Coronavirus attenuated vaccine as well as preparation method and application thereof

By deleting or mutating the SL5 stem-loop structure in the coronavirus 5'UTR, a recombinant attenuated coronavirus strain was constructed, solving the problems of long processing time and unclear mechanism in existing attenuated live vaccines. This resulted in a safe and efficient attenuation effect, suitable for preventing various coronavirus infections.

CN121362767APending Publication Date: 2026-01-20WUHAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410957029.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-17
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Existing technologies make it difficult to develop safe and effective live attenuated vaccines to prevent various coronavirus infections. In particular, the attenuation mechanisms of live attenuated vaccines for yellow fever 17D and Japanese encephalitis virus SA14-14-2 are unclear and time-consuming. There are currently no live attenuated coronavirus vaccines in clinical trials worldwide.

Method used

By deleting or mutating the SL5 stem-loop structure in the 5' untranslated region (5'UTR) of coronavirus, a recombinant attenuated coronavirus strain was constructed. Nucleotide sequence modification was performed in Escherichia coli using molecular cloning and reverse genetics techniques. Viral replication was then carried out by combining the early promoter of cytomegalovirus and the ribozyme of hepatitis D virus to construct an attenuated live vaccine.

Benefits of technology

This study achieved high safety, reduced replication level, and good genetic stability of attenuated coronavirus strains, avoiding genome integration into host cells, and has promising application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362767A_ABST
    Figure CN121362767A_ABST
Patent Text Reader

Abstract

The invention discloses a coronavirus attenuated strain, a vaccine as well as a preparation method and application of the coronavirus attenuated strain. Compared with a natural strain, the coronavirus attenuated strain disclosed by the invention at least comprises deletion of a No.5 stem loop (Stem-loop 5, SL5) from the 131 site to the 350 site of a 5 '-non-coding region (5' UTR) or mutation of any nucleotide maintaining a stem loop structure in a second stem loop from the 175 site to the 299 site of the SL5; compared with a natural strain, the virulence of the SL5-deleted mutant virus strain is obviously reduced; the SL5-deficient mutant virus strain has better genetic stability, and the carried virus genome has no risk of being integrated into the host cell genome. Therefore, the coronavirus attenuated strain disclosed by the invention can be used as an attenuated live vaccine for preventing coronavirus infection, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, in particular to a coronavirus attenuated vaccine and a preparation method and application thereof. BACKGROUND

[0002] Coronaviruses are prone to gene recombination and mutation during evolution, leading to genetic diversity and a wide range of hosts, which provides conditions for coronavirus cross-species transmission. Currently, seven coronaviruses that can infect humans have been found, including four human coronaviruses HCoV-OC43, HCoV-HKU1, HCoV-NL63 and HCoV-229E that cause mild respiratory diseases, and three highly pathogenic coronaviruses SARS-CoV, MERS-CoV and SARS-CoV-2 that cause pandemics. At present, only SARS-CoV-2 has corresponding vaccines and drugs, but there is an urgent need to develop more broad-spectrum therapeutic drugs and vaccines against multiple coronaviruses that can infect humans and the potential risk of cross-species transmission of coronaviruses in the future.

[0003] Vaccines are effective preventive measures against viral infections, including nucleic acid vaccines (DNA / RNA), subunit vaccines, virus-like particle vaccines, viral vector vaccines, inactivated vaccines, and attenuated live vaccines. Compared with other types of vaccines, attenuated live vaccines can simulate the process of live virus infection, more effectively stimulate the immune system to cause adaptive immune response, and at the same time can activate the cellular immune response with broad-spectrum antiviral effect. For example, yellow fever 17D attenuated live vaccine (YF17D) can induce extensive innate humoral immunity and cellular immunity, and can produce lifelong protection after a single vaccination. The attenuated live vaccine of Japanese encephalitis virus SA14-14-2 also has good safety and significant efficacy. However, the yellow fever 17D and Japanese encephalitis virus SA14-14-2 attenuated live vaccines are attenuated by continuous passage of the parent virus in cells or animals, which has the defects of long time-consuming and unclear attenuation mechanism. With the development of molecular virology and reverse genetics operation technology, safe and efficient attenuated live vaccines can be designed by deleting virulence genes in the viral genome. At present, there is no coronavirus vaccine developed by attenuated live vaccine technology in the world that has entered the clinical trial stage, and there is an urgent need in the field to develop a coronavirus attenuated live vaccine that can effectively prevent infection of multiple coronaviruses to cope with possible future coronavirus outbreaks. SUMMARY

[0004] Invention objectives

[0005] The present application aims to provide a recombinant coronavirus attenuated strain, related products and their use in the preparation of drugs (particularly vaccines) for preventing or treating coronavirus infection.

[0006] Solution

[0007] To achieve the object of the present application, the present application provides the following technical solutions.

[0008] The present application provides a nucleotide sequence with weakened function of 5' untranslated region (5'UTR) of coronavirus, which comprises at least the following mutations compared with the 5'UTR of natural strain: deletion of Stem-loop 5 (SL5) at positions 131-350 of 5'UTR, or any one nucleotide mutation in the second stem-loop at positions 175-299 of SL5 which maintains the stem-loop structure.

