Attenuated vaccine resistant to tomato chlorosis virus and tomato yellow leaf curl virus as well as construction method and application of attenuated vaccine

Abstract

The invention belongs to the technical field of vaccine preparation, and particularly relates to an attenuated vaccine resistant to tomato chlorosis virus and tomato yellow leaf curl virus as well as a construction method and application of the attenuated vaccine. The attenuated vaccine comprises a tomato chlorosis virus resistant mutant and a tomato yellow leaf curl virus resistant mutant, the mutant resistant to the tomato chlorotic virus comprises a gene segment which is any one of gene segments as shown in SEQ ID NO.1-5. The mutant resistant to the tomato chlorotic virus is a mutant resistant to the tomato chlorotic virus. The mutant resistant to the tomato yellow leaf curl virus comprises a gene segment as shown in SEQ ID NO. 6 or SEQ ID NO. 7. The vaccine prepared according to the method disclosed by the invention not only can resist skeleton vector viruses, but also can resist tomato chlorosis viruses and tomato yellow leaf curl viruses, and provides technical support for prevention and treatment of single infection and composite infection of ToCV and TYLCV.

Description

Technical Field

[0001] The invention belongs to the technical field of vaccine preparation, and in particular relates to an attenuated vaccine capable of resisting tomato chlorosis virus and tomato yellow leaf curl virus, and a construction method and application thereof. Background Art

[0002] Tomato chlorosis virus (ToCV) and tomato yellow leaf curl virus (TYLCV) mainly infect Solanaceae crops. Currently, the occurrence scope and severity of ToCV and TYLCV are increasing year by year, and the two are very likely to cause complex infection in the field, which has caused serious economic losses to my country's tomato-growing areas and greatly hindered the development of my country's tomato industry.

[0003] Attenuated vaccine prevention and treatment based on the principle of cross-protection is currently an effective strategy for controlling viral diseases. Cross-protection is the use of attenuated mutants to infect and induce the plant's own immune system to prevent and control later infections with the same type of strong virus strains. An attenuated mutant can only be used to prevent and control the corresponding strong virus, and cannot prevent and control different viruses at the same time. The vaccine for the prevention and treatment of two viruses disclosed in the prior art is a attenuated vaccine that uses a heterologous virus fragment inserted into the backbone virus to achieve both prevention and treatment of the backbone virus and the virus corresponding to the inserted fragment. This vaccine has a weak ability to prevent and control viruses, and few types of viruses. It cannot achieve the ability to prevent and control two or more heterologous viruses other than the backbone virus.

[0004] Based on this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide an attenuated vaccine that can prevent and control two or more heterologous viruses in addition to the backbone virus, and in particular, to provide an attenuated vaccine that can prevent and control both tomato chlorosis virus and tomato yellow leaf curl virus, and a construction method and application thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an attenuated vaccine that is resistant to both tomato chlorosis virus and tomato yellow leaf curl virus. The attenuated vaccine comprises a mutant resistant to tomato chlorosis virus and a mutant resistant to tomato yellow leaf curl virus.

[0008] The tomato chlorosis virus-resistant mutant comprises a gene fragment of the tomato chlorosis virus and an empty vector;

[0009] The gene fragment of the tomato chlorosis virus is any one of the gene fragments shown in SEQ ID NO.1 to 5, and the empty vector is a vector containing CMV Fnythe mutant RNA2 or TRV of the isolate;

[0010] The tomato yellow leaf curl virus-resistant mutant comprises a gene fragment of tomato yellow leaf curl virus and an empty vector;

[0011] The gene fragment of the tomato yellow leaf curl virus is shown in SEQ ID NO.6 or SEQ ID NO.7, and the empty vector contains CMV Fny Isolate mutant RNA2 or mutant TRV.

[0012] Preferably, the CMV Fny The mutant RNA2 of the isolate was pCC F R2-2bPTII vector;

[0013] The mutant type of TRV is TRV2-Vector vector.

[0014] Preferably, the primer pair for amplifying the gene fragment shown in SEQ ID NO.1 is shown in SEQ ID NO.8-9 or SEQ ID NO.10-11;

[0015] The primer pair for amplifying the gene fragment shown in SEQ ID NO.2 is shown in SEQ ID NO.12-13 or SEQ ID NO.14-15;

[0016] The primer pair for amplifying the gene fragment shown in SEQ ID NO.3 is shown in SEQ ID NO.16-17 or SEQ ID NO.18-19;

[0017] The primer pair for amplifying the gene fragment shown in SEQ ID NO.4 is shown in SEQ ID NO.20-21 or SEQ ID NO.22-23;

[0018] The primer pair for amplifying the gene fragment shown in SEQ ID NO.5 is shown in SEQ ID NOs.24-25 or SEQ ID NOs.26-27.

[0019] Preferably, the primer pair for amplifying the gene fragment shown in SEQ ID NO.6 is shown in SEQ ID NO.28-29 or SEQ ID NO.30-31;

[0020] The primer pair for amplifying the gene fragment shown in SEQ ID NO.7 is shown in SEQ ID NOs.32-33 or SEQ ID NOs.34-35.

[0021] The present invention also provides a method for constructing the attenuated vaccine, comprising the following steps:

[0022] (1) Using the genome of tomato chlorosis virus as a template, amplify the corresponding gene fragment using primer pairs;

[0023] (2) double-digesting the gene fragment and the empty vector described in step (1) and then ligating them to obtain a mutant resistant to tomato chlorosis virus;

[0024] (3) Using the genome of tomato yellow leaf curl virus as a template, amplify the corresponding gene fragment using primer pairs;

[0025] (4) double-digesting the gene fragment and the empty vector described in step (3), and then ligating them to obtain a mutant resistant to tomato yellow leaf curl virus;

[0026] (5) Mix the mutants resistant to tomato chlorosis virus and the mutants resistant to tomato yellow leaf curl virus to obtain a attenuated vaccine.

[0027] Preferably, the restriction sites for the double enzyme digestion in step (2) are BamHI and SmaⅠ or BamHI and XbaⅠ.

[0028] Preferably, the restriction sites for the double enzyme digestion in step (4) are BamHI and SmaⅠ or BamHI and XbaⅠ.

[0029] The present invention also provides the use of the attenuated vaccine in preparing a product that is resistant to both tomato chlorosis virus and tomato yellow leaf curl virus.

[0030] The present invention also provides a kit for resisting tomato chlorosis virus and tomato yellow leaf curl virus, wherein the kit comprises an attenuated vaccine for resisting tomato chlorosis virus and tomato yellow leaf curl virus;

[0031] The attenuated vaccine that is resistant to both tomato chlorosis virus and tomato yellow leaf curl virus is the attenuated vaccine or the attenuated vaccine constructed according to the construction method.

[0032] The present invention also provides a method for resisting tomato chlorosis virus and tomato yellow leaf curl virus, comprising the following steps:

[0033] The attenuated vaccine is inoculated into crops to obtain crops that are resistant to tomato chlorosis virus and tomato yellow leaf curl virus; the attenuated vaccine is the attenuated vaccine described above or the attenuated vaccine constructed according to the construction method described above.

[0034] The crop is a Solanaceae crop or Nicotiana benthamiana.

[0035] The present invention provides a attenuated vaccine against tomato chlorosis virus and tomato yellow leaf curl virus and a construction method and application thereof. The present invention is based on the attenuated vaccine containing CMV Fny Plasmid vector pCCF R2-2bPTII vector and TR V2-Vector plasmid vector based on TRV modification were used to construct a total of 14 insertion-type attenuated mutants of target ToCV and TYLCV. These mutants can be stably inherited and cross-protected in both Nicotiana benthamiana and tomato plants. Mixed inoculation of two heterologous virus fragment mutants based on the same vector can expand the prevention and control range of attenuated vaccines. It can not only prevent and control vector viruses, but also two heterologous viruses. There is no significant difference between the prevention effect of single infection of target viruses and the single-dose prevention effect of the components; for compound infection of target viruses, the average content of viruses in plants can be controlled at about 30% of the compound infection control plants. It provides technical support for the prevention and control of single infection and compound infection of ToCV and TYLCV. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 CMV Fny Schematic diagram of RNA2 and 2b protein translation premature termination type RNA2 mutant and ToCV insertion type mutant (the left figure is CMV Fny RNA2 and 2b protein translation premature termination type RNA2 mutant, the right picture is the ToCV insertion type mutant);

[0037] Figure 2 Pathogenicity analysis and stability detection of Nicotiana benthamiana inoculated with a CMV attenuated mutant containing a 200 bp ToCV fragment for 14 days (Figure A represents the pathogenicity analysis of the ToCV-inserted CMV mutant for 14 days, and Figure B represents the stability analysis of the ToCV-inserted CMV mutant for 14 days; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0038] Figure 3 Pathogenicity analysis and stability detection of Nicotiana benthamiana 35 days after inoculation of CMV attenuated mutant containing 200 bp ToCV fragment (Figure A represents the pathogenicity analysis of ToCV inserted CMV mutant at 35 days, and Figure B represents the stability analysis of ToCV inserted CMV mutant at 35 days; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0039] Figure 4The cross-protection effect and stability analysis of ToCV-inserted CMV mutants against ToCV (Figure A shows the cross-protection effect of ToCV-inserted CMV mutants against ToCV; Figure B shows the effect of ToCV-inserted CMV mutants on ToCV virus expression, "*" represents P value < 0.05, "**" represents P value < 0.01; Figure C shows the stability analysis results of ToCV-inserted CMV mutants; Figure D shows ToCV virulent PCR detection; CK represents the ToCV virus accumulation in healthy plants after ToCV virulent infection, mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0040] Figure 5 CMV Fny Schematic diagram of RNA2 and 2b protein translation premature termination type RNA2 mutant and TYLCV insertion type mutant;

[0041] Figure 6 Pathogenicity analysis and stability detection of Nicotiana benthamiana inoculated with CMV attenuated mutants containing TYLCV fragments for 14 days (A represents the pathogenicity analysis of TYLCV-inserted CMV mutants for 14 days; B represents the stability analysis of TYLCV-inserted CMV mutants for 14 days; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0042] Figure 7 Pathogenicity analysis and stability detection of Nicotiana benthamiana inoculated with CMV attenuated mutants containing TYLCV fragments for 35 days (A represents the pathogenicity analysis of TYLCV-inserted CMV mutants for 35 days; B represents the stability analysis of TYLCV-inserted CMV mutants for 35 days; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0043] Figure 8The cross-protection effect and stability analysis of TYLCV-inserted CMV mutants against TYLCV (A represents the cross-protection effect of TYLCV-inserted CMV mutants against TYLCV; B represents the effect of TYLCV-inserted CMV mutants on TYLCV virus expression; "**" represents P value < 0.01; C represents stability analysis of TYLCV-inserted CMV mutants; D represents TYLCV virulent PCR detection; CK represents the virus accumulation of TYLCV in healthy plants after TYLCV virulent infection, mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0044] Fig. 9 Schematic diagram of TRV basic vector and ToCV insertion mutant (left picture is TRV basic vector, right picture is inserted viral gene and insertion mutant);

[0045] Fig.10 Pathogenicity analysis and stability detection of TRV attenuated mutants containing 200 bp ToCV fragments inoculated with Nicotiana benthamiana for 14 days (A represents the pathogenicity analysis of ToCV-inserted TRV mutants for 14 days; B represents the stability analysis of ToCV-inserted TRV mutants for 14 days; mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNA Marker DL2000);

[0046] Fig.11 Pathogenicity analysis and stability detection of TRV attenuated mutant containing 200bp ToCV fragment inoculated with Nicotiana benthamiana for 35 days (A represents pathogenicity analysis of ToCV inserted TRV mutant for 35 days; B represents stability analysis of ToCV inserted TRV mutant for 35 days; mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNA Marker DL2000);

[0047] Fig.12Cross-protection effect and stability analysis of ToCV-inserted TRV mutants against ToCV (A represents the cross-protection effect of ToCV-inserted TRV mutants against ToCV; B represents the effect of ToCV-inserted TRV mutants on the expression of ToCV virus; "*" represents P value < 0.05, "**" represents P value < 0.01 (the vertical axis represents the expression of ToCV virus); C represents stability analysis of ToCV-inserted TRV mutants; D represents ToCV virulent PCR detection; CK represents the ToCV virus accumulation in healthy plants after ToCV virulent infection, mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNA Marker DL2000);

[0048] Fig.13 Schematic diagram of TRV basic vector and TYLCV insertion mutant (left picture is TRV basic vector, right picture is mutant);

[0049] Fig.14 Pathogenicity analysis and stability detection of TRV attenuated mutants containing TYLCV fragments inoculated with Nicotiana benthamiana for 14 days (A represents the pathogenicity analysis of TYLCV insertion-type TRV mutants for 14 days; B represents the stability analysis of TYLCV insertion-type TRV mutants for 14 days; mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNAMarkerDL2000);

