N-acetylneuraminic acid synthase mutant and application thereof in production of N-acetylneuraminic acid

Abstract

The invention belongs to the field of gene engineering and enzyme engineering, and discloses an N-acetylneuraminic acid synthase mutant and an application thereof in production of N-acetylneuraminic acid, the mutant NeuBC86T is obtained by performing site-specific mutation on wild type N-acetylneuraminic acid synthase from Neisseria meningitidis, and the mutant NeuBC86T is obtained by performing site-specific mutation on the wild type N-acetylneuraminic acid synthase from Neisseria meningitidis. The amino acid at the 86th position is obtained by replacing cysteine (C) with threonine (T). The yield of N-acetylneuraminic acid is analyzed through high performance liquid chromatography (HPLC), and the result shows that compared with a wild type enzyme, the mutant NeuBC86T has the advantage that the synthesis efficiency of the N-acetylneuraminic acid is remarkably improved by 57%, so that the mutant NeuBC86T has potential superiority in the aspect of producing the N-acetylneuraminic acid.

Description

Technical Field

[0001] The invention belongs to the field of gene engineering and enzyme engineering, and specifically relates to an N-acetylneuraminic acid synthase mutant and application thereof in the production of N-acetylneuraminic acid. Background Art

[0002] N-acetylneuraminic acid (NeuAc), also known as sialic acid, is a nine-carbon monosaccharide derivative containing an amino group. More than 50 types of sialic acid have been discovered so far, of which N-acetylneuraminic acid accounts for 99% of the entire sialic acid family, so sialic acid usually refers to NeuAc. As the terminal sugar of a variety of glycoproteins, glycopeptides and glycolipids, NeuAc has diverse physiological functions. It can regulate the half-life of blood proteins, neutralize toxins, participate in cell adhesion, etc., and has antibacterial, detoxifying, anti-adhesion and anti-cancer functions. NeuAc is often used in the study of antiviral drugs such as zanamivir and targeted cancer therapy. In addition, exogenous dietary supplementation of NeuAc is beneficial to promote the growth and development of the brain of infants and young children and enhance memory.

[0003] Due to the broad application prospects of NeuAc, its production strategy has become a research hotspot. At present, the main production methods of NeuAc are natural product extraction, chemical synthesis, enzyme catalysis and whole cell catalysis. Natural product extraction and chemical synthesis are prone to environmental pollution. Enzyme catalysis and whole cell catalysis have problems such as low product yield and high production cost, which limit large-scale industrial production. In comparison, green, economical, efficient and sustainable microbial fermentation methods are more popular.

[0004] At present, the microbial fermentation method for synthesizing NeuAc mainly involves the N-acetylneuraminic acid synthase NeuB catalyzing the synthesis of NeuAc from N-acetylmannosamine ManNAc and phosphoenolpyruvate PEP. Studies have been conducted to improve the expression of N-acetylneuraminic acid synthase by screening and optimizing its expression. Liu et al. verified and optimized the neuB gene encoding N-acetylneuraminic acid synthase from three different microorganisms, Neisseria meningitides, Moritell a viscosa, and Escherichia coli, and found that the NeuB enzyme from Neisseria meningitides was identified as the best source. However, the enzymatic activity of N-acetylneuraminic acid synthase NeuB limits the production of NeuAc, so we intend to improve the enzymatic activity of NeuB and thus increase the production of NeuAc by modifying the protein structure. Summary of the invention

[0005] The present invention aims to provide a N-acetylneuraminic acid synthase mutant NeuB C86T , the mutant is shown in sequence 2.

[0006] Another object of the present invention is to provide an N-acetylneuraminic acid synthase mutant NeuB C86T Application in the catalytic production of N-acetylneuraminic acid.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The applicant mutated the 86th amino acid of the wild-type N-acetylneuraminic acid synthase from Neisseria meningitidis from cysteine ​​C to threonine T to obtain the N-acetylneuraminic acid synthase mutant NeuB of the present invention. C86T , as shown in SEQ ID NO.4.