[0009] Specifically, the nucleotide sequence with weakened function of 5'UTR of coronavirus comprises at least one of the following nucleotide sequences with weakened function:

[0010] The nucleotide sequence with weakened function of 5'UTR of novel coronavirus (SARS-CoV-2) is deletion of SL5 at positions 150-294 of 5'UTR of natural strain (Genbank accession number: MN908947) (as shown in SEQ ID NO: 1), or any one nucleotide mutation in the second stem-loop at positions 228-252 of SL5 which maintains the stem-loop structure:

[0011] ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAG ATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGT GCACTCACGCAGTATAATTAATAACTAATTACTG (SEQ ID NO: 1);

[0012] The nucleotide sequence with weakened function of 5'UTR of atypical coronavirus (SARS-CoV) is deletion of SL5 at positions 149-293 of 5'UTR of natural strain (Genbank accession number: AY274119) (as shown in SEQ ID NO: 2), or any one nucleotide mutation in the second stem-loop at positions 227-251 of SL5 which maintains the stem-loop structure:

[0013] ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATC TGTTCTCTAAACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCA CCTACGCAGTATAAACAATAATAAATTTTACTG (SEQ ID NO: 2);

[0014] The functional attenuated nucleotide sequence of Middle East Respiratory Syndrome coronavirus (MERS-CoV) 5' UTR is a SL5 deletion (as shown in SEQ ID NO: 3) from position 195 to position 350 of the 5' UTR of the natural strain (Genbank accession number: JX869059), or any one nucleotide mutation in the second stem loop of SL5 from position 273 to position 299 that maintains the stem loop structure:

[0015] GATTTAAGTGAATAGCTTGGCTATCTCACTTCCCCTCGTTCTCTTGCAGAACTTTGATTTTAACGAACTTAAATAAAAGCCCTGTTGTTTAGCGTATCGTTGCACTTGTCTGGTGGGATTGTGGCATTAATTTGCCTGCTCATCTAGGCAGTGGACATATGCTCAACACTGGGTATAATTCTAATTGAATACTA (SEQ ID NO: 3);

[0016] The functional attenuated nucleotide sequence of Human coronavirus OC43 (HCoV-OC43) 5' UTR is a SL5 deletion (as shown in SEQ ID NO: 4) from position 131 to position 299 of the 5' UTR of the natural strain (Genbank accession number: KU131570), or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 227 that maintains the stem loop structure:

[0017] CTCTTCCGATCTAATTGCGTGCGTGCAACCCGCTTCACTGATCTCTTGTTAGATCTT TTTGTAATCTAAACTTTATAAAAACATCCACTCCCTGTAATCTATGCTTGTGGGCGTAGA TTTTTCATAGTGG (SEQ ID NO: 4);

[0018] The nucleotide sequence of the functional attenuated 5' UTR of human coronavirus HKU1 (HCoV-HKU1) is a SL5 deletion (as shown in SEQ ID NO: 5) from position 243 to position 297 of the 5' UTR of the natural strain (Genbank accession number: AY597011), or any one of the nucleotide mutations in the second stem loop of SL5 from position 254 to position 283 that maintain the stem loop structure:

[0019] GAGTTTGAGCGATTGACGTTCGTACCGTCTATCAGCTTACGATCTCTTGTCAGATCTCATTAAATCTAAACTTTTTAAACAAGATTCCCTGTTATCCATGCTTGTGAGTGTGGTTTAATCATAATCTTGTATTTTACTTTCCACACTTTTCATCTCTCTGCCAGTGACGTGTTGGTTGTCCTCAGCGTCCCTCCCATAGGTCGCAATGATTAAAACCAGCAAATACGGTCTCGGCTTCAAGT (SEQ ID NO: 5);

[0020] The nucleotide sequence of the functional attenuated 5' UTR of human coronavirus NL63 (HCoV-NL63) is a SL5 deletion (as shown in SEQ ID NO: 6) from position 144 to position 287 of the 5' UTR of the natural strain (Genbank accession number: AY567487), or any one of the nucleotide mutations in the second stem loop of SL5 from position 208 to position 247 that maintain the stem loop structure:

[0021] CTTAAAGAATTTTTCTATCTATAGATAGAGAATTTTCTTATTTAGACTTTGTGTCTACTCTTCTCAACTAAACGAAATTTTTCTAGTGCTGTCATTTGTTATGGCAGTCCTAGTGTAA TTGAAATTTCGTCAAGTTTGTAAAC (SEQ ID NO: 6);

[0022] The nucleotide sequence of the functional attenuated 5' UTR of human coronavirus 229E (HCoV-229E) is a SL5 deletion (as shown in SEQ ID NO: 7) from position 208 to position 290 of the 5' UTR of the natural strain (Genbank accession number: AF304460), or any one of the nucleotide mutations in the second stem loop of SL5 from position 254 to position 271 that maintain the stem loop structure:

[0023] ACTTAAGTACCTTATCTATCTACAGATAGAAAAGTTGCTTTTTAGACTTTGTGTCTACTTTTCTCAACTAAACGAAATTTTTGCTATGGCCGGCATCTTTGATGCTGGAGTCGTAGTGTAATTGAAATTTCATTTGGGTTGCAACAGTTTGGAAGCAAGTGCTGTGTGTCCTAGTCTAAGGGTTTCGTGTTCCGTCACGAGATTCCA (SEQ ID NO: 7).