[0050] Fig.15 Pathogenicity analysis and stability detection of TRV attenuated mutants containing TYLCV fragments inoculated with Nicotiana benthamiana for 35 days (A represents the pathogenicity analysis of TYLCV insertion-type TRV mutants for 35 days; B represents the stability analysis of TYLCV insertion-type TRV mutants for 35 days; mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNAMarkerDL2000);

[0051] Fig.16The cross-protection effect and stability analysis of TYLCV insertion-type TRV mutants on TYLCV (A represents the cross-protection effect of TYLCV insertion-type TRV mutants on TYLCV; B represents the effect of TYLCV insertion-type TRV mutants on TYLCV virus expression; "**" represents P value < 0.01 (the ordinate represents TYLCV virus expression); C represents stability analysis of TYLCV insertion-type TRV mutants; D represents TYLCV virulent PCR detection; CK represents the virus accumulation of TYLCV in healthy plants after TYLCV virulent infection, mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNA Marker DL2000);

[0052] Fig.17 Pathogenicity analysis and stability detection of tomatoes inoculated with CMV attenuated mutants containing ToCV fragments (A represents pathogenicity analysis of ToCV-inserted CMV mutants; B represents stability analysis of ToCV-inserted CMV mutants; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNAMarker DL2000);

[0053] Fig.18 The cross-protection effect and stability analysis of ToCV-inserted CMV mutants against ToCV (A represents the cross-protection effect of ToCV-inserted CMV mutants against ToCV; B represents the effect of ToCV-inserted CMV mutants on the expression of ToCV virus; "**" represents P value < 0.01 (the ordinate represents the expression of ToCV virus); C represents the stability analysis of ToCV-inserted CMV mutants; D represents the PCR detection of ToCV virulent virus; CK represents the accumulation of ToCV virus in healthy plants after infection with ToCV virulent virus, mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0054] Fig.19 Pathogenicity analysis and stability detection of tomatoes inoculated with CMV attenuated mutants containing TYLCV fragments (A represents the pathogenicity analysis of TYLCV-inserted CMV mutants; B represents the stability analysis of TYLCV-inserted CMV mutants; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNAMarker DL2000);

[0055] Fig. 20The cross-protection effect and stability analysis of TYLCV-inserted CMV mutants against TYLCV (A represents the cross-protection effect of TYLCV-inserted CMV mutants against TYLCV; B represents the effect of TYLCV-inserted CMV mutants on TYLCV virus expression; "**" represents P value < 0.01 (the ordinate represents TYLCV virus expression); C represents stability analysis of TYLCV-inserted CMV mutants; D represents TYLCV virulent PCR detection; CK represents the virus accumulation of TYLCV in healthy plants after TYLCV virulent infection, mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0056] Fig.21 Pathogenicity analysis and stability detection of tomato mixed with homologous virus fragment insertion mutants (A represents pathogenicity analysis of homologous virus fragment insertion mutants; B represents stability analysis of homologous virus fragment insertion mutants; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0057] Fig. 22 Cross-protection effect and stability analysis of mixed vaccination of homologous virus fragments inserted mutants (A represents the cross-protection effect analysis of mixed vaccine of homologous virus fragments inserted mutants; B represents the effect of mixed vaccine of ToCV / TYLCV inserted mutants on the expression of ToCV / TYLCV virus; "**" represents P value < 0.01 (the ordinate of the left figure represents the expression of ToCV virus, and the ordinate of the right figure represents the expression of TYLCV virus); C represents the virulent PCR detection; D represents the stability analysis of mixed vaccine of homologous virus fragments inserted mutants; CK1 / 2 represents the virus accumulation of ToCV / TYLCV in healthy plants after virulent infection of ToCV / TYLCV, mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0058] Fig.23Pathogenicity analysis and stability detection of tomato mixed inoculation with heterologous virus fragments inserted mutants (A represents the cross-protection effect analysis of the mixed vaccine of heterologous virus fragments inserted mutants; B represents the stability analysis of the mixed vaccine of heterologous virus fragments inserted mutants; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0059] Fig.24 Cross-protection effect and stability analysis of mixed inoculation of heterologous virus fragments inserted into mutants (A represents cross-protection effect analysis; B represents mixed vaccine stability analysis; C represents the effect of mixed vaccine on the expression of ToCV and TYLCV viruses in combined infection and single infection; "**" represents P value <0.01CK1 / 2 / 3 / 4 represent the expression of combined ToCV / compound TYLCV / single ToCV / single TYLCV in healthy plants (the ordinates of each figure from left to right are the expression of ToCV virus, TYLCV virus, ToCV virus and TYLCV virus, respectively); D represents virulent PCR detection: 1-4 are combined infection detection, 5-8 are single infection detection; mock represents healthy plants, R1 represents wild-type CMV RNA1, R2 represents wild-type CMV RNA2, R3 represents wild-type CMV RNA3, and M represents DNA Marker DL2000);

[0060] Fig.25 Pathogenicity analysis and stability detection of tomatoes inoculated with TRV attenuated mutants containing ToCV fragments (A represents pathogenicity analysis of ToCV-inserted TRV mutants; B represents stability analysis of ToCV-inserted TRV mutants; mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNAMarker DL2000);

[0061] Fig.26 Cross-protection effect and stability analysis of ToCV insertion-type TRV mutants on ToCV (A represents the cross-protection effect of ToCV insertion-type TRV mutants on ToCV; B represents the effect of ToCV insertion-type TRV mutants on ToCV virus expression; "**" represents P value < 0.01 (the vertical axis represents ToCV virus expression); C represents stability analysis of ToCV insertion-type TRV mutants; D represents ToCV virulent PCR detection; CK represents the ToCV virus accumulation in healthy plants after ToCV virulent infection, mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNAMarkerDL2000);

[0062] Fig. 27 Pathogenicity analysis and stability detection of tomatoes inoculated with TRV attenuated mutants containing TYLCV fragments (A represents the pathogenicity analysis of TYLCV insertion-type TRV mutants; B represents the stability analysis of TYLCV insertion-type TRV mutants; mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNAMarker DL2000);

[0063] Fig.28 The cross-protection effect and stability analysis of TYLCV insertion-type TRV mutants on TYLCV (A represents the cross-protection effect of TYLCV insertion-type TRV mutants on TYLCV; B represents the effect of TYLCV insertion-type TRV mutants on TYLCV virus expression; "*" represents P<0.05 (the ordinate represents the TYLCV virus expression); C represents the stability analysis of TYLCV insertion-type TRV mutants; D represents the TYLCV virulent PCR detection; CK represents the virus accumulation of TYLCV in healthy plants after TYLCV virulent infection, mock represents healthy plants, TRV1 represents wild-type TRV RNA1, V2 represents wild-type TRV RNA2, and M represents DNA Marker DL2000);

[0064] Fig.29 Pathogenicity analysis and stability detection of tomato mixed with homologous virus fragment insertion mutants (A represents pathogenicity analysis of homologous virus fragment insertion mutants; B represents stability analysis of homologous virus fragment insertion mutants; mock represents healthy plants, TRV1 represents wild-type TRVRNA1, V2 represents wild-type TRVRNA2, and M represents DNAMarker DL2000);

[0065] Fig.30 Cross-protection effect and stability analysis of mixed vaccination of homologous virus fragments inserted mutants (A represents the cross-protection effect analysis of mixed vaccine of homologous virus fragments inserted mutants; B represents the effect of mixed vaccine of ToCV / TYLCV inserted mutants on the expression of ToCV / TYLCV virus; "**" represents P value < 0.01 (the ordinate of the left figure represents the expression of ToCV virus, and the ordinate of the right figure represents the expression of TYLCV virus); C represents the virulent PCR detection; D represents the stability analysis of mixed vaccine of homologous virus fragments inserted mutants; CK1 / 2 represents the virus accumulation of ToCV / TYLCV in healthy plants after virulent infection of ToCV / TYLCV, mock represents healthy plants, TRV1 represents wild-type TRVRNA1, V2 represents wild-type TRVRNA2, and M represents DNAMarkerDL2000);

[0066] Fig.31 Pathogenicity analysis and stability detection of tomato mixed inoculated with heterologous virus fragments inserted mutants (A represents the cross-protection effect analysis of the mixed vaccine of heterologous virus fragments inserted mutants; B represents the stability analysis of the mixed vaccine of heterologous virus fragments inserted mutants; mock represents healthy plants, TRV1 represents wild-type TRVRNA1, V2 represents wild-type TRVRNA2, and M represents DNAMarker DL2000);

[0067] Fig.32 Cross-protection effect and stability analysis of mixed inoculation of heterologous virus fragment insertion mutants (A represents cross-protection effect analysis; B represents mixed vaccine stability analysis; C represents the effect of mixed vaccine on the expression levels of ToCV and TYLCV viruses in combined infection and single infection; "**" represents P value <0.01; CK1 / 2 / 3 / 4 represent the expression levels of composite ToCV / composite TYLCV / single ToCV / single TYLCV in healthy plants (the vertical axis of each figure from left to right is the expression level of ToCV virus, the expression level of TYLCV virus, the expression level of ToCV virus and the expression level of TYLCV virus, respectively); D represents virulent PCR detection: 1-4 are combined infection detection, 5-8 are single infection detection, mock represents healthy plants, TRV1 represents wild-type TRVRNA1, V2 represents wild-type TRVRNA2, and M is DNAMarker DL2000). DETAILED DESCRIPTION

[0068] In the present invention, the gene fragments of Tomato Chlorotic Virus (ToCV) are shown in SEQ ID NOs. 1 to 5;

[0069] SEQ ID NO.1 is located at positions 1 to 200 of ToCV p8, and the specific sequence is: ATGTTAGTTTGTTTAGTACT GAGAACTAACTGTCTTGTTAAAGTCTTGTATTTCTCTGATACTCCAATTGTCGAGTCCGGCCCATTAGTAATAAGAAGCT CGGATCCGAC CATTATAGAA GACCTTCTAGAGTGTTTACC TTTCGTCACT GAGTCATGGAACCCGTTGATACTTCCGAAAGAGTCAAAAGACTTTTCTCA.

[0070] SEQ ID NO.2 is located at positions 500-699 of ToCV p27, and the specific sequence is: GAGCGAATTTCAATTTCTTATTTTTGAATTCAAGTGAAATTGACAGAAGGTTGAGTAACATTAGAAGGAAAGGTTATCCAAACTCTGAGAATTTCAATTG GTTCAAAAATATGATAAGTAATTACTTATATTTTGATTTT GTGTTCAGATACTCTGGTACAAAAATCAATATAGAAAGAG TCTCAAATTATTATATTTGA.

[0071] SEQ ID NO.3 is located at positions 238 to 437 of ToCV RdRp, and the specific sequence is: TCGAAAATTCTTGGCAAAGG TGAGAGGACGAGACCGGACAGTATGAAACAGGGGATAATCTCATTGTCACATAGAAATTTTTCTG CACCGAGAATAAATGAACGTCTGGACGTTTATAAGACTGCTGAACGTTTATGTCAGAATCTCGTTAGATCTTTCGACTTTTCGAG GTTGTATGAGAACTATGATG TGATTCTTCC.

[0072] SEQ ID NO.4 is located at positions 703-902 of ToCV RdRp, and the specific sequence is: AGCAAGAAGATAGTTATGTA TTCCGGGATGAATCTAGAAACTCTCGGCACCCTGATTGGTTCTAAACTGCAGAAACCATTGACAT CATATCACACTTTGGAGATTGATTTCTCAAAGTTTGATAAGTCTCAAGGTATCCTATTTAAAGTTTA TGAGGGGATGATTTACCGGTTTTTCAAGTTTTCCGAGGATTACTATAC.

[0073] SEQ ID NO.5 is located at positions 1006 to 1205 of ToCVRdRp. The specific sequence is: TCAAACATTGGTTACTAT GGGTATCATACTCAGTGTTTACGACCTGGATGATATTGATTTATTCTTAGTAAGTGGTGACGACAGTTTGATCTTTTTCGAGTAAACCCTTGAAGAATAAAACTGATGAGATAAACAGAGATTTCGGTTTTG AGGCTAAGATGATAGAGAATTCAGTGCCGTATTTTTGCTCCAAATATAT.

[0074] In the present invention, the gene fragment of Tomato Yellow Leaf Curl Virus (TYLCV) is shown in SEQ ID NO.6-7;

[0075] SEQ ID NO.6 is located at positions 216 to 415 of TYLCVAV1, and the specific sequence is: ATGTAAAGTCCAGTCTTATGAGCATCGGGATGATATTAAGCATACTGGTATTGTTGGTTGTGTTAGTGATGTTACTCGTGGATCTG GAATTACTCACAGAGTGGGTAAGAGATTCTGTGTTAAATCGATATATTTTTTAGGTAAAGTCTGGA TGGATGAAAATATCAAGAAGCAGAATCACACTAATCAG GTCATGTTCT.

[0076] SEQ ID NO.7 is located at positions 1 to 150 of TYLCV AV2, and the specific sequence is: ATGTGGGATCCACTTCTAAATGAATTTCCGGAATCTGTTCACGGATTTCGTTGTATGATAGCTATTAAATATTTGCAGTCCGTTGAC GAAACTTACGAGCCCAATACATTGGGCCACGATTTAATTAGGGATCTTATATCTGTTGTAAGG.