[0009] The protection scope of the present invention also includes:

[0010] A fusion protein obtained by fusing the mutant protein described in SEQ ID NO.4 with a protein tag.

[0011] The gene encoding the mutant protein or fusion protein described in SEQ ID NO.4.

[0012] An expression cassette, a recombinant vector, a recombinant microorganism or an in vitro recombinant cell having the above coding gene.

[0013] The mutant, fusion protein, mutant or fusion protein encoding gene of SEQ ID NO.4, expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the encoding gene are used in preparing N-acetylneuraminic acid synthase.

[0014] A method for improving the activity of N-acetylneuraminic acid synthase comprises the following steps: performing the following mutation on the N-acetylneuraminic acid synthase: mutating the 86th cysteine ​​C of SEQ ID NO.2 to threonine T.

[0015] The encoding gene of the mutant described in SEQ ID NO.4 is preferably shown in SEQ ID NO.3.

[0016] The mutant, fusion protein, mutant or fusion protein encoding gene of SEQ ID NO.4, expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the encoding gene are used in the preparation of N-acetylneuraminic acid.

[0017] The above application preferably comprises the following steps: preparing N-acetylneuraminic acid by culturing a recombinant microorganism, wherein the recombinant microorganism is obtained by transferring a recombinant vector having the above encoding gene into an engineering bacterium DW2△nagB1::gna1△yvm C::age;

[0018] The engineered bacteria DW2△nagB1::gna1△yvmC::age is a strain of Bacillus licheniformis DW2 (CN118995551A) that integrates the key genes for sialic acid synthesis, namely, glucose-6-phosphate acetyltransferase Gna1 with a gene sequence number of 850529 and N-acylglucosamine 2-epimerase Age with a gene sequence number of WP_011320279.1, and simultaneously knocks out the glucosamine-6-phosphate deaminase NagB1 with a gene sequence number of WP_020450463.1 and the cyclodipeptide synthase YvmC with a gene sequence number of WP_020452964.1.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] The present invention uses site-directed mutagenesis to mutate the threonine at position 86 of the C-terminal domain of the N-acetylneuraminic acid synthase molecule to cysteine ​​(named as mutant NeuB in the present invention). C86T ), compared with the control strain expressing wild-type NeuB, the strain expressing mutant NeuB C86T The NeuAc production of the recombinant strain reached 3.68g / L, a significant increase of 57%, suggesting that it is more suitable for industrial production. Experiments have shown that the recombinant strain of Bacillus licheniformis expressing the N-acetylneuraminic acid synthase mutant has excellent NeuAc production capacity and has better industrial application prospects than the recombinant strain containing the unmutated N-acetylneuraminic acid synthase gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Comparison of NeuAc production between N-acetylneuraminic acid synthase mutant and wild-type strain. DETAILED DESCRIPTION

[0022] The technical solutions of the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. In order to make the technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific examples, but it does not constitute a limitation of the present invention.

[0023] The culture medium involved in the following examples is as follows:

[0024] LB liquid medium: yeast powder 5g·L -1 , Peptone 10 g·L -1 、NaCl 10g·L -1 , pH 7.0.

[0025] LB solid medium: yeast powder 5g L -1, Peptone 10 g·L -1 、NaCl 10g·L -1 , agar powder 15g·L -1 .

[0026] Fermentation medium: yeast powder 12g·L -1 , peptone 6g·L -1 、(NH4)2SO4 6g·L -1 、K2HPO4·3H2O11g·L -1 、KH2PO4 3g·L -1 、MgSO4·7H2O 3g·L -1 、Urea 6g·L -1 , glucose 60g·L -1 , pH 7.0, sterilize at 115℃ for 20min.