[0024] Further, the coronavirus 5' UTR function-attenuated nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 1-7.

[0025] Further, the coronavirus can also be a coronavirus that infects mammals, and the coronavirus 5' UTR function-attenuated nucleotide sequence is the corresponding reference to the above-mentioned 5' UTR function-attenuated nucleotide sequence of the coronavirus that infects humans.

[0026] The coronavirus 5' UTR function-attenuated nucleotide sequence of the present application can be obtained by the following method:

[0027] By means of molecular cloning operation technology well known to those skilled in the art, a deletion or mutation (for example, resulting in a deletion of nucleotides 131-350 of the 5' UTR) is made in the 5' UTR sequence of the natural strain of the coronavirus, and by means of homologous recombination and E. coli transformation, a coronavirus function-attenuated nucleotide sequence clone is finally obtained.

[0028] The "mutation" mentioned in the present application refers to a change in the base in the nucleotide sequence in biology, but does not result in a change in the amino acid sequence of the protein. Mutations are commonly used in the field of synthetic biology to artificially design and modify to achieve new functions. The present application is based on the modification of the 5' UTR of the coronavirus to achieve the attenuation design.

[0029] The application also provides a recombinant coronavirus attenuated strain, which comprises at least the following mutations compared with the natural strain: deletion of SL5 from position 131 to position 350 of 5'UTR, or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 299 which maintains the stem loop structure.

[0030] Specifically, the cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus attenuated strain comprises at least one of the following nucleotide sequences:

[0031] The cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus SARS-CoV-2 attenuated strain is deletion of SL5 from position 150 to position 294 of 5'UTR of the natural strain (Genbank accession number: MN908947), or any one nucleotide mutation in the second stem loop of SL5 from position 228 to position 252 which maintains the stem loop structure;

[0032] The cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus SARS-CoV attenuated strain is deletion of SL5 from position 149 to position 293 of 5'UTR of the natural strain (Genbank accession number: AY274119), or any one nucleotide mutation in the second stem loop of SL5 from position 227 to position 251 which maintains the stem loop structure;

[0033] The cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus MERS-CoV attenuated strain is deletion of SL5 from position 195 to position 350 of 5'UTR of the natural strain (Genbank accession number: JX869059), or any one nucleotide mutation in the second stem loop of SL5 from position 273 to position 299 which maintains the stem loop structure;

[0034] The cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus HCoV-OC43 attenuated strain is deletion of SL5 from position 131 to position 299 of 5'UTR of the natural strain (Genbank accession number: KU131570), or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 227 which maintains the stem loop structure;

[0035] The cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus HCoV-HKU1 attenuated strain is deletion of SL5 from position 243 to position 297 of 5'UTR of the natural strain (Genbank accession number: AY597011), or any one nucleotide mutation in the second stem loop of SL5 from position 254 to position 283 which maintains the stem loop structure;

[0036] The cDNA nucleotide sequence corresponding to the genome RNA of the attenuated strain of recombinant coronavirus HCoV-NL63 is the SL5 deletion from 144th to 287th of 5' UTR of the natural strain (Genbank accession number: AY567487), or any one nucleotide mutation in the second stem loop of SL5 from 208th to 247th which maintains the stem loop structure.

[0037] The cDNA nucleotide sequence corresponding to the genome RNA of the attenuated strain of recombinant coronavirus HCoV-229E is the SL5 deletion from 208th to 290th of 5' UTR of the natural strain (Genbank accession number: AF304460), or any one nucleotide mutation in the second stem loop of SL5 from 254th to 271th which maintains the stem loop structure.

[0038] Further, the coronavirus can also be a coronavirus which can infect mammals, and the cDNA nucleotide sequence corresponding to the genome RNA of the attenuated strain of the coronavirus is the corresponding reference to the cDNA nucleotide sequence corresponding to the genome RNA of the attenuated strain of the coronavirus which can infect human described above.

[0039] The present application also provides a construction method of the attenuated strain of recombinant coronavirus, which comprises the following steps:

[0040] (1) The whole genome of the parent coronavirus strain is divided into five fragments with similar sizes for PCR amplification. The Cytomegalovirus immediate early promoter (pCMV) is added to the 5' end of the first fragment of the viral genome, and the SL5 deletion from 131st to 350th of the 5' UTR region or any one nucleotide mutation in the second stem loop of SL5 from 175th to 299th which maintains the stem loop structure is performed, and the Hepatitis delta virus ribozyme (HDVR) sequence and the SV40 early mRNA polyadenylation signal (SV40pA) sequence are added to the 3' end of the fifth fragment, and the infectious subgenomic replicon of the attenuated strain of coronavirus is constructed by fusion PCR;

[0041] (2) The constructed infectious subgenomic replicon is transfected into human malignant fetal rhabdomyosarcoma cells, and the replicon is transcribed in the host cells to form infectious viral transcripts, and the replication and proliferation of the virus are performed to obtain the attenuated strain of coronavirus.