[0077] In the present invention, the primer pairs are shown in Table 1.

[0078] Table 1 Primers for amplifying gene fragments

[0079]

[0080]

[0081] In the present invention, pCC FR2-2bPTII vector contains CMV Fny The 2d protein was terminated based on the mutant RNA2 of the isolate, which was a kind gift from Professor Yuan Xuefeng of the College of Plant Protection, Shandong Agricultural University.

[0082] In the present invention, TRV2-Vector vector is a VIGS vector based on TRV, which is obtained by modifying TRV and obtaining TRV2-Vector vector with restriction site MCS located between CaMV 35S promoter and "ribozyme Rz-NOSt terminator", which is a kind gift from Professor Liu Yule of Tsinghua University.

[0083] The ToCV infectious clone was kindly donated by Professor Zhou Tao from China Agricultural University; the TYLCV infectious clone was kindly donated by Professor Zhou Xueping from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0084] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0085] In the present example, tobacco and tomatoes were grown in a constant temperature artificial climate chamber at 25° C. with a light period of 16 h / darkness of 8 h.

[0086] In the examples of the present invention, the reagents and other unmentioned test materials are all commercially available.

[0087] In the present embodiment, the plant total RNA extraction method is Trizol extraction, and the specific method is as follows: (1) take the plant tissue to be tested (0.1g) and put it into a 2.0mL centrifuge tube with grinding beads, freeze it with liquid nitrogen, grind it in a tissue grinder at 70Hz for 90s, and add 1mL TransZol to each centrifuge tube. TM, mix thoroughly and place at room temperature for 5 minutes; (2) centrifuge at 4°C, 12,000 rpm for 10 minutes; (3) take 800 μL of supernatant and place it in a new sterile 1.5 mL centrifuge tube, add 200 μL of chloroform, then shake for 15 seconds, mix well and place it for 5 minutes, centrifuge at 4°C, 12,000 rpm for 15 minutes; (4) take 400 μL of the upper supernatant and mix it with 400 μL of 70% ethanol by pipetting, then transfer it to the RNA adsorption column; (5) centrifuge at 4°C, 12,000 rpm for 1 minute and discard the filtrate; (6) add 500 μL 75% ethanol was added to the adsorption column, centrifuged at 4°C, 12,000 rpm for 1 min, and the liquid was discarded; (7) step (6) was repeated once; (8) empty centrifugation was performed at 4°C, 12,000 rpm for 3 min; (8) the adsorption column was placed in a 1.5 mL sterile centrifuge tube, and the tube was opened and allowed to stand for 2 min to evaporate the ethanol; (9) 50 μL RNAse-free ddH2O was added to the center of the silica gel membrane of the adsorption column, and the tube was allowed to stand for 3 min, and centrifuged at 4°C, 12,000 rpm for 1 min; (10) the collected liquid was the extracted plant total RNA, which could be used directly in downstream experiments or stored in a -80°C refrigerator.

[0088] The method for synthesizing reverse transcribed cDNA described in the embodiment of the present invention is: using plant total RNA as a template, using random primer N15 as a downstream primer, and referring to the TaKaRa (Bao Ri Yi Biotechnology (Beijing) Co., Ltd.) reverse transcription product instructions to perform cDNA synthesis on ice.

[0089] In the embodiment of the present invention, the plant genomic DNA extraction method is as follows: (1) preheat CTAB for 1 hour at 65°C water bath, add 600 μL of preheated CTAB to a centrifuge tube containing an appropriate amount (0.2 g) of plant tissue, and shake vigorously for 90 seconds; (2) place in a 65°C water bath for 30 minutes (slightly invert and mix once every 10 minutes); (3) cool to room temperature, add 600 μL of chloroform, shake and mix, and let stand for 4 minutes; (4) centrifuge at 12,000 rpm for 10 minutes; (5) take 400 μL of the upper supernatant and mix with 400 μL of isopropanol by pipetting, transfer to an RNA adsorption column, let stand for 15 minutes, and then centrifuge for 10 minutes. Centrifuge at 2,000 rpm for 10 min and discard the waste liquid; (5) Add 200 μL of anhydrous ethanol and centrifuge at 12,000 rpm for 5 min and discard the waste liquid; (6) Repeat step (5) once; (7) Centrifuge at 12,000 rpm for 3 min; (8) Add 50 μL of ddH2O to the center of the silica gel membrane of the adsorption column, let stand for 5 min, and centrifuge at 12,000 rpm for 1 min; (9) The collected liquid is the plant genomic DNA, which can be used directly in PCR experiments or stored in a -20°C refrigerator.

[0090] The PCR amplification method described in the embodiment of the present invention is: using gene-specific primers and cDNA as a template to perform an amplification reaction. The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0091] Table 2 PCR reaction system

[0092] System composition Volume (μL) 2×TaqMasterMix 12.5 Upstream primer (10 μmol / L) 1 Downstream primer (10 μmol / L) 1 TemplateDNA 1 <![CDATA[ddH2O]]> Upto25

[0093] Table 3 PCR reaction program

[0094]

[0095]

[0096] In the embodiment of the present invention, the method for gel excision, recovery and purification of the target fragment is as follows: the electrophoresis band is viewed with a gel imager, the DNA marker fragment is used as a reference, and the gel band of the corresponding length is cut according to the length of the target fragment, and the gel block is cut into pieces and placed in a 2.0 mL centrifuge tube, and the procedure is performed according to the instructions of the Quick Agarose Gel DNA Recovery Kit II produced by Beijing Biotech Biotechnology Co., Ltd.

[0097] In the examples of the present invention, the method for extracting plasmid DNA is carried out with reference to the product instructions of FastPure Plasmid Mini Kit (DC201) produced by Nanjing Novezan Biotechnology Co., Ltd.

[0098] In the embodiments of the present invention, the enzymatic digestion method of plasmid DNA or PCR product is as follows: (1) referring to the instruction manual of Takara restriction endonuclease, double digestion is performed according to the digestion site and vector concentration, and the digestion reaction system is shown in Table 4; (2) the test is performed according to the temperature and time recommended in the instruction manual; (3) after confirming the completion of digestion by electrophoresis, the gel is cut and recovered for purification.

[0099] Table 4 Enzyme digestion reaction system

[0100] Reaction system Volume (μL) Vector plasmid 15 10×buffer 5 Enzyme 1 1 Enzyme 2 1 <![CDATA[ddH2O]]> Addto50

[0101] In the embodiment of the present invention, the method of the ligation reaction is: (1) using homologous recombinase to connect the target fragment and the linearized vector, and preparing the reaction system shown in Table 5 on ice; (2) using a pipette to mix, and performing a brief centrifugation; (3) reacting at 37° C. for 30 min, and immediately placing on ice for 5 min.

[0102] Table 5 Recombination reaction system

[0103] Reaction system Volume (μL) Linearized vector 4 Insert 2 5×CEⅡBuffer 4 ExnaseⅡ 2 <![CDATA[ddH2O]]> Addto20

[0104] In the embodiment of the present invention, the method for preparing competent Escherichia coli is as follows: (1) on an antibiotic-free LB plate, streak the Escherichia coli DH5α strain and invert it at 37°C for 12 hours; (2) pick a single colony of Escherichia coli with a sterilized pipette tip and place it in 4 mL of antibiotic-free LB liquid culture medium, shake and culture at 37°C, 180 rpm for 14 hours; (3) take 3 mL of the bacterial solution and add it to 160 mL of antibiotic-free LB liquid culture medium, shake and culture at 37°C, 180 rpm until the OD 600 The value is between 0.4 and 0.6, and the time is 110 minutes; (4) Place the ice box on the sterile operating table, transfer the culture to a 100mL centrifuge tube, and place on ice for 10 minutes; (5) Centrifuge at 4°C, 5,000rpm for 5 minutes; (6) Discard the supernatant, add 20mL of pre-cooled 0.1M CaCl2, gently pipette and resuspend the cells, and cool on ice for 5 minutes; (7) Centrifuge at 4°C, 4,000rpm for 5 minutes; (8) Discard the supernatant, add 20mL of pre-cooled 0.1M CaCl2, gently pipette and resuspend the cells, and cool on ice for 5 minutes; (9) Centrifuge at 4°C, 4,000rpm for 5 minutes; (10) Discard the supernatant, resuspend the cells with 2mL of pure glycerol and 10mL of pre-cooled 0.1M CaCl2; (11) Aliquot, 100μL per tube, cool with liquid nitrogen and place at -80°C.

[0105] In the embodiment of the present invention, the method for transforming the ligation product into E. coli DH5α is as follows: (1) to make the temperature of the two similar, place the DH5α competent medium and the ligation product on ice for 5 minutes; (2) add the ligation product to the DH5α competent medium and place it on ice for 25 minutes. At the same time, during this period, open a 42°C water bath to heat the LB solid culture medium to melt it. When it cools to a suitable temperature (not exceeding 55°C), add the corresponding antibiotics and pour it into a plate; (3) heat shock at 42°C for 90 seconds, take it out and place it on ice for 5 minutes; (4) add 800 μL of LB liquid culture medium without antibiotics, and culture it at 37°C, 190 rpm for 50 minutes; (5) centrifuge at 8,000 rpm for 5 minutes, pipette and mix 200 μL of supernatant with the bacteria, evenly spread it on the LB plate containing the corresponding antibiotics, and culture it at 37°C for 12 hours.

[0106] In the embodiment of the present invention, the method for identifying a positive single colony by PCR is as follows: a single colony is picked up on a clean bench and cultured at 37°C and 190 rpm for 11 hours. In the clean bench, the culture is used as a template for conventional PCR verification, and the reaction conditions are the same as the reaction system and reaction procedure described in PCR amplification. Electrophoresis observation is performed, and the desired bacterial solution is sequenced.

[0107] In the embodiment of the present invention, the method for determining and analyzing the sequence is: using BLAST (http: / / www.ncbi.nlm.nih.gov) to compare the obtained nucleotide sequences.

[0108] In the embodiment of the present invention, the method for preparing the competent state of Agrobacterium is as follows: (1) on an antibiotic-free LB plate, streaking the Agrobacterium GV3101 strain is carried out, and inverting and culturing at 28°C for 36 hours until a single colony grows; (2) picking a single colony of Agrobacterium on the plate, placing it in 3 mL of LB liquid culture medium containing Rif, and shaking and culturing at 28°C and 180 rpm for 36 hours; (3) taking 2 mL of the bacterial solution, adding it to 150 mL of LB liquid culture medium containing Rif, and shaking and culturing at 28°C and 180 rpm for about 2 hours until the OD 600 The value is between 0.4 and 0.6; (4) On the operating table, transfer the bacterial solution to a pre-cooled 50mL centrifuge tube and place it on ice for 10 minutes; (5) Centrifuge at 4°C, 4,000rpm for 10 minutes; (6) Discard the supernatant, add 10mL of pre-cooled 0.15MNaCl, gently pipette to resuspend the cells, and cool on ice for 10 minutes; (7) Centrifuge at 4°C, 4,000rpm for 10 minutes; (8) Discard the supernatant, resuspend the cells with 2mL of pre-cooled 20mM CaCl2 containing 15% glycerol, treat with ice bath for 4 to 6 hours, treat with liquid nitrogen, and package into 200μL per tube and store at -80°C.

[0109] In the embodiment of the present invention, the method of Agrobacterium transformation is as follows: (1) taking out GV3101 Agrobacterium competent cells from a -80°C refrigerator, and thawing them together with the recombinant plasmid on ice; (2) adding 10 μL of plasmid to 200 μL competent cells, stirring with a pipette tip, placing on ice for 30 min, and turning on a water bath to 37°C; (3) treating with liquid nitrogen for 5 min, bathing in a 37°C water bath for 5 min, and placing on ice for 5 min; (4) adding 800 μL of liquid LB medium without antibiotics to the operating table, sealing with a sealing film, and culturing at 28°C on a shaker at 180 rpm for 3 h; (5) Melt the solid culture medium. Heat the solid culture medium LB in a microwave oven to melt it. After it cools down slightly, add Rif and Kan antibiotics. Invert the plate on the workbench, blow dry under ultraviolet light, and burn the spreader; (6) After the culture is completed, centrifuge at 5,000 rpm for 5 minutes to collect the bacteria. Discard 800 μL of supernatant on the workbench, pipette and resuspend the remaining liquid and bacteria, and spread them evenly on the LB plate containing Rif and Kan. After briefly burning the edge of the plate with an alcohol lamp, seal it with a sealing film; (7) Place the plate in a 28°C incubator and invert it for 48 hours until a single colony grows on the plate.