[0027] Embodiment 1:

[0028] Construction of wild strain of N-acetylneuraminic acid synthase NeuB:

[0029] Primer pair neuB-F / neuB-R was designed to clone an N-acetylneuraminic acid synthase neuB gene (GenBank: WP_002215299.1, gene sequence as shown in SEQ ID NO.1, encoded protein as shown in SEQ ID NO.2) from Neisseria meningitides (GenBank: NZ_LLXR00000000.1). Using the genome of Bacillus subtilis 168 as a template, P43-F and P43-R were used as primers to amplify the P43 promoter; TamyL-F and TamyL-R were used as primers to amplify the amylase terminator TamyL. P43-F and TamyL-R were used as primers to perform SOE-PCR on the three fragments of P43, neuB and TamyL to obtain the fusion fragment P43-neuB-TamyL. Plasmid pHY300PLK was used as a template, and pHY-T5-F and pHY-T5-R were used as primers to perform full plasmid PCR amplification to obtain the linearized pHY300PLK vector. After the above amplified products were tested by electrophoresis, the PCR products were purified and recovered using the DNA agarose gel recovery kit produced by Omega. The fusion fragment was fused with the linearized vector pHY300PL K using the ClonExpress II one-step cloning kit to obtain a recombinant plasmid.

[0030] P43-F: TTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG

[0031] P43-R: TAATCTCCTACTGTATACATTGATCCTTCCTCCTTTAGA

[0032] neuB-F:AGAAAGGAGGAATATATAATGAGTAATATATATATCGTTGCTG

[0033] neuB-R: GTAAACTTGGTCTGACAGTTATTCCCCCTGATTTTTGA

[0034] TamyL-F: CTGAACAAAATAAATCATAAAAGAGCAGAGAGGACGGATT

[0035] TamyL-R:TTTGCCCCAAGCTTCTAGAAGCGCAATAATGCCGTCGCACT

[0036] pHY-T5-F:GAATTCCTGTTATAAAAAAAGGATC

[0037] pHY-T5-R:TCTAGAAGCTTGGGCAAAGCGTTTT.

[0038] The fused recombinant plasmid was transformed into E.coli DH5α competent cells, and positive colonies were screened using LB plates containing tetracycline. After overnight culture at 37°C in a shaking incubator, the plasmid was extracted and sequenced for verification. The recombinant plasmid with correct sequencing was named pHY-P43-neuB.

[0039] The correctly sequenced plasmid pHY-P43-neuB was electroporated by BIO-RAD Pulse controller (GenePulserTM) at 2.4 kV and an electric shock time of 4.8 to 5.2 ms to transform the plasmid into the sialic acid biosynthesis key genes glucose-6-phosphate acetyltransferase Gna1 (genomic sequence number NC_001138.5; gene sequence number 850529) and N-acylglucosamine 2-epimerase Age (genomic sequence number NC_007413.1; gene sequence number WP_01132). 0279.1), and the glucosamine-6-phosphate deaminase NagB1 (genomic sequence number NC_021362.1; gene sequence number WP_020450463.1) and cyclodipeptide synthase YvmC (genomic sequence number NC_021362.1; gene sequence number WP_020452964.1) were knocked out at the same time: DW2△nagB1::gna1△yvmC::age competent cells were quickly added with 800μLLB recovery solution, and after recovery at 37℃ 110rpm for 3h, they were spread on the screening medium with tetracycline resistance and cultured at 37℃ overnight. Transformants were selected, and after colony PCR verification, they were inoculated into LB medium with 20μg / mL tetracycline resistance and cultured at 37℃ for 14h to obtain N-acetylneuraminic acid synthase NeuB wild-type bacteria.

[0040] The preparation method of the engineered bacteria: DW2△nagB1::gna1△yvmC::age is as follows:

[0041] Firstly, taking the integration gene gna1 as an example, the integration expression method is described, the integration site is selected as the site of the gene nagB1 encoding glucosamine-6-phosphate deaminase, and the integration expression vector T2-△nagB1::gna1 is constructed.