[0042] The present application also provides a recombinant coronavirus mRNA or cDNA comprising at least the following mutations compared to the natural strain: SL5 deletion from position 131 to position 350 of 5'UTR, or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 299 that maintains the stem loop structure.

[0043] In particular, the recombinant coronavirus mRNA or cDNA comprises at least one of the following nucleotide sequences:

[0044] The recombinant SARS-CoV-2 mRNA or cDNA nucleotide sequence is SL5 deletion from position 150 to position 294 of 5'UTR of the natural strain (Genbank accession number: MN908947), or any one nucleotide mutation in the second stem loop of SL5 from position 228 to position 252 that maintains the stem loop structure;

[0045] The cDNA nucleotide sequence corresponding to the recombinant SARS-CoV mRNA is SL5 deletion from position 149 to position 293 of 5'UTR of the natural strain (Genbank accession number: AY274119), or any one nucleotide mutation in the second stem loop of SL5 from position 227 to position 251 that maintains the stem loop structure;

[0046] The cDNA nucleotide sequence corresponding to the recombinant MERS-CoV mRNA is SL5 deletion from position 195 to position 350 of 5'UTR of the natural strain (Genbank accession number: JX869059), or any one nucleotide mutation in the second stem loop of SL5 from position 273 to position 299 that maintains the stem loop structure;

[0047] The cDNA nucleotide sequence corresponding to the HCoV-OC43 mRNA is SL5 deletion from position 131 to position 299 of 5'UTR of the natural strain (Genbank accession number: KU131570), or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 227 that maintains the stem loop structure;

[0048] The cDNA nucleotide sequence corresponding to the recombinant HCoV-HKU1 mRNA is SL5 deletion from position 243 to position 297 of 5'UTR of the natural strain (Genbank accession number: AY597011), or any one nucleotide mutation in the second stem loop of SL5 from position 254 to position 283 that maintains the stem loop structure;

[0049] The cDNA nucleotide sequence corresponding to the recombinant HCoV-NL63 mRNA is the deletion of SL5 from 144th to 287th in 5'UTR of natural strain (Genbank accession number: AY567487), or any one nucleotide mutation in the 2nd stem loop of SL5 from 208th to 247th which maintains the stem loop structure;

[0050] The cDNA nucleotide sequence corresponding to the recombinant HCoV-229E mRNA is the deletion of SL5 from 208th to 290th in 5'UTR of natural strain (Genbank accession number: AF304460), or any one nucleotide mutation in the 2nd stem loop of SL5 from 254th to 271th which maintains the stem loop structure.

[0051] Further, the coronavirus can also be a coronavirus which infects mammals, and the coronavirus mRNA or cDNA nucleotide sequence corresponds to the above-mentioned coronavirus mRNA or cDNA nucleotide sequence which can infect human.

[0052] The present application also provides a recombinant coronavirus attenuated vaccine, wherein the active ingredient of the vaccine comprises the recombinant coronavirus attenuated strain or the recombinant coronavirus mRNA or cDNA as described above.

[0053] The present application also provides a medicine / pharmaceutical composition, wherein the medicine / pharmaceutical composition comprises:

[0054] an effective amount of the coronavirus 5'UTR function-attenuated nucleotide sequence, the recombinant coronavirus attenuated strain, the recombinant coronavirus mRNA or cDNA, or the recombinant coronavirus attenuated vaccine which is pharmacologically acceptable; and

[0055] a pharmaceutically acceptable carrier.

[0056] The present application also provides a coronavirus detection reagent / kit, wherein the reagent / kit comprises the coronavirus 5'UTR function-attenuated nucleotide sequence, the recombinant coronavirus attenuated strain, the recombinant coronavirus mRNA or cDNA, the recombinant coronavirus attenuated vaccine, or the medicine / pharmaceutical composition as described above.

[0057] The present application also provides the use of the coronavirus 5'UTR function-attenuated nucleotide sequence, the recombinant coronavirus attenuated strain, the recombinant coronavirus mRNA or cDNA, the recombinant coronavirus attenuated vaccine, the medicine / pharmaceutical composition, or the reagent / kit as described above in the preparation of a medicine for preventing or treating coronavirus infection.

[0058] Preferably, the drug is a vaccine, further preferably, a live attenuated vaccine;

[0059] The present application also provides the recombinant coronavirus attenuated vaccine for preventing or treating coronavirus infection.

[0060] Advantages

[0061] The inventors of the present application constructed a recombinant coronavirus attenuated strain by deleting the SL5 stem loop at position 131-350 of the 5'UTR region of 7 coronavirus natural strains or mutating any one nucleotide maintaining the stem loop structure in the second stem loop at position 175-299 of SL5. The recombinant coronavirus attenuated strain has the following advantages:

[0062] (1) sufficient attenuation; compared with the natural strain, the replication level of the ΔSL5 mutant strain is reduced, and the safety is extremely high;

[0063] (2) stable characteristics; the ΔSL5 mutant strain has good genetic stability, and the possibility of returning to the natural strain is low;

[0064] (3) the ΔSL5 mutant strain only replicates in the cytoplasm, and the genome carried by it has no risk of integration into the host cell genome.

