Monascus purpureus M3 and application thereof in preparation of fermented products such as Pixian thick broad-bean sauce

Abstract

The invention relates to the field of microorganisms, and particularly discloses monascus purpureus M3 and application of the monascus purpureus M3 in preparation of fermented products such as Pixian thick broad-bean sauce and the like. The monascus purpureus M3 strain is preserved in the China Center for Type Culture Collection (CCTCC), the preservation number is CCTCC NO: M20241378, the preservation date is June 26, 2024, and the preservation address is Wuhan University, Wuhan, China. The color value of extracellular pigment produced by fermentation culture of the monascus purpureus M3 under the same condition is remarkably increased, and the content of produced extracellular lovastatin is also remarkably increased. Therefore, the monascus purpureus M3 can be applied to some fermented products and is beneficial to enhancing the color, luster, condition, nutritional value and health-care effect of the fermented products.

Description

Technical Field

[0001] The present application relates to the field of microorganisms, and more specifically, to a purple Monascus M3 (Monascus purpureus M3) and its application in the preparation of fermented products such as Pixian bean paste. Background Art

[0002] Monascus spp. belongs to the phylum Ascomycota, subphylum Anisomycetes, order Eurotiophorales, family Monascus, genus Monascus. Its mycelium and spores are used as medicine. Monascus has a history of more than 1,000 years in my country and is widely used in traditional Chinese medicine, winemaking, food coloring, etc.

[0003] The primary metabolites of purple Monascus mainly include: protease, amylase, maltase, pectinase, saccharifying enzyme, organic acid, etc., and the secondary metabolites mainly include: Monacolin K, red pigment (monascus red pigment, red pigment yellow pigment, red pigment orange pigment), lovastatin, red polysaccharide, γ-aminobutyric acid, ergosterol, etc. These secondary metabolites have a wide range of biological activities and application values, so they have become the focus of research.

[0004] The yield and quality of the metabolites of purple Monascus are affected by many factors, such as fermentation conditions, genetic characteristics of the strain, etc. In order to improve the yield and quality stability of the metabolite Monascus pigment, it is necessary to further screen excellent strains. Summary of the invention

[0005] In order to solve the above technical problems, the present application provides a purple Monascus M3 (Monascus purpureus M3) and its application in the preparation of fermented products such as Pixian bean paste.

[0006] This application adopts the following technical solutions: In the first aspect, the present application provides a purple Monascus M3 (Monascus purpureus M3), which is preserved by the China Center for Type Culture Collection, with the preservation number being CCTCC NO: M20241378, the preservation date being June 26, 2024, and the preservation address being: Wuhan University, Wuhan, China.

[0007] Furthermore, the ITS sequence of the above-mentioned Monascus purpurogenum M3 is shown in SEQ ID NO.1: (SEQ ID NO.1).

[0008] In a second aspect, the present application provides a red yeast rice fermentation agent, wherein the red yeast rice fermentation agent contains the above-mentioned purple Monascus M3 (Monascus purpureus M3).

[0009] In a third aspect, the present application provides a use of the above-mentioned Monascus purpureus M3 in the preparation of fermented food.

[0010] Furthermore, the fermented food includes any one of bean paste, soy sauce, vinegar, wine and bread.

[0011] In a fourth aspect, the present application further provides a fermented food, wherein the fermented food is obtained by fermenting the above-mentioned Monascus purpureus M3.

[0012] In a fifth aspect, the present application provides a bean paste, which is obtained by fermenting broad beans using the above-mentioned Monascus purpureus M3.

[0013] In a sixth aspect, the present application provides a method for preparing a fermented bean paste, comprising: The spores of the purple Monascus M3 are inoculated into a broad bean paste medium and fermented at 25-35° C. for 4-7 days.

[0014] Furthermore, the broad bean paste culture medium comprises: 100g broad beans and 15-30g flour.

[0015] Furthermore, the amount of spores when the spores of the purple Monascus M3 are inoculated into the broad bean paste fermented mash medium is: 1×10 5 / mL~1×10 7 Pieces / mL.