[0042] According to the complete genome information of B. licheniformis DW2 (NC_021362.1), the complete sequences of genes gna1 and nagB1 were found on the NCBI website. Primers T2-△nagB1::gna1-F1 and T2-△nagB1::gna1-R1 were designed for the 572 bp upstream of gene nagB1, and primers T2-△nagB1::gna1-F5 and T2-△nagB1::gna1-R5 were designed for the 531 bp downstream of gene nagB1. The DNA of DW2 was used as a template to amplify the upstream and downstream homologous arm fragments of gene nagB1 by PCR. The promoter P43UTR12 (Xiao et al., ACS Synth Biol. 2020May) was used to amplify the upstream and downstream homologous arm fragments of gene nagB1. 15; 9(5):1051-1058.) was used as a template and the promoter P43UTR was amplified using primers T2-△nagB1::gna1-F2 and T2-△nagB1::gna1-R2. 12; Using the Saccharomyces cerevisiae genome (genome sequence number NC_001138.5) as a template, the gna1 gene fragment was amplified using primers T2-△nagB1::gna1-F3 and T2-△nagB1::gna1-R3; using the plasmid PHY300PLK as a template, the terminator fragment Tamp was amplified using primers T2-△nagB1::gna1-F4 and T2-△nagB1::gna1-R4; according to overlap extension PCR (SOE-PCR), the upstream homologous arm of the gene nagB1, the promoter P43UTR12, the gene nagB1, the terminator Tamp and the downstream homologous arm of nagB1 were partially connected using primers T2-△nagB1::gna1-F1 and T2-△nagB1::gna1-R5. After the SO E-PCR product was recovered and purified, the recovered product was digested with restriction endonucleases Sac I and BamH I, and the digested fragment was connected with the T2 plasmid digested with Sac I and BamH I using T4 ligase, and the ligated product was transformed into E. col i DH5α. After colony PCR verification and sequencing, the integrated expression plasmid T2-ΔnagB1::gna1 was obtained.T2-△nagB1::gna1-F1:CTGCAGCCCGGGGGATCCAATGGTGCAACTCAAGGCG T2-△nagB1::gna1-R1:GCATGAAATTGGAAATTCCGCGAATAATTTTCACGTCGTTCTCC T2-△nagB1::gna1-F2:GGAGAACGACGTGAAAATTATTCGCGGAATTTCCAATTTCATGC A A T2-△nagB1::gna1-R5:GATCTTTTCTACGAGCTCATGTCTCTGAATGACAAGGATAAAC T2-△nagB1::gna1-YF:TAAAGGTCAAGAGGGAGGGTTC.

[0043] T2-△nagB1::gna1-YR:TTATGATGGACCCTTTGCGG

[0044] T2-F:ATGTGATAACTCGGCGTAT2-R:TCTGCTGAAGCCAGTTAC.

[0045] The correctly sequenced plasmid T2-ΔnagB1::gna1 was electrotransformed into B.licheniformis DW2 using an electroporation instrument (BIO-RAD) at 2.4 kV and an electric shock time of 4.8-5.2 ms, cultured overnight at 37°C, and transformants were selected and verified by colony PCR. Positive clones were selected for single-double exchange passage.

[0046] Single exchange: Pick the transformants that were successfully electroporated in the previous step, inoculate them into 5 mL of liquid LB medium (containing 20 μg / mL of Kan antibiotics), and culture them at 45°C and 180 rpm for 10 to 12 h to pass the first generation. Dilute the bacterial solution after the third passage by 10 -6 times, take 100 μL of the diluted bacterial solution and evenly spread it on a plate culture medium containing 20 μg / mL Kan antibiotic, and culture it at 45°C; after a single colony grows on the plate, pick a small number of single colonies and streak culture on the corresponding antibiotic plate. After 5 to 6 hours, pick an appropriate amount of bacteria for single exchange verification; after the verification is correct, double exchange subculture is carried out.