[0065] In view of the above, the recombinant coronavirus attenuated strain of the present application has a good application prospect as a coronavirus attenuated live vaccine for preventing coronavirus. BRIEF DESCRIPTION OF DRAWINGS

[0066] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0067] Figure 1 Schematic diagram of 5'UTR functional region of 7 coronaviruses;

[0068] Figure 2 Verification of 5'UTR functional region of coronavirus;

[0069] Figure 3 Verification of 5'UTR functional region of 7 coronaviruses;

[0070] Figure 4 Construction of coronavirus attenuated strain and evaluation of replication characteristics. DETAILED DESCRIPTION

[0071] The advantages and various effects of the present application will be more clearly presented hereinafter with specific embodiments and example drawings. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present application, but not to limit the present application.

[0072] Throughout the specification, the terms used by the present application should be understood as having the meanings commonly used in the art, unless otherwise specifically stated. Therefore, unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs. If there is a conflict, the present specification takes precedence.

[0073] Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or obtained by existing methods.

[0074] The technical solution of the embodiments of the present application is to solve the above technical problems, and the general idea is as follows:

[0075] Coronaviruses belong to single-stranded positive-sense RNA viruses. After entering host cells, the viral genome can act as mRNA to guide the synthesis of viral proteins using host ribosomes. The 5' UTR region of coronavirus is an important element for regulating viral mRNA translation, which regulates the translation activity and half-life of viral mRNA through interaction with RNA binding proteins. Therefore, revealing the function of coronavirus 5' UTR helps us to understand the pathogenic mechanism of coronavirus and provides scientific basis and practical application value for the development of attenuated live vaccine. The present application explores the function of 5' UTR of 7 kinds of coronaviruses that can infect humans. The 5' UTR of coronavirus can form multiple stem-loop structures, and the stem-loop structure SL5 located at No. 5 is a key stem-loop for mediating coronavirus mRNA translation. The present application provides that the 5' UTR can significantly inhibit the translation level of coronavirus mRNA after deleting SL5, which can provide new ideas and schemes for the development of attenuated live vaccine of coronavirus. Specifically:

[0076] The present application first found that the SL5 stem-loop of coronavirus 5' UTR is a key functional region for mediating viral mRNA translation. The destruction of SL5 secondary structure leads to the loss of stem-loop function, thereby inhibiting the viral translation function mediated by 5' UTR. It is further found that the protein translation level mediated by 5' UTR with SL5 deleted (having a nucleotide sequence as shown in SEQ ID NO: 1-7) is significantly lower than that of the natural strain 5' UTR, indicating that the function of 5' UTR with stem-loop structure SL5 deleted is weakened. The virus with the weakened function includes SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-OC43, HCoV-HKU1, HCoV-NL63 and HCoV-229E, a total of 7 viruses.

[0077] Subsequently, the application constructs a SL5 mutant strain of HCoV-OC43 by reverse genetics method, and determines the virulence of the two viruses by growth curve determination of the mutant strain and the natural virus strain. Compared with the natural virus, the virus replication level of the SL5 mutant virus after infecting cells is significantly reduced. Therefore, the attenuated strain of coronavirus as an attenuated live vaccine for preventing coronavirus infection has good application prospect.

[0078] The application of a coronavirus attenuated strain, vaccine, and preparation and application thereof will be described in detail below with reference to examples and experimental data.

[0079] Example 1, screening of a key functional region of coronavirus 5'UTR

[0080] 1, establishment of a coronavirus 5'UTR function weakening report system

[0081] The application downloads the genomic sequences of 7 kinds of human coronavirus from NCBI, and performs secondary structure comparison analysis on the 5'UTR sequences of the 7 kinds of coronavirus by using RNAFolding software. As shown in Figure 1 , the 5'UTR region of the coronavirus exists similar SL5 stem-loop structure, which contains UUYCGU motif, and this motif is highly conserved in the 7 kinds of coronavirus, which indicates that the SL5 stem-loop may have similar functions.

[0082] In order to explore the function of the SL5 stem-loop structure of the coronavirus, the application inserts the 5'UTR of the coronavirus between the CMV promoter and the luciferase report gene as the mRNA translation regulation element, and constructs two report systems of 5'UTR full length and 5'UTR SL5, respectively, so as to represent the translation level of the virus mRNA by the luciferase expression level. The 5'UTR amplification primers of different coronaviruses are shown in Table 1.

[0083] Table 1-primer sequences

[0084]

[0085]

[0086] 2, verification of the function of the SL5 stem-loop of the coronavirus

[0087] The application finds that SL5 is the longest sequence and the highest structured stem-loop in the 5'UTR region by the secondary structure analysis of the 5'non-coding region of SARS-CoV-2 Figure 2A) RNA regions with complex secondary structures tend to bind tightly to proteins, which indicates that SL5 may play a key role in the translation regulatory function of 5'UTR. Further analysis by software, the present application predicts that the 2nd stem loop of SL5 plays a major regulatory function. Therefore, the present application screens 4 nucleotide sites on the 2nd stem loop of SL5 that maintain the stem loop structure: G236, U238, C241 and G250 Figure 2 B) The present application further constructs five reporter systems of SL5-WT, SL5-G236U, SL5-U238C, SL5-C241G and SL5-G250C using the above-mentioned luciferase reporter systems of SARS-CoV-2 5'UTR and 5'UTR-ΔSL5, to verify the influence of structural changes of SL5 stem loop on viral mRNA translation.