[0016] In a seventh aspect, the present application provides a method for preparing Pixian bean paste using the above-mentioned Monascus purpureus M3, comprising: (1) The spores of the purple Monascus M3 are inoculated into a broad bean paste medium, and fermented at 25-35° C. for 4-7 days to obtain a purple Monascus M3 fermentation liquid, wherein the number of spores in the purple Monascus M3 fermentation liquid is 1×10 10 -1×10 12 Pieces / mL; (2) mixing edible salt and water, and adding the purple Monascus M3 fermentation liquid to obtain a purple Monascus M3 bacterial suspension; (3) mixing the purple Monascus M3 bacterial suspension, edible salt, water and bean curd, stirring evenly and fermenting at 32-40° C. for 150-200 days to obtain sweet bean curd; (4) Mix the sweet peppers with pepper embryos, add the purple Monascus M3 bacterial suspension and mix evenly, ferment at room temperature for 150-200 days, add edible salt and water, and obtain Pixian bean paste.

[0017] Furthermore, in the above step (2), the mass ratio of edible salt, glucose and water is 4-7:2:100.

[0018] Furthermore, in the above step (3), the amount of the above-mentioned bean curd, edible salt, water, and purple Monascus M3 bacterial suspension is 1000:510:1650:70-140 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M3 bacterial suspension; Furthermore, in the above step (4), the ratio of sweet pepper peel: pepper embryo: purple Monascus M3 bacterial suspension is 30:70:5-7.

[0019] In summary, this application has the following beneficial effects: 1. This application screened single colonies with typical morphological characteristics of Monascus from red yeast rice samples from farmers in Fujian, further streaked and cultured, and obtained 8 purified strains. After repeated screening, strain M3 that can produce high yields of red yeast pigment and extracellular lovastatin was obtained. By sequencing the PCR amplification products of the strain, performing BLAST comparison analysis on the spliced ​​sequencing results and the NCBI database and constructing an evolutionary tree, it was determined that strain M3 was purple Monascus M3.

[0020] 2. Compared with the existing purple Monascus and other strains screened, the purple Monascus M3 has a significantly improved color value of extracellular pigment produced by fermentation culture under the same conditions, and the content of extracellular lovastatin produced has also increased significantly. This shows that the purple Monascus M3 can be applied to some fermented products, such as bean paste, soy sauce, vinegar, wine and bread, etc., and the extracellular pigment produced has a certain antibacterial effect and can effectively improve the color of the fermented products; the extracellular lovastatin produced has the biological activity of lowering blood lipids and preventing atherosclerosis, which helps to enhance the nutritional value and health care effect of such fermented products.

[0021] 3. The present application provides a Pixian bean paste obtained by fermenting broad beans with purple Monascus M5 (Monascus purpureus M5). The purple Monascus M5 has good salt tolerance and can remain active in an environment with a salt content of 10-12%. It ferments bean paste, a mixture of sweet bean paste and pepper embryos. On the one hand, due to the high red pigment production of purple Monascus M5, the obtained Pixian bean paste has a better color; on the other hand, due to the purple Monascus M5 belonging to Monascus, the Pixian bean paste can have the health benefits of dehumidification, blood circulation and lipid reduction. At the same time, the fermentation flavor and amino acid content of Pixian bean paste can be further increased, and the quality of Pixian bean paste can be improved, especially the color, aroma and taste indicators all meet the special index requirements for Pixian bean paste in GB / T 20560-2006 "Geographical Indication Product Pixian Bean Paste". BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The colony morphology of Monascus purpurogenus M3 provided in Example 2 of the present application; Figure 2 The microscopic morphology of Monascus purpurogenus M3 provided in Example 2 of the present application; Figure 3 This is a phylogenetic tree analysis diagram of Monascus purpurogenum M3 provided in Example 2 of the present application. DETAILED DESCRIPTION

[0023] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0024] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0025] Example 1 This example provides the screening process of purple Monascus strains 1. Preparation of culture medium The screening medium is a PDA solid medium, and the specific preparation method is: weigh 200.0g of potatoes, peel and cut into pieces, add distilled water, boil for 20-30min, filter with double-layer gauze, add 20.0g of glucose and 15.0-20.0g of agar, and dilute to 1000mL with distilled water. Sterilize at 121℃ for 15min.