[0110] In the embodiment of the present invention, the specific method of real-time fluorescence quantitative PCR is as follows: the total RNA of the plant is extracted as described above, the RNA concentration is quantified to 1000 ng and then reverse transcribed, qPCR primers are designed, and each sample is repeated 3 times, and the amount of each repeat must be consistent to avoid experimental errors. After the reaction is completed, 2 -ΔΔCT The data were processed by the qPCR method, and the standard error of the data was calculated to perform significance analysis. The specific qPCR reaction system is shown in Table 6, and the qPCR operation program is shown in Table 7.

[0111] Table 6 qPCR reaction system

[0112] Reagent name Volume (μL) 2×SYBR qPCR Master Mix 10.0 PrimerF 0.4 PrimerR 0.4 cDNA 1.0 <![CDATA[ddH2O]]> Addto20.0

[0113] Table 7 qPCR operation program

[0114]

[0115] In the embodiment of the present invention, the Agrobacterium infiltration inoculation method is as follows: (1) streaking the Agrobacterium bacterial solution stored at -80°C, and inverting and culturing at 28°C for 3 days; (2) picking a single colony with a sterilized pipette tip, placing it in a 10 ml centrifuge tube containing 2 ml Rif and Kan in a liquid LB medium, and culturing it at 28°C and 180 rpm for 20 h until the bacterial solution turns orange-yellow; (3) adding the above Agrobacterium liquid to 5 ml LB liquid medium containing Rif and Kan, and culturing it overnight on a shaker at 28°C and 180 rpm; (4) preparing the required inoculation buffer MMABuffer (adding 1 ml 1M MgCl2, 1 ml 1M MES, 100 μL 0.1 MAS to a beaker, and adding deionized water to make up to 100 ml); (5) centrifuging the cultured bacterial solution at 4,000 rpm for 10 min, and discarding the supernatant; (6) resuspending the bacterial cells with the infiltration buffer MMABuffer, and adjusting the OD value with the buffer in a spectrophotometer 600 =0.5; (7) According to the dosage, mix the required bacterial solution in a 1:1 ratio to make the final OD 600 The concentration of the bacterial solution was 0.5, and the sample was wrapped in tin foil and placed in the dark at room temperature for more than 3 h. (8) A disposable 1 mL syringe was used to infiltrate the lower epidermis of the host plant leaves. The infiltration area of ​​the bacterial solution should not be less than 2 / 3 of the leaf area.

[0116] In the embodiment of the present invention, the steps of the tomato grafting virus transmission operation are as follows: (1) Selecting a tomato rootstock: Select a tomato seedling with a stem thickness of 0.5 cm, healthy growth, and no pests and diseases, remove the part above the second branch at the bottom of the plant with a sterile scalpel, and make a vertical cut downward in the middle of the cross section, one finger long; (2) Selecting a scion: Select a scion that is neither old nor tender with axillary buds, remove the leaves (to reduce transpiration and make it easier to survive), cut the lower part of the stem into a wedge shape, and in order to maintain the humidity of the scion, the scion can be wetted with a damp cloth. (3) Insert the scion: insert the scion into the cut of the tomato rootstock (align the cut of the scion with the cut of the rootstock to maximize the contact area between the two), wrap the grafting joint tightly with a well-ventilated sealing film for 4 turns. When wrapping, be sure to wrap from half a finger below the cut from bottom to top and firmly fix the scion on the rootstock; (4) Management of grafted seedlings: place the grafted plants in a 25℃ greenhouse (the joint heals very slowly in a low temperature environment, affecting the survival rate), and shade the grafted seedlings within 4 days. The humidity of the greenhouse environment should be controlled at about 85% within 2 days after grafting (if the humidity is too low, the scion will wilt easily; if the humidity is too high, the grafting joint will rot easily, directly affecting the survival of the scion). In the subsequent management, the soil should be kept moist. Excessive or insufficient watering can easily lead to the inactivation of the scion. At the same time, the scion should be frequently observed to see if it remains fresh and if there is obvious water loss. (5) After 28 days, the symptoms of the grafted plants should be observed and the disease susceptibility should be tested using molecular detection technology. During this period, the occurrence of whiteflies should be prevented and imidacloprid should be sprayed every 2 days.

[0117] Example 1

[0118] Construction of Tomato Chlorotic Virus (ToCV) Insertion Mutant of CMV

[0119] Contains CMV Fny pCC of mutant RNA2 isolated from F The R2-2bPTII plasmid vector terminates the translation of the 2d protein in advance, and inserts a multiple cloning site (MCS) on this basis. Based on this plasmid vector, different virus fragments are inserted at the restriction site to construct attenuated vaccines against different target viruses, such as Figure 1 .

[0120] The target proteins of ToCV (RdRp located in ToCV RNA1 (NCBI: KC887998.1); p8 and p27 located in ToCV RNA2 (NCBI: KC887999.1) SGN-VIGS) were predicted and analyzed for the peak of small interfering RNA on a professional website (siDirect (rnai.jp)) to determine the required segment, select a 200 bp sequence with a relatively high peak, and use the ToCV infectious clone solution as a template, using primers CMV To-p8-1-200-F / CMV To-p8-1-200-R; CMV To-p27500-699-F / CMVTo-p27500-699-R; CMV To-RdRp 238-437-F / CMV To-RdRp 238-437-R; CMV To-RdRp 703-902-F / CMV To-RdRp 703-902-R; CMV To-RdRp 1006-1205-F / CMV To-RdRp 1006-1205-R, PCR amplification to obtain the target fragments ToCV (P81-200) (SEQ ID NO.1); ToCV (P27500-699) (SEQ ID NO.2); ToCV (RdRp 238-437) (SEQ ID NO.3); ToCV (RdRp 703-902) (SEQ ID NO.4) and ToCV (RdRp 1006-1205) (SEQ ID NO.5). The target fragments recovered from the gel were double-digested with BamHI and SmaⅠ, and ligated to pCC F R2-2bPTII. After transformation of E. coli, colony PCR screening, sequencing analysis and plasmid extraction, plasmids containing the target fragments CMV To-p8-1-200 (R2-ToCV-200Ⅳ), CMVTo-p27500-699 (R2-ToCV-200Ⅴ), CMVTo-RdRp 238-437 (R2-ToCV-200Ⅰ), CMV To-RdRp 703-902 (R2-ToCV-200Ⅱ) and CMV To-RdRp 1006-1205 (R2-ToCV-200Ⅲ) were obtained.

[0121] Example 2

[0122] Stability analysis of tomato chlorosis virus (ToCV) insertional CMV mutants in Nicotiana benthamiana

[0123] The five successfully constructed attenuated mutant plasmids containing a 200 bp ToCV fragment insertion were selected: CMVTo-RdRp238-437 (abbreviated as R2-ToCV-200Ⅰ), CMVTo-RdRp 703-902 (abbreviated as R2-ToCV-200Ⅱ); CMVTo-RdRp 1006-1205 (abbreviated as R2-ToCV-200Ⅲ), CMVTo-p8-1-200 (abbreviated as R2-ToCV-200Ⅳ) and CMV To-p27500-699 (abbreviated as R2-ToCV-200Ⅴ). The plasmids containing the five mutants were transformed into GV3101 Agrobacterium competent cells and incubated with wild-type CMV Fny RNA1 and CMV Fny The Agrobacterium liquid of RNA3 plasmid was mixed in equal proportions to form a vaccine, which was inoculated into Nicotiana benthamiana at the 6- to 8-leaf stage by the Agrobacterium infiltration method. The growth status of Nicotiana benthamiana plants was observed 14 days after inoculation with the mutants, and the stability test was performed. Plants inoculated with wild-type CMV (R1 / R2 / R3) were dwarfed, with wrinkled leaves and stunted growth; the healthy control plants had good growth and green and flat leaves; the plants treated with the five mutants were in good condition, with flat leaves, which was basically the same as healthy plants, indicating that the five insertion mutants were all attenuated mutants ( Figure 2 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in Nicotiana benthamiana, and RNA was extracted. RT-PCR detection was performed using CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37). The amplified bands of the plants inoculated with the five mutants were about 200 bp more than the amplified bands of the plants inoculated with the wild-type CMV, indicating that the five ToCV insertion-type CMV mutants were stable 14 days after inoculation with Nicotiana benthamiana ( Figure 2 B). SEQ ID NO.36: AGAATCGACGGGAACGAGGT; SEQ ID NO.37: GGGGAGGTTTCAGAAAGCACC.

[0124] The pathogenicity and stability of N. benthamiana plants inoculated with attenuated mutants for 35 days were analyzed. Plants treated with mutant R2-ToCV-200V were slightly shorter than those treated with the other four mutants, and had no significant difference from healthy plants, indicating that the ToCV-inserted CMV mutant would not have an adverse effect on the normal growth of N. benthamiana plants ( Figure 3A). 35 days after mutant inoculation, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in Nicotiana benthamiana, and RNA was extracted. RT-PCR detection was performed using CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37). The amplified bands of the plants inoculated with the five mutants were about 200 bp more than the amplified bands of the plants inoculated with the wild-type CMV, indicating that the five ToCV insertion-type CMV mutants were stable 35 days after inoculation with Nicotiana benthamiana plants ( Figure 3 B).

[0125] Example 3

[0126] Evaluation of the cross-protective effect of Tomato Chlorotic Virus (ToCV) insertional CMV mutants on Nicotiana benthamiana

[0127] The five ToCV-inserted CMV mutants prepared above were inoculated with Nicotiana benthamiana for 7 days, and then inoculated with ToCV infectious clones. 600 =0.7 (strong toxicity), and the cross-protection effect was evaluated after 28 days. The uninoculated upper systemic leaves were taken, RNA was extracted, and RT-PCR was performed using primers CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37) and ToCV-3 / ToCV-4 (SEQ ID NO.38-39), respectively. All five mutants showed obvious bands, and ToCV strong toxicity could be detected, indicating that the plants inoculated with ToCV insertion-type CMV mutants and challenged with ToCV strong toxicity can still exist stably ( Figure 4 A / C / D). SEQ ID NO.38: GGCTAATCCTAATCGATCTTCCAGT; SEQ ID NO.39: GCGTTTCTTTTCATAAGCAGGTTC.

[0128] In order to detect the changes in viral expression in N. benthamiana treated with five mutants after infection with ToCV, real-time fluorescence quantitative PCR was used to detect plant samples. The results showed that the ToCV viral content in N. benthamiana that was vaccinated in advance and then infected with ToCV showed a significant decrease, and was downregulated compared with the viral content in healthy plants infected with ToCV. This shows that the five ToCV insertion-type CMV mutants can have a good cross-protective effect against ToCV infection in N. benthamiana. The R2-ToCV-200Ⅲ and R2-ToCV-200Ⅳ mutants have the best cross-protective effect against ToCV, with the viral content being 15.6% and 22% of the strong toxicity, respectively; followed by the R2-ToCV-200Ⅰ mutant, with the viral content of the plant after treatment being 29.9% of the strong toxicity; while the R2-ToCV-200Ⅱ and R2-ToCV-200Ⅴ had the worst cross-protective effect, with the viral content of the plant after treatment being 49.2% and 49.6% of the strong toxicity, respectively. Figure 4 B). The primers for real-time fluorescence quantitative PCR amplification are as shown in SEQ ID NOs. 44-45, and the internal reference gene (EF-1α-F / EF-1α-R) is as shown in SEQ ID NOs. 50-51.

[0129] SEQ ID NO.44: ACTGGTGATAACGGTGGT; SEQ ID NO.45: CGAATCGTCCCTCCTGCC; SEQ ID NO.50: TGAGATGCACCACGAAGCTC; SEQ ID NO.51: CCAACATTGTCACCAGGAAGTG.

[0130] Example 4

[0131] Construction of a CMV insertion mutant of Tomato Yellow Leaf Curl Virus (TYLCV)

[0132] The target protein of TYLCV (AV1 AV2 is located in NCBI: MN432609.1) was predicted and analyzed by small interfering RNA peak on the professional website (siDirect (rnai.jp)), the required segment was determined, and the target sequence with relatively high peak was selected. The TYLCV infectious clone bacterial solution existing in the laboratory was used as a template, and primers CMVTY-V1-1 F / CMVTY-V1-1 R (SEQ ID NO.28-29) and CMV TY-V2-F / CMV TY-V2-R (SEQ ID NO.32-33) were used to perform PCR amplification to obtain the target fragments TYLCV (AV1216-415) (SEQ ID NO.6) and TYLCV (AV21-150) (SEQ ID NO.7). The target fragments recovered from the gel were double-digested with BamHⅠ and SmaⅠ, and ligated to pCC F R2-2bPTII. After E. coli transformation, colony PCR screening, sequencing analysis, and plasmid extraction, a plasmid mutant containing the target fragment was obtained ( Figure 5 ) CMVTY-AV1216-415 (R2-TY-200Ⅰ) and CMV TY-AV21-150 (R2-TY-150Ⅰ).