[0088] The present application determines the mRNA translation level of different reporter systems in 293T cells. First, 293T cells are plated in a 24-well plate, and when the cell density reaches 60-70%, transfection is started. 500 ng of seven reporter system plasmids are co-transfected with 100 ng of viral translation regulatory protein expression plasmid, and the transfected cells are further cultured at 37℃ for 24 h, and the cells are lysed to detect luciferase activity. The experimental results are shown in Figure 2 C, compared with full-length 5'UTR, there is no significant difference in viral mRNA translation level of SL5 reporter system. However, the viral mRNA translation level of the five SL5 mutant reporter systems (ΔSL5, G236U, U238C, C241G and G250C) is significantly reduced, indicating that the SL5 stem loop of coronavirus 5'UTR is a key functional region for mediating viral mRNA translation. Mutations of G236, U238, C241 and G250 change the nucleotide sequence and secondary structure of SL5 stem loop, and the destruction of SL5 secondary structure leads to the loss of stem loop function. Similarly, any nucleotide mutation that maintains the stem loop structure at positions 175-299 in the 2nd stem loop of SL5 will change the sequence and secondary structure of SL5 stem loop, thereby inhibiting the 5'UTR-mediated viral translation function.

[0089] 3. Explore the function of 7 coronavirus 5'UTRΔSL5 nucleotides

[0090] The present application uses the above-mentioned 7 coronavirus 5'UTR full-length and 5'UTRΔSL5 reporter systems to conduct experiments to explore whether the viral mRNA translation level is inhibited after the deletion of SL5 in different coronavirus 5'UTR.

[0091] The present application determines the mRNA translation level of different report systems in 293T cells. First, 293T cells are plated in a 24-well plate, and when the cell density reaches 60-70%, transfection is started. 500 ng of seven coronavirus 5'UTR full-length and 5'UTRΔSL5 report system plasmids are co-transfected with 100 ng of viral translation regulatory protein expression plasmids, and the transfected cells are further cultured at 37℃ for 24 h, and the cells are lysed to detect luciferase activity. The experimental results are shown in Figure 3 Compared with the 5'UTR full-length report system, the viral mRNA translation level of the seven coronavirus 5'UTRΔSL5 report system is significantly reduced, indicating that the viral mRNA translation of the seven coronavirus 5'UTR is inhibited after the deletion of SL5. After the coronavirus infects the host cells, it hijacks the host translation system to encode viral proteins, and its 5'UTR is relatively conserved in the evolution process, so the deletion of the SL5 stem loop of the 5'UTR in different mutant strains can inhibit the translation function of the virus.

[0092] Example 2, Construction of attenuated coronavirus strain and study on replication characteristics

[0093] 1. Construction of attenuated coronavirus strain

[0094] The present application downloads the full genome sequence of HCoV-OC43 virus from GenBank (Genbank accession number: KU131570), and designs seven pairs of primers for amplifying viral genome sequence, CMV and SV40pA sequence. The specific sequence information is shown in Table 2.

[0095] Table 2-Reverse genetic primer sequences

[0096]

[0097]

[0098] The present application uses the reverse transcription product of the total RNA of the natural strain as a template, uses primer pair F1 to amplify HCoV-OC43-F1 fragment, uses primer pair F2 to amplify HCoV-OC43-F2 fragment, uses primer pair F3 to amplify HCoV-OC43-F3 fragment, uses primer pair F4 to amplify HCoV-OC43-F4 fragment, uses primer pair F5 to amplify HCoV-OC43-F5 fragment, and uses primer pair F6-HDVR to amplify HCoV-OC43-F6-HDVR; uses primer pair CMV to amplify CMV fragment using pEGFP as a template, and uses primer pair HDVR-SV40pA to amplify HDVR-SV40pA fragment.

[0099] The CMV, HCoV-OC43-F1, HCoV-OC43-F2, HCoV-OC43-F3, HCoV-OC43-F4, HCoV-OC43-F5, HCoV-OC43-F6-HDVR and HDVR-SV40pA fragments are fused into HCoV-OC43 FL-DNA by fusion PCR technology, as shown in formula (I). Figure 4 The amplified fragment is separated by agarose gel electrophoresis, and the target fragment is recovered by using a gel recovery kit, and the DNA fragment is sent to Beijing Qianke Biological Technology Co., Ltd. for sequencing. The sequencing results show that the construction of the full-length genome of the attenuated strain is successfully completed.

[0100] The HCoV-OC43 attenuated full-length DNA identified correctly in the above step is subjected to in vitro transcription to obtain HCoV-OC43 attenuated full-length RNA; the above RNA is transfected into RD cells, the culture medium is replaced after 16 hours, and then the cells are cultured and observed for cytopathic effect. After obvious cytopathic effect appears, the cell supernatant is collected, and the virus is stored after being identified by sequencing.