[0026] 2. Enrichment and purification Under sterile conditions, 5 g of Fujian farmer's red yeast rice sample and sterilized glass beads were added to a conical flask containing 45 mL of 0.85% NaCl, and the mixture was shaken on a constant temperature oscillator for 10 minutes. The mixture was then filtered through a glass funnel filled with sterile cotton to obtain a 10-1 dilution. After 10-fold gradient dilution, an appropriate amount of the dilutions of different concentrations were spread on a PDA solid culture medium, and cultured in a 30°C incubator for 3 to 5 days. Single colonies with typical morphological characteristics of Monascus were picked, and further streaked for 3 to 5 times to obtain 15 purified strains (numbered M1 to M8), which were finally inoculated into slant test tubes and stored in a 4°C refrigerator.

[0027] 3. Screening The purified strain was spotted on a PDA plate and cultured at 30°C for 6 days. The growth status of each strain was observed and screened, and finally the strain M3 of the present application was obtained.

[0028] Example 2 This example provides the identification process of the strain 1. Bacterial morphological characteristics After the strain M3 was cultured on a PDA plate at 30°C for 6 days, Figure 1 As shown, the colonies are relatively flat, localized in growth, velvety, flocculent in the middle, dry and opaque on the surface, with wrinkles, initially milky white, then pink, and then orange-red.

[0029] 2. Microscopic observation characteristics The strain M3 was placed under a microscope for observation. Figure 2 As shown, microscopic observation showed that the hyphae had septa, many branches, spherical thecothecia, ellipsoidal ascospores, and purple crystals on the surface and inside of the hyphae.

[0030] (3) Gene sequence analysis The genomic DNA of the strain was extracted using the 2×T5 Direct PCR Kit (Plant). The specific steps are as follows: add 50 μL of Lysis Buffer A to a 2 mL centrifuge tube, scrape a small amount of non-spore-producing mycelium on the PDA medium with an inoculation loop and place it in a centrifuge tube, incubate at 95°C for 30 min, centrifuge at 1000 g for 1 min, and take the supernatant as the template for the reaction system. The ITS fragment of the DNA was PCR amplified using the universal primers ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3'. The PCR amplification reaction system: 2×T5 Direct PCR Mix (Plant) 12.5 μL, template DNA 1 μL, ITS1 and ITS4 1 μL each, and sterile ultrapure water 9.5 μL. PCR amplification reaction conditions: 98℃3min; 98℃10s, 60℃10s, 72℃10s, 30× cycles; 72℃5min; 4℃ storage. The PCR amplification products were sequenced, and the spliced ​​sequencing results were compared with the NCBI database by BLAST. Phylogenetic analysis was performed using MEGA 7.0 software, and the molecular evolutionary tree was constructed using the NJ (neighbor-joining method). The evolutionary tree branches were self-checked 1000 times using the bootstrap method (Bootstrap values).

[0031] The ITS rDNA sequence of strain M3 is shown in SEQ ID NO.1: TTCCGTAGGGTGACCTGCGGAAGGATCATTACCGAGTGCGGGTCCCCTTCGTGGGACCC AACCTCCCACCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGC CGGAGACATCTTCTCGAACGCTTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCA AATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC ATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAG CGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCG AAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCA GTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAA (SEQ ID NO. 1).

[0032] The ITS rDNA sequence of strain M3 was 571 bp in length. The BLAST analysis and phylogenetic tree ( Figure 3 ) analysis showed that it was clustered in the same branch with Monascus purpureus (AY498573.1), Monascus aurantiacus (AY629435.1) and Monascuspilosus (MH855524.1), and the homology was more than 99%. Combined with the colony morphology and microscopic morphology, strain M3 was determined to be Monascus purpureus M3.