[0133] Example 5

[0134] Stability analysis of the insertional CMV mutant of Tomato Yellow Leaf Curl Virus (TYLCV) in Nicotiana benthamiana

[0135] The two successfully constructed attenuated mutant plasmids containing 200 bp and 150 bp TYLCV fragment insertions were selected: CMV TY-AV1216-415 (abbreviated as R2-TY-200Ⅰ) and CMV TY-AV21-150 (abbreviated as R2-TY-150Ⅰ). The plasmids containing the two mutants were transformed into GV3101 Agrobacterium competent cells and incubated with wild-type CMV Fny RNA1 and CMV Fny The Agrobacterium liquid of RNA3 plasmid was mixed in equal proportions to form a vaccine, which was inoculated into Nicotiana benthamiana plants at the 6- to 8-leaf stage using the Agrobacterium infiltration method. The growth status of the Nicotiana benthamiana plants was observed 14 days after the mutants were inoculated, and the stability test was performed. The plants inoculated with wild-type CMV (R1 / R2 / R3) grew poorly, with curled leaves; the healthy control plants grew well; the plants treated with the two mutants had flat leaves and grew basically the same as the healthy plants, indicating that the two insertion mutants were attenuated mutants ( Figure 6A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in Nicotiana benthamiana, and RNA was extracted. RT-PCR detection was performed using CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37). The amplified bands of the plants inoculated with the two mutants were about 200 bp more than the amplified bands of the plants inoculated with the wild-type CMV, indicating that the two TYLCV insertion-type CMV mutants were stable 14 days after inoculation with Nicotiana benthamiana ( Figure 6 B).

[0136] The pathogenicity and stability of N. benthamiana inoculated with attenuated mutants for 35 days were analyzed. The height of plants treated with mutant R2-TY-200Ⅰ was shorter than that of plants treated with mutant R2-TY-150Ⅰ, but there was no significant difference between them and healthy plants, indicating that the TYLCV insertion-type CMV mutant did not interfere with the normal growth of N. benthamiana plants ( Figure 7 A). 35 days after mutant inoculation, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in N. benthamiana, and RNA was extracted. RT-PCR detection was performed using CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37). The amplified bands of the plants inoculated with the two mutants were about 200 bp and 150 bp more than the amplified bands of the plants inoculated with the wild-type CMV, respectively, indicating that the two TYLCV insertion-type CMV mutants were stable 35 days after inoculation with N. benthamiana plants ( Figure 7 B).

[0137] Example 6

[0138] Evaluation of the cross-protective effect of tomato yellow leaf curl virus (TYLCV) insertional CMV mutants on Nicotiana benthamiana

[0139] The two TYLCV-inserted CMV mutants constructed above were inoculated with Nicotiana benthamiana for 7 days, and then inoculated with TYLCV infectious clone liquid. The OD 600=0.7 (strong toxicity), symptom observation, PCR detection and quantitative analysis were carried out after 28 days. The new leaves of plants directly inoculated with TYLCV strong toxicity without mutant treatment curled and shrank significantly, and the symptoms of new leaves of plants treated with mutants were significantly weakened. The uninoculated upper systemic leaves were taken, RNA was extracted, and RT-PCR was performed using primers CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36~37). Both mutants showed obvious bands. DNA was extracted and PCR was performed using primers TYLCV-F / TYLCV-R (SEQID NO.40~41). The target bands were obtained in all plants, indicating that the plants inoculated with TYLCV insertion-type CMV mutants can still stably exist after being challenged with TYLCV strong toxicity ( Figure 8 A / C / D).

[0140] SEQ ID NO.40: GAAACGACCAGTCTGAGGCTGTAATGTC; SEQ ID NO.41: AAGAAAACCAATAAGGCGTAAGCGTGTAG.

[0141] In order to detect the changes in viral expression in Nicotiana benthamiana treated with two mutants after infection with TYLCV, real-time fluorescence quantitative PCR was used to detect plant samples. The results showed that after pre-inoculation with mutants, the viral content of TYLCV in Nicotiana benthamiana infected with TYLCV showed a significant decrease, and was downregulated compared with the viral content in healthy plants infected with TYLCV. This shows that both TYLCV insertion-type CMV mutants can have good cross-protection against TYLCV infection in Nicotiana benthamiana, among which the R2-TY-200Ⅰ mutant has the best cross-protection against TYLCV, and the viral content is only 24.3% of that of the strong toxicity; the cross-protection effect of the R2-TY-150Ⅰ mutant is poor, and the viral content of the treated plants is 38.4% of that of the strong toxicity ( Figure 8 B). The primer pair for real-time fluorescence quantitative PCR is shown in SEQ ID NOs. 48-49, and the internal reference primer pair (EF-1α-F / EF-1α-R) is shown in SEQ ID NOs. 50-51.

[0142] SEQ ID NO.48: CAGAGAATGGCGTTTTTA; SEQ ID NO.49: TGCTGATGTTGTGGTTGA;

[0143] SEQ ID NO.50: TGAGATGCACCACGAAGCTC; SEQ ID NO.51: CCAACATTGTCACCAGGAAGTG.

[0144] Example 7

[0145] Construction of ToCV insertion mutant of TRV

[0146] The TRV-based VIGS vector was modified by TRV to obtain the TRV2-Vector vector (SinghAK, GhoshD, ChakrabortyS. Optimization of Tobacco Rattle Virus (TRV)-Based Virus-Induced Gene Silencing (VIGS) in Tomato. Methods Mol Biol. 2022; 2408: 133-145. doi: 10.1007 / 978-1-0716-1875-2_9), in which the restriction site MCS is located between the CaMV 35S promoter and the "ribozyme Rz-NOSt terminator". Based on this vector, different virus fragments are inserted at the restriction site to construct attenuated vaccines against different target viruses ( Fig. 9 ).

[0147] The target proteins of ToCV (RdRp, located in ToCV RNA1 (NCBI: KC887998.1); P8 and p27, located in ToCV RNA2 (NCBI: KC887999.1)) were predicted and analyzed by small interfering RNA peaks on a professional website (siDirect (rnai.jp)). The required segments were determined, and a 200 bp sequence with a relatively high peak was selected. The existing ToCV infectious clone solution in the laboratory was used as a template, and primers TRV To-p8-1-200-F / TRV To-p8-1-200-R (SEQ ID NOs. 10-11); TRV To-p27500-699-F / TRV To-p27500-699-R (SEQ ID NOs. 14-15); TRV To-RdRp 238-437-F / TRV To-RdRp 238-437-R (SEQ ID NO.18~19); TRVTo-RdRp 703-902-F / TRVTo-RdRp 703-902-R (SEQ ID NO.22~23); TRVTo-RdRp 1006-1205-F / TRV To-RdRp 1006-1205-R (SEQ ID NO.26~27), PCR amplification was performed to obtain the target fragments ToCV (P81-200) (SEQ ID NO.1), ToCV (P27500-699) (SEQ ID NO.2), ToCV (RdRp 238-437) (SEQ ID NO.3), ToCV (RdRp 703-902) (SEQ ID NO.4) and ToCV (RdRp 1006-1205) (SEQ ID NO.5). The target fragments recovered from the gel were treated with double restriction enzymes of BamHI and XbaⅠ, and then connected to the TRV2-Vector plasmid vector treated with BamHI and XbaⅠ. After E. coli transformation, colony PCR screening, sequencing analysis, and plasmid extraction, plasmid mutants containing the target fragments TRVTo-p8-1-200 (V2-ToCV-200ⅳ), RVTo-p27500-699 (V2-ToCV-200ⅴ), TRVTo-RdRp 238-437 (V2-ToCV-200ⅰ), TRVTo-RdRp703-902 (V2-ToCV-200ⅱ), and TRVTo-RdRp 1006-1205 (V2-ToCV-200ⅲ) were obtained.

[0148] Example 8

[0149] Stability analysis of ToCV insertion-type TRV mutant in Nicotiana benthamiana

[0150] The five successfully constructed attenuated mutant plasmids containing a 200bp ToCV fragment insertion were selected: TRVTo-RdRp238-437 (abbreviated as V2-ToCV-200ⅰ), TRVTo-RdRp 703-902 (abbreviated as V2-ToCV-200ⅱ), TRVTo-RdRp 1006-1205 (abbreviated as V2-ToCV-200ⅲ), TRV To-p8-1-200 (abbreviated as V2-ToCV-200ⅳ) and TRV To-p27500-699 (abbreviated as V2-ToCV-200ⅴ). The plasmid containing the five mutants was transferred into the competent GV3101 agrobacterium, and mixed with the wild-type TRVRAN1 plasmid Agrobacterium liquid in equal proportions to form a vaccine. The vaccine was inoculated into Nicotiana benthamiana plants at the 6-8 leaf stage using the Agrobacterium infiltration method. The growth status of the Nicotiana benthamiana plants was observed 14 days after inoculation with the mutants, and the stability test was performed. The plants inoculated with the wild-type TRV had mild symptoms, and the leaves of the healthy control plants were flat and green, and they grew well. The plants treated with the five mutants were basically the same as the healthy plants, in good condition, with flat leaves, indicating that the five insertion mutants were all attenuated mutants ( Fig.10 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in Nicotiana benthamiana, and RNA was extracted. RT-PCR detection was performed using TRV2-F / TRV2-R (SEQ ID NO.42-43). The amplified bands of the plants inoculated with the five mutants were 200 bp more than the amplified bands of the plants inoculated with the wild-type TRV, indicating that the five ToCV insertion-type TRV mutants were stable 14 days after inoculation with Nicotiana benthamiana ( Fig.10 B). The pathogenicity and stability of N. benthamiana plants inoculated with attenuated mutants for 35 days were analyzed. The plants treated with the five mutants showed no significant difference from the healthy plants, indicating that the ToCV insertion-type TRV mutant would not have an adverse effect on the normal growth of N. benthamiana plants ( Fig.11 A). 35 days after mutant inoculation, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in N. benthamiana, RNA was extracted, and RT-PCR was performed using TRV2-F / TRV2-R (SEQ ID NO.42-43). The amplified bands of the plants inoculated with the five mutants were 200 bp more than the amplified bands of the plants inoculated with wild-type TRV, indicating that the five mutants were stable after inoculation with N. benthamiana plants ( Fig.11 B).

[0151] SEQ ID NO. 42: GCTGCTAGTTCATCTGCAC; SEQ ID NO. 43: GCACGGATCTACTTAAAGAAC.

[0152] Example 9

[0153] Evaluation of the cross-protective effect of ToCV insertion-type TRV mutants on Nicotiana benthamiana

[0154] The five successfully constructed ToCV-inserted TRV mutants were inoculated with Nicotiana benthamiana for 7 days, and then inoculated with ToCV infectious clones. 600 =0.7 (strong toxicity), and the cross-protection effect was evaluated after 28 days. The uninoculated upper systemic leaves were taken, RNA was extracted, and RT-PCR detection was performed using primers ToCV-3 / ToCV-4 (SEQ ID NO.38-39) and TRV2-F / TRV2-R (SEQ ID NO.42-43). The results showed that all five mutants showed bands consistent with expectations, and ToCV strong toxicity could be detected, indicating that after the plants were treated with ToCV insertion-type TRV mutants, they were still stably infected with ToCV strong toxicity ( Fig.12 A / C / D).

[0155] In order to detect the cross-protection effect of the five mutants on Nicotiana benthamiana against ToCV, plant samples were tested using real-time fluorescence quantitative PCR (primer pairs and internal reference primers are shown in SEQ ID NO. 44-45 and SEQ ID NO. 50-51). The results showed that the ToCV virus content in Nicotiana benthamiana infected with ToCV decreased after being treated with the mutants. This indicates that the five ToCV insertion-type TRV mutants all have good cross-protection against ToCV infection. The best cross-protection against ToCV is from V2-ToCV-200ⅲ and V2-ToCV-200ⅳ mutants, with virus contents of 9.05% and 11.1% respectively; followed by V2-ToCV-200ⅰ mutant, with virus content of 18.2% in the treated plants; and the worst cross-protection is from V2-ToCV-200ⅱ and V2-ToCV-200ⅴ, with virus contents of 31.2% and 32% respectively in the treated plants. Fig.12 B).

[0156] Example 10

[0157] Construction of TYLCV insertional TRV mutant

[0158] The target protein of TYLCV (located at NCBI: MN432609.1) was predicted and analyzed for the peak of small interfering RNA on a professional website (siDirect (rnai.jp)) to determine the required segment, select the target sequence with a relatively high peak value, and use the TYLCV infectious clone bacterial solution as a template. PCR amplification was performed using primers TRV TY-V1-1 F / TRV TY-V1-1 R (SEQ ID NO.30-31) and TRV TY-V2-F / TRV TY-V2-R (SEQ ID NO.34-35), respectively, to obtain the target fragments TYLCV (AV1216-415) (SEQ ID NO.6) and TYLCV (AV21-150) (SEQ ID NO.7). The target fragments recovered from the gel were double-digested with BamHⅠ and XbaⅠ and ligated to TRV2-Vector digested with BamHⅠ and XbaⅠ. After colon transformation, colony PCR screening, sequencing analysis, and plasmid extraction, a plasmid mutant containing the target fragment was obtained ( Fig.13 )TRVTY-AV1216-415 (V2-TY-200ⅰ) and TRVTY-AV21-150 (V2-TY-150ⅰ).