[0101] 2. Replication curve determination of HCoV-OC43 attenuated virus strain

[0102] The present application finds, through virus gene secondary structure comparison, that the 5'UTR region of the seven known human-infecting coronaviruses has a similar SL5 stem loop structure, which contains a UUYCGU motif, and this motif is highly conserved in the seven coronaviruses. In the present application, the coronavirus HCoV-OC43 is taken as an example, and the HCoV-OC43 ΔSL5 mutant strain is constructed by reverse genetics method, and the virulence of the two viruses is determined by the growth curve determination of the mutant strain and the natural virus strain.

[0103] The growth curves of the natural strain and the ΔSL5 mutant virus strain in RD cells are determined. First, the RD cells are inoculated in a 10 cm cell culture dish. When the cell density reaches 80%, the cells are counted, and the natural strain and the mutant virus strain are added at a multiplicity of infection (MOI) of 0.1, respectively, and adsorbed for 1.5 hours. Then the infection liquid is discarded, and fresh culture medium is replaced, and the cells are cultured in a 37℃ incubator. The supernatant is collected at 1, 2, 3, 4 and 5 days after infection for virus titer detection. The virus titer in the supernatant sample is determined by indirect immunization method, and the virus growth curve is drawn by prism7 software. The growth curve results are as shown in formula (II). Figure 4 B, compared with the natural virus, the replication of the ΔSL5 mutant virus strain in RD cells is obviously weakened, indicating that the ΔSL5 mutation leads to the decrease of the virus replication ability. Therefore, the HCoV-OC43 ΔSL5 mutant strain can be used as a candidate attenuated live vaccine strain.

[0104] Based on the successful case of HCoV-OC43 ΔSL5 mutant strain, the present application further speculates that deletion mutation of SL5 region of other 6 human infecting coronaviruses can also produce mutant strains with similar attenuation effect. The attenuation strategy of deleting SL5 provides important experimental basis for the development of live attenuated vaccine of coronavirus.

[0105] Finally, it should be noted that the terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but can also include other elements not expressly listed or inherent to such process, method, article, or apparatus.

[0106] While the preferred embodiments of the application have been described, additional alternatives, modifications, and variations can become apparent to those skilled in the art once given the benefit of the foregoing description. Accordingly, it is intended that the appended claims shall embrace any such alternatives, modifications, and variations as falling within the scope of the application. Accordingly, the appended claims as typically interpreted in accordance with the proper statutory interpretation that the courts of law place on them should be construed in a manner consistent with this limitation.

[0107] Obviously, numerous modifications and variations of the present application are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described.

Claims

1. A nucleotide sequence of a coronavirus 5' non-coding region with attenuated 5' UTR function, characterized in that, The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5.

2. The coronavirus 5' UTR functionally attenuated nucleotide sequence of claim 1, wherein, The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. The coronavirus 5' UTR comprises at least the following mutations compared to the 5' UTR of the native strain: deletion of the 5th stem loop SL5 from position 131 to 350 of the 5' UTR, or any one nucleotide mutation in the 2nd stem loop that maintains the stem loop structure from position 175 to 299 of SL5. A human coronavirus 229E HCoV-229E 5'UTR functionally attenuated nucleotide sequence is a SL5 deletion from position 208 to position 290 of the 5'UTR of the natural strain (Genbank accession number: AF304460), as shown in SEQ ID NO: 7, or any one nucleotide mutation in the 2nd stem loop of SL5 from position 254 to position 271 that maintains the stem loop structure.

3. A recombinant attenuated strain of coronavirus, characterized in that, The recombinant coronavirus attenuated strain containing the coronavirus 5'UTR functionally attenuated nucleotide sequence according to claim 1 or 2 comprises at least the following mutations compared to the natural strain: a SL5 deletion from position 131 to position 350 of the 5'UTR, or any one nucleotide mutation in the 2nd stem loop of SL5 from position 175 to position 299 that maintains the stem loop structure.

4. The recombinant coronavirus attenuated strain of claim 3, wherein, The cDNA nucleotide sequence corresponding to the genomic RNA of the recombinant coronavirus attenuated strain comprises at least one of the following nucleotide sequences: The cDNA nucleotide sequence corresponding to the genomic RNA of the SARS-CoV-2 attenuated strain is a SL5 deletion from position 150 to position 294 of the 5'UTR of the natural strain (Genbank accession number: MN908947), or any one nucleotide mutation in the 2nd stem loop of SL5 from position 228 to position 252 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the genomic RNA of the SARS-CoV attenuated strain is a SL5 deletion from position 149 to position 293 of the 5'UTR of the natural strain (Genbank accession number: AY274119), or any one nucleotide mutation in the 2nd stem loop of SL5 from position 227 to position 251 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the genomic RNA of the MERS-CoV attenuated strain is a SL5 deletion from position 195 to position 350 of the 5'UTR of the natural strain (Genbank accession number: JX869059), or any one nucleotide mutation in the 2nd stem loop of SL5 from position 273 to position 299 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the genomic RNA of the HCoV-OC43 attenuated strain is a SL5 deletion from position 131 to position 299 of the 5'UTR of the natural strain (Genbank accession number: KU131570), or any one nucleotide mutation in the 2nd stem loop of SL5 from position 175 to position 227 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the genomic RNA of the HCoV-HKU1 attenuated strain is a SL5 deletion from position 243 to position 297 of the 5'UTR of the natural strain (Genbank accession number: AY597011), or any one nucleotide mutation in the 2nd stem loop of SL5 from position 254 to position 283 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the genome RNA of the attenuated strain of HCoV-NL63 is the deletion of SL5 from position 144 to position 287 of the 5' UTR of the natural strain (Genbank accession number: AY567487), or any one nucleotide mutation in the second stem loop of SL5 from position 208 to position 247 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the genome RNA of the attenuated strain of HCoV-229E is the deletion of SL5 from position 208 to position 290 of the 5' UTR of the natural strain (Genbank accession number: AF304460), or any one nucleotide mutation in the second stem loop of SL5 from position 254 to position 271 that maintains the stem loop structure.