[0033] Example 3 Determination of extracellular pigments and extracellular lovastatin produced by Monascus purpurogenus 1. Culture medium preparation A culture medium simulating soybean paste was used, and its formula was as follows: 100 g broad beans, 20 g flour, 1 L distilled water was added and boiled for 10 min, and the mixture was aseptically filtered into a conical flask.

[0034] 2. Fermentation of purple Monascus The screened purple Monascus (M1-M8) was inoculated into an agar slant medium and cultured at 28°C for 4 days. The mature slant spores were made into a suspension, inoculated into a flat bottle solid culture medium, and cultured at 28°C for 10 days to obtain a spore liquid of purple Monascus.

[0035] The spore liquid of purple Monascus was 10 6The spores were inoculated into the simulated fermented mash medium and fermented at 30 °C for 5 days to obtain the fermentation broth (among which, the spores of Monascus purpurogenus M3 were 1×10 11 / mL).

[0036] The color value of the extracellular pigment and the content of extracellular lovastatin in the fermentation broth were determined. The content of extracellular lovastatin was determined by HPLC; the color value of the extracellular pigment was determined by: Adopt GB1886.19-2015 "Food Additive Red Yeast Rice" method: Take the fermentation liquid of purple Monascus, remove the bacteria and impurities by centrifugation or filtration, and obtain an extracellular pigment solution. Dilute the extracellular pigment solution with ethanol to an appropriate concentration, measure the color value of the red component at a wavelength of 505nm, and measure the absorbance at 410nm and 465nm respectively according to the characteristics of the yellow component and the orange component in the Monascus pigment having absorption peaks at 410nm and 465nm. The color value = (OD410+OD465+OD505) × dilution factor / sample mass (g).

[0037] The results are shown in Table 1: Table 1. Results of determination of extracellular pigments and extracellular lovastatin As can be seen from Table 1, the color value of the extracellular pigment and the concentration of lovastatin of M3 and M5 in the strains screened in the present application are higher than those of other strains, among which the effect of M3 is stronger than that of M5.

[0038] Example 4 This embodiment provides an application of purple Monascus M3 in fermenting bean paste (1) Prepare broad bean paste medium according to the recipe: 100 g broad beans, 15 g flour, add 1 L distilled water and boil for 10 min.

[0039] (2) The spore liquid of Monascus purpurogenum M3 was obtained by the method of Example 3.

[0040] (3) The spore liquid of Monascus purpurogenus M3 was diluted to 10 5 The spores were inoculated into broad bean paste medium and fermented at 25 °C for 7 days to obtain fermented bean paste liquid, in which the number of spores was 1×10 10 Pieces / mL.

[0041] Example 5 This embodiment provides an application of purple Monascus M3 in fermenting bean paste (1) Prepare broad bean paste medium according to the recipe: 100 g broad beans, 30 g flour, add 1 L distilled water and boil for 10 min.

[0042] (2) The spore liquid of Monascus purpurogenum M3 was obtained by the method of Example 3.

[0043] (3) The spore liquid of Monascus purpurogenus M3 was diluted to 10 7 The fermented bean curd liquid was obtained by inoculating 1×10 spores / mL into fermented mash medium and fermenting at 35°C for 4 days. 12 Pieces / mL.

[0044] Example 6 This embodiment provides a purple Monascus M3 for the preparation of Pixian bean paste, and the specific steps are as follows: S1: Broad bean pretreatment Screen out peeled dry broad beans without diseases and insect pests, blanch them in 90-98° C. hot water for 2-6 minutes at a mass ratio of peeled dry broad beans to water of 1:6, and then cool the blanched broad beans to 35° C. with cold water to obtain pretreated broad bean petals; S2: Koji making The pre-treated broad bean paste is mixed with wheat flour and koji extract to obtain a mixture I, and the temperature of the mixture I is controlled at 37°C. The relative humidity was 84% ​​and the koji was made for 48 hours to obtain bean curd; The amount of the pre-treated broad bean, wheat flour and koji extract is such that the mass ratio of dry broad beans used to prepare the pre-treated broad bean: wheat flour: koji extract is 1000:100:0.1; S3: Preparation of Monascus purpurogenum M3 bacterial suspension Edible salt and water were mixed evenly to obtain a mixed solution, and then the purple Monascus M3 fermentation liquid (the number of spores was 1×10 11 / mL), and then let it stand for 15min to obtain a purple Monascus M3 bacterial suspension.