[0047] Double exchange: Take an appropriate amount of single colonies verified by single exchange and place them in 5 mL of liquid LB medium, subculture at 37°C and 180 rpm for a total of 3 generations; dilute the culture medium after the third subculture by 10 -6 times, take 100 μL and spread it evenly on the LB solid culture medium plate, and culture it at 37°C; after a single colony grows on the plate, pick a single colony and plant it on the LB solid culture medium plate and the LB solid culture medium plate containing 20 μg / mL Kan antibiotic, and culture it at 37°C for 12 h; select the single colony that does not grow on the LB culture medium plate containing 20 μg / mL Kan antibiotic for double exchange colony PCR identification, and the strain with correct double exchange verification is named DW2△nagB1::gna1.

[0048] Secondly, the integration expression vector T2-△yvmC::age was constructed using the same method as T2-△nagB1::gna1. The template of the age gene was Mucor variabilis (genome sequence number NC_007413.1). The constructed integration expression vector T2-△yvm C::age was electroporated into the DW2△nagB1::gna1 strain, and the engineered strain DW2△nagB1::gna1△yvmC::age was constructed through single and double exchange subculture.

[0049] T2-△yvmC::age-F1:CTGCAGCCCGGGGGATCCCTCCTTTATCAATGTCAACGAAC

[0050] T2-△yvmC::age-R1:GCATGAAATTGGAAATTCCGCGGCGTCTGGCGTTTTAGTATTTC T2-△yvmC::age-F2:GAAATACTAAAACGCAGACGCCGCGGAATTTCCAATTTCATGC T2-△yvmC::age-R2:CCAACGCTTGCAGGTTTTTGCCCATTATATATTCCTCCTTTCT T2-△yvmC::age-F3:AGAAAGGAGGAATATATAATGGGCAAAAACCTGCAAGCGTTGG T2-△yvmC::age-R3:TATGAGTAAACTTGGTCTGACAGTTAGCTCAGGCTTCAAATTGTT GC T2-△yvmC::age-F4:GCAACAATTTGAAGCGCTGAGCTAACTGTCAGACCAAGTTTACTC ATA

[0051] T2-△yvmC::age-R4:TTAGATTCCACACTTTCGTCCGGTCTGACGCTCAGTGGAAC

[0052] T2-△yvmC::age-F5:GTTCCACTGAGCGTCAGACCGGACGAAAGTGTGGAATCTAA T2-△yvmC::age-R5:GATCTTTTCTACGAGCTCAGCGAGCTGTTCACTGCATTTA

[0053] T2-ΔyvmC::age-YF: GATGAACAGCGAGACGGACAGT2-ΔyvmC::age-YR: CATCGCTACTCCCTCGTATTCG.

[0054] Embodiment 2:

[0055] Construction of N-acetylneuraminic acid synthase NeuB mutant strain:

[0056] The neuB catalytic active site was subjected to site-directed mutagenesis and reverse PCR amplification to replace the mutation on the gene sequence, specifically: the 86th position of the catalytic domain of the N-acetylneuraminic acid synthase molecule was mutated from cysteine ​​to threonine, and the linear plasmid of the entire neuB mutant sequence C86T was amplified using primers C86T-F and C86T-R and the plasmid of Example 1 as a template (the N-acetylneuraminic acid synthase neuB gene after point mutation is shown in SEQ ID NO.3, and the encoded protein is shown in SEQ ID NO.4).

[0057] C86T-F:GAAAGAACCGCGCTGAACGAA

[0058] C86T-R:GCGCGGTTTCTTTCCATGATT.

[0059] The plasmid was recovered and purified according to the method in Example 1, and the linear plasmid was treated with the ClonExpress II one-step cloning kit and transformed into E. coli DH5α competent cells. The positive colonies were screened using LB plates containing tetracycline. After verification by specific primers, it was inoculated into LB medium with Tet resistance and cultured overnight at 37°C in a shaking incubator to extract the plasmid pHY-P43-neuB. C86T , and the recombinant plasmid with the correct sequencing was named pHY-P43-neuB C86T .

