signal, Light chain constant is the nucleic acid sequence of CL (left), and Heavy chain constant is the nucleic acid sequence of CH (right). Then, the amplified VL and VH genes were connected to the expression vector pBR322 carrying CL and CH genes linearized with XbaI and NheI restriction enzymes respectively by homologous recombination to obtain complete light chain (FL) and heavy chain (FH) gene expression vectors, and the vector construction was successfully verified by sequencing.

[0092] In order to achieve secretory expression of antibodies, signal peptide sequences need to be added to the front end of their VL and VH genes. Signal peptides can use antibody expression signal peptides commonly used in the art, such as the patent "rabbit monoclonal antibody against human interferon α2 and its application (publication number: CN116063487A, publication date: 2023-05-05)" and the patent "high affinity human IL-5 rabbit monoclonal antibody and its application (publication number: CN115819578A, publication date: 2023-03-21)" VL upstream has a signal peptide "MDTRAPTQLLGLLLLWLPGATF" or "MDTRAPTQLLGLLLLWLPGARC", and VH upstream has a signal peptide "METGLRWLLLVAVLKGVQC". Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not reflected in the antibody sequence of Table 1-2 of this embodiment.

[0093] The encoding gene of the above-mentioned signal peptide "MDTRAPTQLLGLLLLWLPGATF" can be atggacacgagggcccccact cagctgctgggtttgcttctcttgtggttgccaggcgcaacgttt; the encoding gene of the signal peptide "MDTRAPTQLLGLLLLWLPGARC" can be atggacacgagggcccccactcagctgctgggacttctgttactgtggctcccaggtgcaagatgt; the encoding gene of the signal peptide "METGLRWLLLVAVLKGVQC" can be atggagactgggctgcgctggcttctcctggttgctgtgctcaag ggagtgcagtgc or atggagactgggctgcgctggcttctcctggttgcagtgctgaagggcgtccagtgc.

[0094] The successfully constructed expression vector containing FL and FH genes was co-transfected into 293F cells and cultured for 72-96 hours after transfection. The culture supernatant was collected and the recombinant rabbit monoclonal antibody recognizing human MCP-1 protein was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100).

[0095] 5. Antibody performance testing: After obtaining multiple strains of recombinantly expressed antibodies, the antibodies are identified for affinity and antigen recognition epitopes to obtain the target antibody strains of the present invention.

[0096] 1) Identification of antibody affinity: The antigen-antibody binding curve was determined using the Gator biomolecular interaction analyzer from Probe Life to identify antibody affinity. First, the antibody was fixed on the HFC (Anti-HIgG FC) probe (purchased from Gator Bio, catalog number 160003) at a solidification concentration of 1 μg / mL; then the probe was placed in 56.733nM and 49.4nM recombinant human monocyte chemoattractant protein-1 solutions, respectively, to allow the antigen to bind to the antibody, and the affinity curves of antibodies 4C2 and 1A5 were obtained, as shown in Figure 1. Figure 2-3 , where the ordinate represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, the abscissa represents the binding time, the dark gray curve is the real-time binding value curve, and the light gray curve is the fitted average curve. The affinity constants calculated by curve fitting are shown in Table 3, where the dissociation coefficient K off The constant that characterizes the dissociation rate between antibody and antigen, the binding coefficient K on A constant that characterizes how quickly an antibody binds to its target, the affinity constant K D K off / K on The ratio of , characterizes the dissociation equilibrium constant between antibody and antigen.

[0097] Table 3 Affinity-related parameter determination results of monoclonal antibodies 4C2 and 1A5

[0098] Monoclonal antibodies <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 4C2 <![CDATA[2.55×10 -5 ]]> <![CDATA[3.47×10 5 ]]> <![CDATA[7.35×10 -11 ]]> 1A5 <![CDATA[8.73×10 -5 ]]> <![CDATA[2.41×10 5 ]]> <![CDATA[3.62×10 -10 ]]>

[0099] The dissociation equilibrium constants of antibody 4C2 and antibody 1A5 against human MCP-1 protein are 0.0735 nM and 0.362 nM, respectively, indicating that they have high affinity to the antigen protein.

[0100] 2) Identification of antigen recognition epitopes: Use Probe Life's Gator Biomolecular Interaction Analyzer to perform a pairing reaction on the obtained antibodies to test the antigen epitopes they recognize. First, the antigen protein was immobilized on the HFC probe at a concentration of 1 μg / mL. Then, the probes with the immobilized antigen protein were placed in a 3 μg / mL antibody 4C2 solution to allow antibody 4C2 (as the first antibody) and the target protein to bind to saturation. The probes were then placed in a 3 μg / mL antibody 1A5 solution to allow antibody 1A5 (as the second antibody) to bind to the target protein. By analyzing the binding characteristics of different antibodies on the antigen, the recognition epitopes of the antibodies were analyzed. The results are shown in Figure 4 , where the ordinate represents the change in thickness of the complex after the probe binds to the antibody and protein, and the abscissa represents the binding time.