[0045] The amount of edible salt and water in the above-mentioned mixture is based on a mass ratio of edible salt to water of 6:100; S4: Making sweet potatoes Put the bean curd into a fermentation container, add edible salt, water, and purple Monascus M3 bacterial suspension (Example 3) in sequence, stir evenly and ferment at 32-40° C. for 180 days to obtain sweet bean curd; The dosage of the above-mentioned bean curd, edible salt, water, and purple Monascus M3 suspension is 1000:510:1650:100 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M3 suspension; S5: Pepper pretreatment The removed chili peppers are cleaned with water and then crushed (with salt or brine) to obtain chili sauce; The maximum diameter of the chili pieces in the obtained chili sauce is 40 mm, and the salt content of the crushed chili sauce is 15-18%; S6: Pixian Doubanjiang semi-finished product fermentation The purple Monascus M3 bacterial suspension obtained in S3, the sweet bean sprouts obtained in S4, and the pepper embryos obtained in S5 are mixed evenly, and then fermented at room temperature for 180 days to obtain a semi-finished Pixian bean sprout; The mixing ratio of sweet scallion, pepper embryo and purple Monascus M3 bacterial suspension is calculated according to the mass ratio: sweet scallion: pepper embryo: The suspension ratio of Monascus purpurogenum M3 is 30:70:6.

[0046] S7: Pixian Doubanjiang finished product Edible salt and water are added to the semi-finished Pixian bean paste obtained in S6, and the mixture is stirred and mixed to obtain a finished Pixian bean paste. The amount of edible salt and water added is calculated based on the total acid ≤2.0%, amino acid nitrogen ≥0.18%, edible salt (calculated as sodium chloride) 15-22%, and water ≤60% in the finished Pixian bean paste.

[0047] Example 7 This embodiment provides a preparation process of purple Monascus M3 for Pixian bean paste, which is different from that of embodiment 6 in that: S4: making sweet bean paste: The dosage of the above-mentioned bean curd, edible salt, water, and purple Monascus M3 suspension is 1000:510:1650:70 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M3 suspension.

[0048] Example 8 This embodiment provides a preparation process of purple Monascus M3 for Pixian bean paste, which is different from that of embodiment 6 in that: S4: making sweet bean paste: The dosage of the above-mentioned bean curd, edible salt, water, and purple Monascus M3 suspension is 1000:510:1650:140 according to the dry broad beans corresponding to the pretreated broad beans used to prepare the bean curd: edible salt: water: purple Monascus M3 suspension.

[0049] Example 9 This embodiment provides a preparation process of Pixian bean paste using purple Monascus M3, which is different from that of embodiment 6 in that: S6: fermentation of semi-finished Pixian bean paste The mixing ratio of sweet petals, pepper embryos and purple Monascus M3 bacterial suspension is calculated according to the mass ratio, and the sweet petals: pepper embryos: purple Monascus M3 bacterial suspension is 30:70:5.

[0050] Example 10 This embodiment provides a preparation process of Pixian bean paste using purple Monascus M3, which is different from that of embodiment 6 in that: S6: fermentation of semi-finished Pixian bean paste The mixing ratio of sweet petals, pepper embryos and purple Monascus M3 bacterial suspension is calculated according to the mass ratio, and the sweet petals: pepper embryos: purple Monascus M3 bacterial suspension is 30:70:7.

[0051] Comparative Example 1 During the fermentation of Pixian bean paste, no purple Monascus M3 bacterial suspension was added, and the rest was the same as in Example 6.