[0159] Embodiment 11

[0160] Stability analysis of TYLCV insertional TRV mutant in Nicotiana benthamiana

[0161] The above-mentioned successful construction, containing 200bp and 150bp TYLCV fragment insertion type attenuated mutant plasmids: TRVTY-AV1216-415 (abbreviated as V2-TY-200ⅰ) and TRVTY-AV21-150 (abbreviated as V2-TY-150ⅰ). The plasmids of the above mutants were transferred into Agrobacterium competent cells, and were used in equal proportions with the Agrobacterium liquid of the wild-type TRVRNA1 plasmid to form a vaccine, which was inoculated on Nicotiana benthamiana at the 6 to 8 leaf stage using the Agrobacterium infiltration method. After 14 days, the state of Nicotiana benthamiana was observed and the stability test was carried out. The overall state of the plants treated with the two mutants was basically the same as that of healthy plants, and the leaves were flat, indicating that the two mutants were both attenuated ( Fig.14 A). 14 days after inoculation, the uninoculated systemic leaves on the upper part of the plants were taken to detect the stability of the vaccine in N. benthamiana. RNA was extracted and RT-PCR was performed using primers TRV2-F / TRV2-R (SEQ ID NO. 42-43). The amplified bands of the plants inoculated with the two mutants were consistent with the expectations, indicating that the two TYLCV insertion-type TRV mutants were stably inherited in N. benthamiana 14 days after inoculation ( Fig.14 B).

[0162] The pathogenicity and stability of 35-day-old Nicotiana benthamiana plants treated with attenuated mutants were analyzed. The height of plants treated with 2 mutants was slightly shorter than that of healthy plants, but their leaf circumference and plant growth were consistent with those of healthy plants, indicating that the TYLCV insertion-type TRV mutant is attenuated ( Fig.15 A). After 35 days of mutant treatment, the uninoculated systemic leaves on the upper part of the plant were taken to detect the stability of the vaccine, and RNA was extracted. RT-PCR was performed using TRV2-F / TRV2-R (SEQ ID NO. 42-43) primers. Both mutants obtained bands consistent with the expectations, indicating that the two TYLCV insertion-type TRV mutants can be stably inherited in Nicotiana benthamiana plants for a long time ( Fig.15 B).

[0163] Example 12

[0164] Evaluation of the cross-protective effect of TYLCV insertional TRV mutants on Nicotiana benthamiana

[0165] Two TYLCV insertion-type TRV mutants were inoculated into Nicotiana benthamiana, and then inoculated with virulent TYLCV 7 days later. Symptoms were observed 28 days later, and PCR detection and quantitative analysis were performed. The new leaves of plants directly inoculated with virulent TYLCV without mutant treatment curled and shrank significantly, while the symptoms of new leaves of plants treated with mutants were significantly weakened. 28 days after virulent inoculation, DNA was extracted from uninoculated upper systemic leaves, and primers TYLCV-F / TYLCV-R (SEQ ID NO.40-41) were used to detect virulent toxicity. RNA was extracted, and mutant stability was detected with TRV2-F / TRV2-R (SEQ ID NO.42-43). The results showed that each mutant could produce expected bands, and TYLCV virulent toxicity could be successfully detected. Each mutant could stably exist under TYLCV virulent infection ( Fig.16 A / C / D).

[0166] In order to detect the cross-protection effect of the two mutants against TYLCV in Nicotiana benthamiana, plant samples were tested using real-time fluorescence quantitative PCR (primers are SEQ ID NO.48-49, and internal reference primers are SEQ ID NO.50-51). The results showed that the virus content of TYLCV in Nicotiana benthamiana infected with TYLCV decreased after treatment with the mutants. This indicates that both TYLCV insertion-type TRV mutants have good cross-protection effects against TYLCV infection, among which the V2-TY-200ⅰ mutant has the best cross-protection effect against TYLCV, with the virus content being only 36.5% of that of the strong toxin; the V2-TY-150ⅰ mutant has a poor cross-protection effect, and the virus content of the treated plants is 46.3% of that of the strong toxin ( Fig.16 B).

[0167] Embodiment 13

[0168] Evaluation of the cross-protective effect of CMV vector-based attenuated vaccine on tomatoes indoors

[0169] The attenuated mutants R2-ToCV-200Ⅲ, R2-ToCV-200Ⅳ, R2-TY-200Ⅰ, and R2-TY-150Ⅰ were selected for the next study. The above four mutants and wild-type CMV Fny RNA1 and CMV Fny Agrobacterium liquids containing RNA3 were mixed in equal proportions to prepare a single dose of vaccine, homologous mixtures (R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ mixture and R2-TY-200Ⅰ+R2-TY-150Ⅰ mixture) and heterologous mixtures (R2-ToCV-200Ⅲ+R2-TY-200Ⅰ mixture), which were transferred to tomatoes by the Agrobacterium infiltration method to observe their stability and cross-protection effects on tomatoes.

[0170] (1) Stability analysis of the ToCV insertion-type CMV mutant in tomato

[0171] The mutants were mixed with wild-type CMV Fny RNA1 and CMV Fny The Agrobacterium liquid of RNA3 was mixed in equal proportions to form a vaccine, which was inoculated into Zhongshu No. 4 tomato by Agrobacterium infiltration method. The growth status of Zhongshu No. 4 tomato plants was observed 35 days after inoculation of the mutant. The leaves of the plants inoculated with wild-type CMV (R1 / R2 / R3) were wrinkled and rat-tail-shaped, and poorly developed; the plants inoculated with wild-type CMV (R1 / R2 / R3) grew well, with green and flat leaves, and no obvious changes in the leaf circumference; the plants treated with the mutant were basically the same as the healthy control plants, indicating that the ToCV insertion-type CMV mutant is attenuated on tomatoes ( Fig.17 A). 14 days after the mutant was inoculated, the uninoculated systemic leaves on the upper part of the plant were taken for RNA extraction, and RT-PCR detection was performed using CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37), and the expected bands were obtained, indicating that the ToCV insertion-type CMV mutant is stable on Zhongshu No. 4 tomato ( Fig.17 B).

[0172] (2) Analysis of the cross-protection effect of the ToCV insertion-type CMV mutant on tomatoes

[0173] Seven days after the ToCV insertion CMV mutant was inoculated into Zhongshu No. 4 tomato, the strong ToCV virus was inoculated using the grafting virus transmission method, and the cross-protection effect was evaluated 28 days later. The uninoculated upper systemic leaves were taken, RNA was extracted, and RT-PCR detection was performed using primers ToCV-3 / ToCV-4 (SEQ ID NO.38~39), and the expected bands ( Fig.18D). At the same time, the symptoms of tomato plants were observed. The leaves of plants inoculated with ToCV without pre-inoculation of mutants turned green and yellow between the veins, while the leaves of plants treated with mutants showed significantly reduced chlorosis, indicating that ToCV grafting was successful and that the mutants had a cross-protective effect against ToCV infection ( Fig.18 A). In order to further detect the cross-protection effect of mutants against ToCV on tomatoes, plant samples were tested using real-time fluorescence quantitative PCR (primer pairs are shown in SEQ ID NO.44-45, and internal reference primers are shown in SEQ ID NO.46-47). The results showed that the ToCV virus content in tomatoes infected with ToCV after pre-treatment with the vaccine was lower than that in healthy plants infected with strong ToCV. The virus content of plants treated with R2-ToCV-200Ⅲ and R2-ToCV-200Ⅳ mutants was 28.8% and 41% of the strong toxic content, respectively, indicating that the ToCV insertion-type CMV mutant has a good cross-protection effect against ToCV infection on Zhongshu No. 4 tomato ( Fig.18 B). The stability of the weak mutant in tomatoes was tested 7 days after inoculation with strong toxin, and the expected target bands were obtained, indicating that the ToCV insertion-type CMV mutant can still be stably inherited under strong toxin infection ( Fig.18 C). SEQ ID NO. 46: AGGCAGGATTTGCTGGTGATGATGCT; SEQ ID NO. 47: ATACGCATCCTTCTGTCCCATTCCGA.

[0174] (3) Stability analysis of TYLCV insertional CMV mutants in tomato

[0175] The mutants were mixed with wild-type CMV Fny RNA1 and CMV Fny Agrobacterium liquid of RNA3 was mixed in equal proportions to form a vaccine, which was inoculated into Zhongshu No. 4 tomato by Agrobacterium infiltration method. The growth status of Zhongshu No. 4 tomato plants was observed 35 days after inoculation of mutants. Plants inoculated with wild-type CMV (R1 / R2 / R3) were shorter, and the leaves were curled up like rat tails; the plants of healthy control grew well, and the leaves were flat; the plants treated with the two mutants were basically the same as the healthy plants, indicating that the two insertion mutants were attenuated in tomatoes ( Fig.19 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken to test the stability of the vaccine in Nicotiana benthamiana, RNA was extracted, and RT-PCR was performed using CMV-Fny2-2510-F / CMV-Fny2-2510-R (SEQ ID NO.36-37). Both obtained bands consistent with the expected ones, indicating that the two TYLCV insertion-type CMV mutants are stable in Zhongshu No. 4 tomatoes ( Fig.19 B).

[0176] (4) Analysis of the cross-protection effect of TYLCV insertional CMV mutants on tomatoes

[0177] TYLCV insertion-type CMV mutant was inoculated into Zhongshu No. 4 tomato for 7 days, and then inoculated with TYLCV infectious clone solution. 600 =0.7 (strong toxicity), and the cross protection effect was evaluated after 28 days. Uninoculated upper systemic leaves were taken, DNA was extracted, and PCR detection was performed using primers TYLCV-F / TYLCV-R (SEQ ID NO.40-41), and the expected bands ( Fig. 20 D). At the same time, the symptoms of tomato plants were observed. The leaves of plants inoculated with TYLCV without pre-inoculation with mutants were shrunken and the plants were short, while the plants treated with mutants grew well and the leaf symptoms were weakened. This shows that TYLCV successfully infected the plants and the mutants had a cross-protective effect against TYLCV infection ( Fig. 20 A). In order to further detect the cross-protection effect of mutants against TYLCV on tomatoes, plant samples were tested using real-time fluorescence quantitative PCR (primer pairs are shown in SEQ ID NO.48-49 and SEQ ID NO.46-47). The results showed that the TYLCV virus content in tomatoes infected with TYLCV after pre-treatment with the vaccine was lower than that in healthy plants infected with TYLCV. The virus content of plants treated with R2-TY-200Ⅰ and R2-TY-150Ⅰ mutants was 34.9% and 45.8% of that of the strong toxin, respectively, indicating that the TYLCV insertion-type CMV mutant has a good cross-protection effect against TYLCV infection on Zhongshu No. 4 tomato ( Fig. 20 B). The stability of the weak mutant in tomatoes was tested 7 days after inoculation with strong toxins, and the expected target bands were obtained, indicating that the TYLCV insertion-type CMV mutant can still be stably inherited under strong toxin infection ( Fig. 20 C).

[0178] (5) Stability analysis of homologous virus fragment insertion mutants inoculated in tomato

[0179] The R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ mixture and the R2-TY-200Ⅰ+R2-TY-150Ⅰ mixture were injected into Zhongshu No. 4 tomatoes by Agrobacterium infiltration method, and the symptoms of tomato plants were observed after 35 days. The healthy control plants grew well, with green and flat leaves and no obvious changes in leaf circumference, while the leaves of the plants inoculated with wild-type CMV (R1 / R2 / R3) were severely wrinkled, with reduced leaf circumference and poor development. The plants treated with mutants were basically the same as the healthy control plants, indicating that the homologous virus fragment insertion mutants were attenuated on tomatoes after mixed inoculation ( Fig.21 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken for RNA extraction. The primers CMV-Fny2-2510-F / CMV-Fny2-2510-R were used to detect the overall stability of the two mixtures. At the same time, the primers CMVTo-RdRp 1006-1205-F / CMV-Fny2-2510-R and CMV To-p8-1-200-F / CMV-Fny2-2510-R were used to detect the stability of the two mutants in the plants for the mixture of R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ, and the primers CMV TY-V1-1 F / CMV-Fny2-2510-R and CMV TY-V2-F / CMV-Fny2-2510-R detected the stability of the two mutants in the mixture in the plant, and both obtained amplified bands that met the expected fragment size, indicating that the mixture of R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ and R2-TY-200Ⅰ+R2-TY-150Ⅰ as a whole and the mutants that make up the mixture can stably coexist in tomato ( Fig.21 B).