[0101] from Figure 4 It can be seen that the probe immobilized with human MCP-1 can obviously bind to 1A5 after binding to 4C2. It can be seen that the two antibodies bind to different epitopes on human MCP-1. Therefore, the two antibodies can be used as paired antibodies for double antibody sandwich enzyme-linked immunosorbent assay.

[0102] Example 2 Establishment of a double antibody sandwich ELISA system based on antibodies 4C2 and 1A5 and its analytical sensitivity

[0103] Biotin labeling of antibody 1A5: Mix antibody 1A5 and biotin (purchased from Biosai Biotechnology, product number B5064) at a mass ratio of 10:1. After reacting at 2-8°C for 16-20 hours, the biotin-labeled antibody 1A5 (1A5-biotin) can be obtained.

[0104] The antibody 4C2 was used as the capture antibody and the antibody 1A5-biotin was used as the detection antibody to establish a double antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system, and the steps were as follows: 1) Coating the capture antibody 4C2: the antibody 4C2 was diluted to 1 μg / mL with 1×PBS, and 100 μL / well was added to a 96-well microplate, covered with a cover film, and incubated at 4°C for 16-20 hours; 2) Washing: after the incubation, the liquid in the well was discarded, and the plate was washed once with 1×PBST, 300 μL of the sample was added, and the liquid in the well was discarded after standing for 40 seconds; 3) Blocking: 200 μL / well of the blocking solution (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20 and 0.1% proclin 300, pH 7.0) was added to the wells. 7.2) Add to the microplate, cover with a cover film, block at 37°C for 2h, discard the blocking solution after blocking, and place in a 37°C oven to dry for 0.5-2h; 4) Add antigen protein: human MCP-1 protein (from ABclona, ​​product number RP01653) is diluted with diluent (1×PBS containing 2% BSA, 0.05% Tween 20 and 0.1% proclin 300, pH 7.2) Dilute to the following concentrations: 2000, 1000, 500, 250, 125, 62.5, 31.25, 0 pg / mL, then add to the microplate at 100 μL / well, cover with a cover film, and incubate at 37°C for 2 h; 5) Wash the plate: Same as step 2); 6) Add detection antibody 1A5: Dilute the biotin-labeled antibody 1A5 (1A5-biotin) to 0.005 μg / mL, then add to the microplate at 100 μL / well, cover with a cover film, and incubate at 37°C for 1 h; 7) Wash the plate: Same as step 2); 8) Add SA-HRP: Add 100×SA-HRP (horseradish peroxide Enzyme-labeled streptavidin, purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number SA00001-0) was diluted with the concentrate and added to the microplate at 100 μL / well, covered with a cover film, and incubated at 37°C for 0.5h; 9) Washing: Same as step 2); 10) Add TMB colorimetric solution: 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution (purchased from Tetramethylbenzidine, catalog number 4ATMB1000) was added to the ELISA plate at 100 μL / well, covered with a cover film, and incubated at 37°C for 15min; 11) Reading: Take out the microplate, add 50 μL of stop solution (1 mol / L hydrochloric acid) to each well, and read immediately with an ELISA reader.

[0105] The concentration of human MCP-1 protein is used as the horizontal axis, and the correction value of the absorbance value is Y1 (Y1 = OD 450nm -OD 630nm ) as the ordinate, see Figure 5The results showed that the detection of human MCP-1 by using antibody 4C2 as the capture antibody and antibody 1A5 as the detection antibody showed good linearity, high accuracy and good reliability. The sensitivity of the detection system was calculated by taking the average absorbance value of 16 dilution blank wells and the sum of 2 times the standard deviation as the absorbance signal value of sensitivity (see Table 4), and the detection limit was 10.85pg / mL, which has high sensitivity.

[0106] Table 4 Sensitivity of the double antibody sandwich ELISA method based on antibodies 4C2 and 1A5

[0107]

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An antibody against human MCP-1 protein, characterized in that Selected from the first antibody or the second antibody, wherein: The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 8-10, respectively; The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NOs.13-15, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs.18-20, respectively.

2. The antibody against human MCP-1 protein according to claim 1, characterized in that The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The antibody against human MCP-1 protein according to claim 2, characterized in that The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The antibody against human MCP-1 protein according to claim 1, characterized in that The first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; The antigen binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the first antibody or the second antibody as described in any one of claims 1-4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleic acid sequence of the light chain variable region of the first antibody is as shown in SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.24 or a sequence complementary thereto; The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the light chain of the first antibody is as shown in SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or a sequence complementary thereto; The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.27 or a sequence complementary thereto.

8. An antibody pair against human MCP-1 protein, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A kit for detecting human MCP-1 protein, characterized in that: The kit comprises the antibody against human MCP-1 protein according to any one of claims 1 to 4 or the antibody pair against human MCP-1 protein according to claim 8.

10. The kit for detecting human MCP-1 protein according to claim 9, characterized in that: The kit is a double antibody sandwich ELISA kit, which comprises a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is coupled with a detection label.

Images