[0052] Comparative Example 2 During the fermentation of Pixian bean paste, the purple Monascus M3 bacterial suspension is added only in the S4 sweet bean paste making sub-step, and the purple Monascus M3 bacterial suspension is not added in the S6 Pixian bean paste semi-finished product fermentation step. The rest is the same as Example 6.

[0053] Comparative Example 3 During the fermentation of Pixian bean paste, the purple Monascus M3 bacterial suspension is not added in the S4 sweet bean paste making sub-step, and the purple Monascus M3 bacterial suspension is only added in the S6 Pixian bean paste semi-finished product fermentation step. The rest is the same as Example 6.

[0054] The Pixian bean paste obtained in Example 6 of the present application and Comparative Examples 1-3 were evaluated respectively, and the evaluation results are shown in Table 1: Table 1. Evaluation results of Pixian bean paste As shown in Table 1, compared with Comparative Example 1, the Pixian Doubanjiang provided in Example 6 of the present application has a more ruddy color, better aroma and taste, and an increase of 10-40% in the content of amino acid nitrogen, and in particular, the aroma and taste indexes meet the special index requirements for Pixian Doubanjiang in GB / T20560-2006 "Geographical Indication Product Pixian Doubanjiang". However, in Comparative Examples 2 and 3, since the purple Monascus M3 bacterial suspension was added only in the sweet sub-step or the semi-finished product fermentation step, the color, flavor and amino acid nitrogen content of the obtained Doubanjiang are all weaker than those of Example 6.

[0055] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A purple Monascus M3 (Monascus purpureus M3), characterized in that: It is preserved by China Center for Type Culture Collection, the preservation number is CCTCC NO: M20241378, the preservation date is June 26, 2024, and the preservation address is: Wuhan University, Wuhan, China.

2. The Monascus purpureus M3 according to claim 1, characterized in that The ITS sequence of the purple Monascus M3 is shown in SEQ ID NO.

1.

3. A red yeast rice fermentation agent, characterized in that: The red yeast rice fermentation agent contains the purple red yeast rice M3 (Monascus purpureus M3) as claimed in claim 1 or 2.

4. Use of the Monascus purpureus M3 according to claim 1 in preparing fermented food.

5. The use according to claim 4, characterized in that: The fermented food comprises any one of bean paste, soy sauce, vinegar, wine and bread.

6. A fermented food, characterized in that: The fermented food is obtained by fermenting the Monascus purpureus M3 as claimed in claim 1 or 2.

7. A bean paste, characterized in that: The bean paste is obtained by fermenting broad beans with the Monascus purpureus M3 as claimed in claim 1 or 2.

8. A method for preparing fermented bean paste, characterized in that: It includes: The spores of the purple Monascus M3 as claimed in claim 1 or 2 are inoculated into a broad bean paste medium and fermented at 25-35° C. for 4-7 days.

9. The method for preparing fermented bean paste according to claim 8, characterized in that: The broad bean paste culture medium comprises: 100 g / L broad beans and 15-30 g / L flour.

10. A method for preparing Pixian bean paste using the Monascus purpureus M3 according to any one of claims 1 to 3, characterized in that: It includes: The spores of the purple Monascus M3 are inoculated into a broad bean paste medium, and fermented at 25-35° C. for 4-7 days to obtain a purple Monascus M3 fermentation liquid. The number of spores in the purple Monascus M3 fermentation liquid is 1×10 10 -1×10 12 Pieces / mL; After mixing edible salt and water, add the purple Monascus M3 fermentation liquid to obtain a purple Monascus M3 bacterial suspension; The purple Monascus M3 bacterial suspension, edible salt, water and bean curd are mixed, stirred evenly and fermented at 32-40° C. for 150-200 days to obtain sweet bean curd; The sweet bean paste is mixed with pepper embryos, and then the purple Monascus M3 bacterial suspension is added and mixed evenly, and fermented at room temperature for 150-200 days, and then edible salt and water are added to obtain Pixian bean paste.

Images