[0180] (6) Analysis of the cross-protection effect of homologous virus fragment insertion mutants inoculated into tomatoes

[0181] After the homologous virus fragment insertion mutants were mixed and inoculated into Zhongshu No. 4 tomato for 7 days, the plants treated with the R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ mixture were inoculated with the ToCV infectious clone solution. 600=0.7 (strongly virulent); plants treated with the mixture of R2-TY-200Ⅰ+R2-TY-150Ⅰ were inoculated with strong TYLCV, and the cross-protection effect was evaluated after 28 days. The uninoculated upper systemic leaves were taken for RNA extraction, and RT-PCR detection was performed using primers ToCV-3 / ToCV-4, and the expected bands were obtained. At the same time, the symptoms of tomato plants were observed: the leaves of plants inoculated with ToCV without pre-inoculation with mutants were chlorotic and the veins were dark green, while the symptoms of plants treated with mutants were significantly weakened, indicating that ToCV grafting was successful, and the R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ mixture had a cross-protective effect on ToCV infection; DNA was extracted at the same time, and PCR detection was performed using TYLCV-F / TYLCV-R, and the expected bands were obtained. At the same time, the symptoms of tomato plants were observed: the leaves of plants directly inoculated with TYLCV with strong toxins shrank, and the symptoms of plants treated with mutants were weakened, indicating that TYLCV was successfully infected, and the R2-TY-200Ⅰ+R2-TY-150Ⅰ mixture had a cross-protective effect on TYLCV infection ( Fig. 22 A / C).

[0182] In order to further detect the cross-protective effect of homologous virus fragment insertion mutants mixed inoculated on tomatoes against strong virus infection, real-time fluorescence quantitative PCR (primer pairs are shown in SEQ ID NO.44-45 and SEQ ID NO.48-49, and internal reference primers are shown in SEQ ID NO.46-47) was used to detect plant samples. The results showed that the content of strong virus in tomatoes infected with strong virus after pre-treatment with vaccine was lower than that in healthy plants directly infected with strong virus. The virus content of ToCV in plants treated with R2-ToCV-200Ⅲ+R2-ToCV-200Ⅳ mixture was 18.2% of that of strong virus; the virus content of TYLCV in plants treated with R2-TY-200Ⅰ+R2-TY-150Ⅰ mixture was 15.7% of that of strong virus, indicating that the mixture of homologous virus fragment insertion mutants has a good cross-protective effect on single infection of target virus in Zhongshu No. 4 tomato ( Fig. 22 B). The stability of the weak mutants in tomatoes was tested 7 days after inoculation with the strong virus, and the expected target bands were obtained, indicating that the homologous virus fragment insertion mutant mixture can still be stably inherited under strong virus infection ( Fig. 22 D).

[0183] (7) Stability analysis of heterologous virus fragment insertion mutants inoculated into tomatoes

[0184] The R2-ToCV-200Ⅲ+R2-TY-200Ⅰ mixture was injected into Zhongshu No. 4 tomatoes by Agrobacterium infiltration, and the symptoms of the tomato plants were observed after 35 days. The healthy control plants grew well, with green and flat leaves and no obvious changes in leaf circumference, while the leaves of the plants inoculated with wild-type CMV (R1 / R2 / R3) were severely wrinkled, with reduced leaf circumference and poor development. The plants treated with mutants were basically the same as the healthy control plants, indicating that the heterologous virus fragment insertion mutants were attenuated on tomatoes after mixed inoculation ( Fig.23 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken for RNA extraction. The primers CMV-Fny2-2510-F / CMV-Fny2-2510-R were used to detect the overall stability of the mixture. At the same time, the primers CMVTo-RdRp 1006-1205-F / CMV-Fny2-2510-R and CMV TY-V1-1F / CMV-Fny2-2510-R were used to detect the stability of each mutant in the mixture in the plant. Amplified bands with expected fragment sizes were obtained, indicating that the heterologous virus fragment insertion mutant mixture as a whole and each mutant in the mixture can stably coexist in tomato ( Fig.23 B).

[0185] (8) Analysis of the cross-protection effect of mixed inoculation of heterologous virus fragment insertion mutants on tomatoes

[0186] Seven days after the heterologous virus fragment insertion mutants were mixed and inoculated into Zhongshu No. 4 tomato, the plants treated with the R2-ToCV-200Ⅲ+R2-TY-200Ⅰ mixture were infected with ToCV alone, TYLCV alone, and ToCV and TYLCV combined. The cross-protection effect was evaluated after 28 days. The uninoculated upper systemic leaves were taken to extract RNA and DNA respectively. RT-PCR detection was performed using primers ToCV-3 / ToCV-4, and PCR detection was performed using TYLCV-F / TYLCV-R. The expected bands were obtained, and the symptoms of tomato plants were observed at the same time: the leaves of plants infected with ToCV alone without pre-inoculation of mutants were chlorotic and the veins were dark green, the leaves of plants infected with TYLCV alone were severely wrinkled, and the leaves of plants infected with ToCV and TYLCV combined were chlorotic, brittle, and wrinkled more severely than those infected with ToCV alone, indicating that the single and combined infection of ToCV and TYLCV were successful, and the R2-ToCV-200Ⅲ+R2-TY-200Ⅰ mixture had cross-protection effects against both single and combined virus infections ( Fig.24 A / D).

[0187] In order to further detect the cross-protective effect of heterologous virus fragment insertion mutants inoculated on tomatoes against single and combined infection of strong toxins, real-time fluorescence quantitative PCR (primer pairs are shown in SEQ ID NO.44-45 and SEQ ID NO.48-49, and internal reference primers are shown in SEQ ID NO.46-47) was used to detect plant samples. The results showed that the content of strong toxin viruses in tomatoes infected with strong toxins after pre-treatment with vaccines was reduced compared with the content of viruses in healthy plants directly infected with strong toxins. In the case of single infection of strong toxins, the content of ToCV virus in plants treated with R2-ToCV-200Ⅲ+R2-TY-200Ⅰ mixture was 29.8% of that of strong toxins, and the content of TYLCV virus was 33.2% of that of strong toxins; while in the case of combined infection, the content of ToCV virus in plants treated with R2-ToCV-200Ⅲ+R2-TY-200Ⅰ mixture was 31% of that of strong toxins, and the content of TYLCV virus was 28.5% of that of strong toxins. This indicates that the heterologous virus fragment insertion mutant mixture has a good cross-protection effect on single infection and combined infection of target viruses in Zhongshu No. 4 tomato ( Fig.24 C). After 7 days of inoculation with strong toxin, the stability of the weak mutant in tomatoes was tested, and the expected target bands were obtained, which showed that the mixture and each single agent in the components could be stably inherited under strong toxin infection ( Fig.24 B).

[0188] Embodiment 14

[0189] Evaluation of indoor cross-protection effect of TRV-based attenuated vaccine on tomatoes

[0190] The attenuated mutants of ToCV and TYLCV virus fragments were inoculated on Nicotiana benthamiana, and stability analysis and cross-protection effect evaluation were carried out. V2-ToCV-200ⅲ, V2-ToCV-200ⅳ, V2-TY-200ⅰ, and V2-TY-150ⅰ mutants were selected for the next step of research. The above four mutants and Agrobacterium liquid of wild-type TRV RNA1 were mixed in equal proportions to prepare a single dose of vaccine, homologous mixtures (V2-ToCV-200ⅲ+V2-ToCV-200ⅳ mixture and V2-TY-200ⅰ+V2-TY-150ⅰ) and heterologous mixtures (V2-ToCV-200ⅲ+V2-TY-200ⅰ mixture), and transferred to tomatoes by Agrobacterium infiltration method to observe their stability and cross-protection effect on tomatoes.

[0191] (1) Stability analysis of the ToCV insertion-type TRV mutant in tomato

[0192] The mutant and wild-type TRVRAN1 Agrobacterium culture fluid were mixed in equal proportions to form a vaccine, which was inoculated onto Zhongshu No. 4 tomato plants using the Agrobacterium infiltration method. The growth status of Zhongshu No. 4 tomato plants was observed 35 days after inoculation with the mutant. The symptoms of the plants after TRV wild-type inoculation were mild, and the plants treated with the mutant were basically the same as the healthy control plants. The leaves of the plants were flat, growing well, and there was no obvious change in the leaf circumference, indicating that the ToCV insertion-type TRV mutant was attenuated on tomatoes ( Fig.25 A). 14 days after the mutant was inoculated, the uninoculated systemic leaves on the upper part of the plant were taken to test the stability of the vaccine in Zhongshu No. 4 tomato, RNA was extracted, and RT-PCR was performed using TRV2-F / TRV2-R. The expected bands were obtained, indicating that the ToCV insertion-type TRV mutant is stable in Zhongshu No. 4 tomato ( Fig.25 B).

[0193] (2) Analysis of the cross-protection effect of ToCV insertion-type TRV mutants on tomatoes

[0194] Seven days after the ToCV insertion TRV mutant was inoculated into Zhongshu No. 4 tomato, the strong ToCV virus was inoculated using the grafting virus transmission method. The cross-protection effect was evaluated 28 days later. The uninoculated upper systemic leaves were taken, RNA was extracted, and RT-PCR detection was performed using primers ToCV-3 / ToCV-4, and the expected bands ( Fig.26 D). At the same time, the symptoms of tomato plants were observed. The leaf chlorosis symptoms of plants pre-treated with mutants were significantly weakened compared with those of plants directly inoculated with ToCV, indicating that ToCV grafting was successful and that the mutants had a cross-protective effect against ToCV infection ( Fig.26 A). In order to further detect the cross-protection effect of the mutant against ToCV on tomatoes, plant samples were tested using real-time fluorescence quantitative PCR (primer pairs such as SEQ ID NO.44~45, internal reference primers such as SEQ ID NO.46~47). The results showed that the ToCV virus content in tomatoes infected with ToCV after pre-treatment with the vaccine was lower than that in healthy plants infected with strong ToCV. The virus content of plants treated with V2-ToCV-200ⅲ and V2-ToCV-200ⅳ mutants was 38.4% and 51.3% of the strong ToCV, respectively, indicating that the ToCV insertion-type TRV mutant has a good cross-protection effect against ToCV infection on Zhongshu No. 4 tomato ( Fig.26 B). The stability of the weak mutant in tomatoes was tested 7 days after inoculation with strong toxin, and the expected target band was obtained, indicating that the ToCV insertion-type TRV mutant can still be stably inherited in Zhongshu No. 4 tomatoes ( Fig.26 C).

[0195] (3) Stability analysis of TYLCV insertional TRV mutants in tomato

[0196] The mutant and wild-type TRV RNA1 Agrobacterium culture fluid were mixed into vaccines in equal proportions and inoculated into Zhongshu No. 4 tomatoes using the Agrobacterium infiltration method. The growth status of Zhongshu No. 4 tomato plants was observed 35 days after inoculation of the mutants. The overall condition of the plants treated with the two mutants was basically the same as that of healthy plants, with flat leaves, indicating that the two insertion mutants were both attenuated in tomatoes ( Fig. 27 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken to test the stability of the vaccine in Nicotiana benthamiana, RNA was extracted, and RT-PCR was performed using TRV2-F / TRV2-R. The expected bands were obtained, indicating that the two TYLCV insertion-type TRV mutants can be stably inherited in Zhongshu No. 4 tomato ( Fig. 27 B).

[0197] (4) Analysis of the cross-protection effect of TYLCV insertional TRV mutants on tomatoes

[0198] Seven days after the inoculation of the TYLCV insertion-type TRV mutant on Zhongshu No. 4 tomato, the TYLCV infectious clone solution was inoculated. The OD 600 =0.7 (strong toxicity), and the cross protection effect was evaluated after 28 days. Uninoculated upper systemic leaves were taken, DNA was extracted, and PCR detection was performed using primers TYLCV-F / TYLCV-R, and the expected bands ( Fig.28 D). At the same time, the symptoms of the plants were observed. The plants treated with the mutants grew well and the symptoms were reduced, while the plants that were not pre-inoculated with the mutants and directly infected with TYLCV had stunted growth and shrunken leaves. This shows that TYLCV successfully infected the plants and the mutants had a cross-protective effect against TYLCV infection ( Fig.28 A). In order to further detect the cross-protection effect of mutants against TYLCV on tomatoes, real-time fluorescence quantitative PCR (primer pairs shown in SEQ ID NO.48-49, internal reference primers such as SEQ ID NO.46-47) was used to detect plant samples. The results showed that the virus content of TYLCV in tomatoes infected with TYLCV after vaccine treatment was lower than that in healthy plants directly infected with TYLCV. After treatment with V2-TY-200ⅰ and V2-TY-150ⅰ mutants, the virus content in the plants was 42.7% and 52.5% higher than that of the strong toxin, respectively, indicating that the TYLCV insertion-type TRV mutant has a good cross-protection effect against TYLCV infection in Zhongshu No. 4 tomatoes ( Fig.28B). The stability of the weak mutant in tomatoes was tested 7 days after inoculation with the strong virus, and the expected target bands were obtained, indicating that the TYLCV insertion-type TRV mutant can still be stably inherited under TYLCV infection ( Fig.28 C).