[0060] The above plasmid was electroporated into Bacillus licheniformis DW2△nagB1::gna1△yvmC::age, spread on a screening medium with Tet resistance, cultured overnight at 37°C, transformants were selected, and the correct transformants were inoculated into LB medium with 20 μg / mL tetracycline resistance, cultured at 37°C for 14 h, and the N-acetylneuraminic acid synthase NeuB mutant strain was obtained.

[0061] Embodiment 3:

[0062] Comparison of NeuAc production between N-acetylneuraminic acid synthase NeuB mutant strain and wild strain:

[0063] The N-acetylneuraminic acid synthase NeuB mutant strain and the N-acetylneuraminic acid synthase NeuB wild bacteria were activated from the stored glycerol tubes, inoculated into LB medium with 20 μg / mL tetracycline resistance, cultured at 37°C for 14 hours; transferred to the fermentation medium with an inoculation amount of 3%, cultured at 37°C for 48 hours, centrifuged at 12000 rpm for 10 minutes, collected the fermentation supernatant, diluted 20 times, passed through a 0.22 μm filter membrane through a 1 mL syringe, injected 500 μL into a liquid phase bottle, loaded, and analyzed by liquid chromatography HPLC.

[0064] Liquid chromatography conditions: Agilent liquid chromatograph (with UV detector), injection volume 1 μL, mobile phase: 5 mM H2SO4, chromatographic column: organic acid column, column temperature: 30°C.

[0065] The results showed that the expression of mutant NeuB C86T The NeuAc production of the recombinant strain reached 3.68 g / L, which was significantly increased by 57% compared with the control.

Claims

1. A synthetic N-acetylneuraminic acid synthase mutant NeuB C86T The amino acid sequence of the N-acetylneuraminic acid synthase mutant is shown in SEQ ID NO.

4.

2. A fusion protein obtained by fusing the mutant protein described in SEQ ID NO.4 with a protein tag.

3. The gene encoding the mutant protein or fusion protein described in SEQ ID NO.

4.

4. An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the coding gene according to claim 3.

5. Use of the mutant according to claim 1, the fusion protein according to claim 2, the coding gene according to claim 3 or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above coding gene according to claim 4 in the preparation of N-acetylneuraminic acid synthase.

6. A method for improving the activity of N-acetylneuraminic acid synthase, comprising the following steps: mutating the N-acetylneuraminic acid synthase as follows: mutating the cysteine ​​C at position 86 of SEQ ID NO.2 to threonine T.

7. The coding gene according to claim 3, wherein the polynucleotide encoding the gene is shown as SEQ ID NO.

3.

8. Use of the mutant according to claim 1, the fusion protein according to claim 2, the coding gene according to claim 3 or the expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above coding gene according to claim 4 in the preparation of N-acetylneuraminic acid.

9. The use according to claim 8, wherein the use process comprises preparing N-acetylneuraminic acid by culturing a recombinant microorganism, wherein the recombinant microorganism is a recombinant vector having the coding gene according to claim 3 transferred into the engineering bacterium DW2△ nagB1 :: gna1 △ yvC :: age Obtained in; The engineered bacteria DW2△ nagB1 :: gna1 △ yvC :: age It is a strain of Bacillus licheniformis DW2 that integrates the key genes for sialic acid synthesis, glucose-6-phosphate acetyltransferase Gna1 with gene sequence number 850529 and N-acylglucosamine 2-isomerase Age with gene sequence number WP_011320279.1, and knocks out the glucosamine-6-phosphate deaminase NagB1 with gene sequence number WP_020450463.1 and the cyclodipeptide synthase YvmC with gene sequence number WP_020452964.1.

Images