5. A recombinant coronavirus mRNA or cDNA, characterized in that, The recombinant coronavirus mRNA or cDNA containing the attenuated coronavirus 5' UTR functional nucleotide sequence according to claim 1 or 2 comprises at least the following mutations: deletion of SL5 from position 131 to position 350 of the 5' UTR, or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 299 that maintains the stem loop structure, compared to the natural strain.

6. The recombinant coronavirus mRNA or cDNA of claim 5, wherein, The recombinant coronavirus mRNA or cDNA comprises at least one of the following nucleotide sequences: The recombinant SARS-CoV-2 mRNA or cDNA nucleotide sequence is the deletion of SL5 from position 150 to position 294 of the 5' UTR of the natural strain (Genbank accession number: MN908947), or any one nucleotide mutation in the second stem loop of SL5 from position 228 to position 252 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the recombinant SARS-CoV mRNA is the deletion of SL5 from position 149 to position 293 of the 5' UTR of the natural strain (Genbank accession number: AY274119), or any one nucleotide mutation in the second stem loop of SL5 from position 227 to position 251 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the recombinant MERS-CoV mRNA is the deletion of SL5 from position 195 to position 350 of the 5' UTR of the natural strain (Genbank accession number: JX869059), or any one nucleotide mutation in the second stem loop of SL5 from position 273 to position 299 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the recombinant HCoV-OC43 mRNA is the deletion of SL5 from position 131 to position 299 of the 5' UTR of the natural strain (Genbank accession number: KU131570), or any one nucleotide mutation in the second stem loop of SL5 from position 175 to position 227 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the recombinant HCoV-HKU1 mRNA is the deletion of SL5 from position 243 to position 297 of the 5' UTR of the natural strain (Genbank accession number: AY597011), or any one nucleotide mutation in the second stem loop of SL5 from position 254 to position 283 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the recombinant HCoV-NL63 mRNA is the deletion of SL5 from position 144 to position 287 of the 5' UTR of the natural strain (Genbank accession number: AY567487), or any one nucleotide mutation in the second stem loop of SL5 from position 208 to position 247 that maintains the stem loop structure; The cDNA nucleotide sequence corresponding to the recombinant HCoV-229E mRNA is the deletion of SL5 from position 208 to position 290 of the 5' UTR of the natural strain (Genbank accession number: AF304460), or any one nucleotide mutation in the second stem loop of SL5 from position 254 to position 271 that maintains the stem loop structure.

7. A recombinant coronavirus attenuated vaccine, characterized in that, The active ingredient of the vaccine comprises: the coronavirus 5' UTR functionally attenuated nucleotide sequence according to claim 1 or 2, or the recombinant coronavirus attenuated strain according to claim 3 or 4, or the recombinant coronavirus mRNA or cDNA according to claim 5 or 6.

8. A pharmaceutical / pharmaceutical composition, characterized by, The pharmaceutical / drug composition comprises: an effective amount of the coronavirus 5' UTR functionally attenuated nucleotide sequence according to claim 1 or 2, or the recombinant coronavirus attenuated strain according to claim 3 or 4, or the recombinant coronavirus mRNA or cDNA according to claim 5 or 6, or the recombinant coronavirus attenuated vaccine according to claim 7; and a pharmaceutically acceptable carrier. The reagent / kit comprises: the coronavirus 5' UTR functionally attenuated nucleotide sequence according to claim 1 or 2, or the recombinant coronavirus attenuated strain according to claim 3 or 4, or the recombinant coronavirus mRNA or cDNA according to claim 5 or 6, or the recombinant coronavirus attenuated vaccine according to claim 7, or the pharmaceutical / drug composition according to claim 8.

9. A coronavirus detection reagent / kit, characterized by, 10. Use of the coronavirus 5' UTR functionally attenuated nucleotide sequence according to claim 1 or 2, or the recombinant coronavirus attenuated strain according to claim 3 or 4, or the recombinant coronavirus mRNA or cDNA according to claim 5 or 6, or the recombinant coronavirus attenuated vaccine according to claim 7, or the pharmaceutical / drug composition according to claim 8, or the reagent / kit according to claim 9 in the preparation of a medicament for the prevention or treatment of coronavirus infection; preferably, the medicament is a vaccine; further preferably, the vaccine is a live attenuated vaccine. ​