[0199] (5) Stability analysis of homologous virus fragment insertion mutants inoculated in tomato

[0200] The V2-ToCV-200ⅲ+V2-ToCV-200ⅳ mixture and the V2-TY-200ⅰ+V2-TY-150ⅰ mixture were injected into Zhongshu No. 4 tomatoes by Agrobacterium infiltration method, and the symptoms of tomato plants were observed after 35 days. The healthy control plants grew well with flat leaves, and the plants treated with mutants were basically the same as the healthy control plants, indicating that the homologous virus fragment insertion mutants were attenuated on tomatoes after mixed inoculation ( Fig.29 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken for RNA extraction, and the primers TRV2-F / TRV2-R were used to detect the overall stability of the two mixtures. At the same time, the primers TRV To-RdRp1006-1205-F / TRV2-R and TRV To-p8-1-200-F / TRV2-R were used to detect the stability of the mutants constituting the mixture in the plants for the mixture of V2-ToCV-200ⅲ+V2-ToCV-200ⅳ, and the primers TRV TY-V1-1 F / TRV2-R and TRVTY-V2-F / TRV2-R were used to detect the stability of the mutants constituting the mixture in the plants for V2-TY-200ⅰ+V2-TY-150ⅰ. Amplified bands that met the expected fragment size were obtained, indicating that the mutants constituting the mixture and the mixture of two homologous virus fragment insertion mutants as a whole can stably coexist in tomato ( Fig.29 B).

[0201] (6) Analysis of the cross-protection effect of homologous virus fragment insertion mutants inoculated into tomatoes

[0202] Seven days after the homologous virus fragments were mixed and inoculated into Zhongshu No. 4 tomato, the plants treated with the mixture of V2-ToCV-200ⅲ+V2-ToCV-200ⅳ were inoculated with the ToCV infectious clone solution. 600=0.7 (strongly virulent); plants treated with the mixture of V2-TY-200ⅰ + V2-TY-150ⅰ were inoculated with strong TYLCV, and the cross-protection effect was evaluated after 28 days. The uninoculated upper systemic leaves were taken for RNA extraction, and RT-PCR detection was performed using primers ToCV-3 / ToCV-4, and the expected bands were obtained. At the same time, the symptoms of tomato plants were observed: the leaves of plants inoculated with ToCV without pre-inoculation of mutants turned green, while the symptoms of plants treated with mutants were significantly weakened, indicating that ToCV was successfully transmitted, and V2-ToCV-200ⅲ+V2-ToCV-200ⅳ had a cross-protective effect on ToCV infection; DNA was extracted at the same time, and PCR detection was performed using TYLCV-F / TYLCV-R, and the expected bands were obtained. At the same time, the symptoms of tomato plants were observed: the leaves of plants directly inoculated with TYLCV with strong toxins shrank, and the symptoms of plants treated with mutants were weakened, indicating that TYLCV infection was successful, and the mixture of V2-TY-200ⅰ+V2-TY-150ⅰ had a cross-protective effect on TYLCV infection ( Fig.30 A / C).

[0203] In order to further detect the cross-protective effect of homologous virus fragment insertion mutants mixed inoculated on tomatoes against strong virus infection, real-time fluorescence quantitative PCR (primer pairs are shown in SEQ ID NO.44-45 and SEQ ID NO.48-49, and internal reference primers are shown in SEQ ID NO.46-47) was used to detect plant samples. The results showed that the content of strong virus in tomatoes infected with strong virus after pre-treatment with vaccine was lower than that in healthy plants directly infected with strong virus. The virus content of ToCV in plants treated with V2-ToCV-200ⅲ+V2-ToCV-200ⅳ mixture was 29% of that of strong virus; the virus content of TYLCV in plants treated with V2-TY-200ⅰ+V2-TY-150ⅰ mixture was 21.1% of that of strong virus, indicating that the mixture of homologous virus fragment insertion mutants on Zhongshu No. 4 tomatoes has a good cross-protective effect against single infection of target virus ( Fig.30 B). The stability of the weak mutants in tomatoes was tested 7 days after inoculation with the strong virus, and the expected target bands were obtained, indicating that the homologous virus fragment insertion mutant mixture can still be stably inherited under strong virus infection ( Fig.30 D).

[0204] (7) Stability analysis of heterologous virus fragment insertion mutants inoculated into tomatoes

[0205] The V2-ToCV-200ⅲ+V2-TY-200ⅰ mixture was injected into Zhongshu No. 4 tomatoes by Agrobacterium infiltration method, and the symptoms of tomato plants were observed after 35 days. The healthy control plants grew well with flat leaves, and the plants treated with mutants were basically the same as the healthy control plants, indicating that the heterologous virus fragment insertion mutants were attenuated on tomatoes after mixed inoculation ( Fig.31 A). 14 days after the mutants were inoculated, the uninoculated systemic leaves on the upper part of the plants were taken for RNA extraction. The primers TRV2-F / TRV2-R were used to detect the overall stability of the mixture. At the same time, the primers TRV To-RdRp 1006-1205-F / TRV2-R and TRVTY-V1-1 F / TRV2-R were used to detect the stability of each mutant in the mixture in the plant. Amplified bands with expected fragment sizes were obtained, indicating that each mutant in the mixture and the heterologous virus fragment insertion mutant mixture as a whole can stably coexist in the tomato body ( Fig.31 B).

[0206] (8) Analysis of the cross-protection effect of mixed inoculation of heterologous virus fragment insertion mutants on tomatoes

[0207] Seven days after the heterologous virus fragment insertion mutants were mixed and inoculated into Zhongshu No. 4 tomato, the plants treated with the V2-ToCV-200ⅲ+V2-TY-200ⅰ mixture were infected with ToCV alone, TYLCV alone, and ToCV and TYLCV combined, and the cross-protection effect was evaluated after 28 days. Uninoculated upper systemic leaves were taken to extract RNA and DNA respectively. RT-PCR detection was performed using primers ToCV-3 / ToCV-4, and PCR detection was performed using TYLCV-F / TYLCV-R. Both obtained target bands of the expected length. At the same time, the symptoms of tomato plants were observed: the leaves of plants that were not treated with mutants and were directly infected with ToCV alone turned chlorotic and yellow, the leaves of plants that were infected with TYLCV alone turned wrinkled, and the leaves of plants that were infected with ToCV and TYLCV combined with wrinkled leaves and chlorotic and yellowing degrees were further aggravated compared with single infection, indicating that the single infection and combined infection of ToCV and TYLCV were successful, and the V2-ToCV-200ⅲ+V2-TY-200ⅰ mixture had a cross-protective effect against both single infection and combined infection of ToCV and TYLCV ( Fig.32 A / D).

[0208] In order to further detect the cross-protection effect of mixed inoculation of heterologous virus fragment insertion mutants on tomatoes against strong single infection and combined infection, plant samples were detected using real-time fluorescence quantitative PCR (primer pairs are shown in SEQ ID NOs.44-45 and SEQ ID NOs.48-49, and internal reference primers are shown in SEQ ID NOs.46-47). The results showed that the content of strong virus in tomatoes infected with strong virus after pre-treatment with vaccine showed a downward trend compared with the content of virus in healthy plants after direct infection with strong virus. In the case of single strong virus infection, the virus content of ToCV in plants treated with V2-ToCV-200ⅲ+V2-TY-200ⅰ mixture was 37.6% of the strong virus, and the virus content of TYLCV was 41.9% of the strong virus; while in the case of combined infection, the virus content of ToCV in plants treated with V2-ToCV-200ⅲ+V2-TY-200ⅰ mixture was 35.3% of the strong virus, and the virus content of TYLCV was 32% of the strong virus. This shows that the heterologous virus fragment insertion mutant mixture has a relatively good cross-protection effect on Zhongshu No. 4 tomato against single infection and combined infection of target virus ( Fig.32 C). The stability of the vaccine was tested 7 days after inoculation with the strong virus, and the expected bands were obtained, indicating that the mutant mixture and each single agent in the components can be stably inherited in tomato plants under the condition of strong virus infection ( Fig.32 B).

[0209] The present invention provides a attenuated vaccine against tomato chlorosis virus and tomato yellow leaf curl virus and a construction method and application thereof. The present invention is based on the attenuated vaccine containing CMV Fny Plasmid vector pCC F R2-2bPTII vector and TR V2-Vector plasmid vector based on TRV modification were used to construct a total of 14 insertion-type attenuated mutants of target ToCV and TYLCV. These mutants can be stably inherited and cross-protected in both Nicotiana benthamiana and tomato plants. Mixed inoculation of two heterologous virus fragment mutants based on the same vector can expand the prevention and control range of attenuated vaccines. It can not only prevent and control vector viruses, but also two heterologous viruses. There is no significant difference between the prevention effect of single infection of target viruses and the single-dose prevention effect of the components; for compound infection of target viruses, the average content of viruses in plants can be controlled at about 30% of the compound infection control plants. It provides technical support for the prevention and control of single infection and compound infection of ToCV and TYLCV.

[0210] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A attenuated vaccine against tomato chlorosis virus and tomato yellow leaf curl virus, characterized in that: The attenuated vaccine includes a mutant resistant to tomato chlorosis virus and a mutant resistant to tomato yellow leaf curl virus; The tomato chlorosis virus-resistant mutant comprises a gene fragment of the tomato chlorosis virus and an empty vector; The gene fragment of the tomato chlorosis virus is any one of the gene fragments shown in SEQ ID NO.1 to 5, and the empty vector is a vector containing CMV Fny the mutant RNA2 or TRV of the isolate; The tomato yellow leaf curl virus-resistant mutant comprises a gene fragment of tomato yellow leaf curl virus and an empty vector; The gene fragment of the tomato yellow leaf curl virus is shown in SEQ ID NO.6 or SEQ ID NO.7, and the empty vector contains CMV Fny Isolate mutant RNA2 or mutant TRV.

2. The attenuated vaccine according to claim 1, characterized in that: The CMV Fny The mutant RNA2 of the isolate was pCC F R2-2bPTII vector; The mutant type of TRV is TRV2-Vector vector.

3. The attenuated vaccine according to claim 1, characterized in that: The primer pair for amplifying the gene fragment shown in SEQ ID NO.1 is shown in SEQ ID NO.8-9 or SEQ ID NO.10-11; The primer pair for amplifying the gene fragment shown in SEQ ID NO.2 is shown in SEQ ID NO.12-13 or SEQ ID NO.14-15; The primer pair for amplifying the gene fragment shown in SEQ ID NO.3 is shown in SEQ ID NO.16-17 or SEQ ID NO.18-19; The primer pair for amplifying the gene fragment shown in SEQ ID NO.4 is shown in SEQ ID NO.20-21 or SEQ ID NO.22-23; The primer pair for amplifying the gene fragment shown in SEQ ID NO.5 is shown in SEQ ID NOs.24-25 or SEQ ID NOs.26-27.

4. The attenuated vaccine according to claim 1, characterized in that: The primer pair for amplifying the gene fragment shown in SEQ ID NO.6 is shown in SEQ ID NO.28-29 or SEQ ID NO.30-31; The primer pair for amplifying the gene fragment shown in SEQ ID NO.7 is shown in SEQ ID NOs.32-33 or SEQ ID NOs.34-35.

5. The method for constructing an attenuated vaccine according to any one of claims 1 to 4, characterized in that: The steps include: (1) Using the genome of tomato chlorosis virus as a template, amplify the corresponding gene fragment using primer pairs; (2) double-digesting the gene fragment and the empty vector described in step (1) and ligating them to obtain a mutant resistant to tomato chlorosis virus; (3) Using the genome of tomato yellow leaf curl virus as a template, amplify the corresponding gene fragment using primer pairs; (4) double-digesting the gene fragment and the empty vector described in step (3), and then ligating them to obtain a mutant resistant to tomato yellow leaf curl virus; (5) Mix the mutants resistant to tomato chlorosis virus and the mutants resistant to tomato yellow leaf curl virus to obtain a attenuated vaccine.

6. The construction method according to claim 5, characterized in that: The restriction sites for the double enzyme digestion in step (2) are BamHI and SmaⅠ or BamHI and XbaⅠ.

7. The construction method according to claim 6, characterized in that: The restriction sites for the double restriction digestion in step (4) are BamHI and SmaⅠ or BamHI and XbaⅠ.

8. Use of the attenuated vaccine according to any one of claims 1 to 4 in the preparation of a product that is resistant to both tomato chlorosis virus and tomato yellow leaf curl virus.

9. A kit for resisting tomato chlorosis virus and tomato yellow leaf curl virus, characterized in that: The kit includes an attenuated vaccine against both tomato chlorosis virus and tomato yellow leaf curl virus; The attenuated vaccine against both tomato chlorosis virus and tomato yellow leaf curl virus is the attenuated vaccine according to any one of claims 1 to 4 or the attenuated vaccine constructed according to the construction method according to any one of claims 5 to 7.

10. A method for resisting tomato chlorosis virus and tomato yellow leaf curl virus, characterized in that: The steps include: The attenuated vaccine is inoculated into crops to obtain crops that are resistant to tomato chlorosis virus and tomato yellow leaf curl virus; the attenuated vaccine is the attenuated vaccine according to any one of claims 1 to 4 or the attenuated vaccine constructed according to the construction method according to any one of claims 5 to 7. The crop is a Solanaceae crop or Nicotiana benthamiana.

Images