Nucleic acid aptamer combined with TIDG6 protein as well as application and screening method of nucleic acid aptamer

Abstract

The invention relates to the technical field of biology, in particular to a nucleic acid aptamer combined with TIDG6 protein, application and a screening method of the nucleic acid aptamer, and the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence which has at least 30% homology with SEQ ID NO.1 and is combined with TIDG6 protein; the nucleic acid aptamer is an RNA sequence transcribed by a nucleotide sequence as shown in SEQ ID NO.1, or an RNA sequence transcribed by a nucleotide sequence as shown in SEQ ID NO.1. The nucleic acid aptamer is small in molecular weight, stable in chemical property, easy to store and mark, capable of being combined with TIDG6 protein with high affinity, very good in specificity, capable of being used in the aspects of detection, diagnosis, imaging, treatment and the like and wide in application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer binding to a TIDG6 protein, and an application and a screening method thereof. Background Art

[0002] Tigger transposable element derived protein 6 (TIGD6) is a DNA-mediated transposon protein and an oncogene-encoded protein associated with the occurrence, invasion and metastasis of malignant tumors. It belongs to the tigger subfamily of the pogo superfamily of human DNA-mediated transposons. Abnormal expression of TIGD6 may induce genomic instability and lead to poor prognosis in patients with lung and colon adenocarcinoma. Gene ontology (GO) annotations associated with this gene include nucleic acid binding. An important paralog of this gene is TIGD4.

[0003] TIGD6 may reflect the organ specificity of transcriptomic analysis of copy number alterations in CRC (colorectal cancer). Diseases associated with TIGD6 include intellectual developmental disability and autosomal dominant inheritance 22. TIGD6 is a key gene for survival of CNA (copy number alteration) promoters. For TIDG6, lower expression is associated with improved CNA survival. Therefore, it is a potential target for the development of colorectal cancer tumor suppressors.

[0004] Aptamers are DNA or RNA molecules separated by systematic evolution of ligands by exponential enrichment (SELEX). They can bind to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells with high affinity and specificity, and therefore have broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, aptamers have small molecular weight, better stability, easy modification, no immunogenicity, short production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification. Therefore, if we can find aptamers with higher affinity and high specificity for TIDG6 protein, it will help to achieve high sensitivity and high specificity detection of TIDG6 protein, and help to develop drugs targeting TIDG6 protein.

[0005] Therefore, there is an urgent need to find a nucleic acid aptamer that has high binding affinity and good specificity for the TIDG6 protein, maintains high binding affinity after precise truncation, is easy to modify and synthesize artificially, has good stability, and is easy to use. Summary of the invention

[0006] In order to overcome at least one of the defects of the above-mentioned prior art, the present invention provides a nucleic acid aptamer binding to TIDG6 protein, application and screening method thereof. A nucleic acid aptamer that can bind to TIDG6 protein with high affinity and has a small molecular weight, stable chemical properties, easy storage and labeling can be obtained, and has very good specificity, which can be used for detection, diagnosis, imaging and treatment, and has broad application prospects.

[0007] The technical solution adopted by the present invention to solve the problem is:

[0008] A nucleic acid aptamer binding to TIDG6 protein, the nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology with SEQ ID NO.1 and binding to TIDG6 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.1.

[0009] By adopting the above scheme, the inventors designed and synthesized a random single-stranded DNA library and corresponding primers based on SELEX technology to screen for nucleic acid aptamers that have small molecular weight, stable chemical properties, easy storage and labeling and can bind to TIDG6 protein with high affinity, thereby screening out a nucleic acid aptamer that binds to TIDG6 protein with high affinity, which is TIGD6-05 (SEQ ID NO.1). The nucleic acid aptamer has high affinity with TIDG6 protein and high specificity.

[0010] It can be understood that the nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology with the nucleic acid aptamer provided by the present invention and binds to the TIDG6 protein, for example, the nucleotide sequence shown in any of the above nucleic acid aptamers can be partially deleted or partially added, and still has high affinity with the TIDG6 protein and is still within the scope of protection of the present invention.

[0011] Furthermore, the nucleic acid aptamer includes a sequence obtained by modifying a nucleotide sequence that has at least 30% homology to SEQ ID NO.1 and binds to the TIDG6 protein.

[0012] Furthermore, the modification includes at least one of the following modification methods:

[0013] (1) Phosphorylation;

[0014] (2) Methylation;

[0015] (3) Amination;

[0016] (4) thiolation;

[0017] (5) Isotopization;

[0018] (6) Substituting sulfur for oxygen;

[0019] (7) Replace oxygen with selenium.

[0020] By adopting the above scheme, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium or isotopization, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to T IDG6 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0021] Furthermore, the nucleic acid aptamer has a sequence that is at least 30% homologous to SEQ ID NO. 1 and is modified by a nucleotide sequence that binds to the T IDG6 protein.

[0022] Furthermore, the transformation includes at least one of the following transformation methods:

[0023] (1) Connecting a fluorescent marker to the aptamer;

[0024] (2) Connecting radioactive substances to the aptamer;

[0025] (3) Connecting therapeutic substances to the aptamer;

[0026] (4) connecting biotin to the aptamer;

[0027] (5) connecting digoxigenin to the aptamer;

[0028] (6) connecting a nanoluminescent material to the nucleic acid aptamer;

[0029] (7) Connecting a small peptide to the aptamer;

[0030] (8) Connecting siRNA to the nucleic acid aptamer.

[0031] By adopting the above scheme, the modified aptamer sequence has desirable properties, for example, it can have the same or higher affinity for binding to TIDG6 protein as the parent aptamer sequence before modification, or have higher stability although the affinity is not significantly improved.

[0032] In other words, the above aptamers, whether partially substituted or modified, have substantially the same or similar molecular structures, physicochemical properties and functions as the original aptamers, and can be used to bind to the TIDG6 protein.

[0033] The present invention also provides a derivative of a nucleic acid aptamer that binds to a TIDG6 protein, wherein the derivative comprises at least one of the following:

[0034] (1) a phosphorothioate backbone sequence derived from the aforementioned TIDG6 protein-binding aptamer backbone;

[0035] (2) A peptide nucleic acid sequence synthesized by designing the above-mentioned nucleic acid aptamer that binds to the TIDG6 protein.

[0036] The term "phosphorothioate backbone" as used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets, as well as enhanced resistance to nuclease degradation.

[0037] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. Oligonucleotide mimics linked by peptide bonds were synthesized using N-2-(aminoethyl)-glycine units instead of sugar-phosphate backbones as repeating structural units, and are called peptide nucleic acids. Since peptide nucleic acids (PNA) do not have phosphate groups like those on DNA or RNA, there is a lack of electrical repulsion between PNA and DNA, making the binding strength between the two greater than the binding strength between DNA.

[0038] The present invention also provides a product for detecting TIDG6 protein, comprising the above-mentioned nucleic acid aptamer binding to TIDG6 protein, or a derivative of the above-mentioned nucleic acid aptamer binding to TIDG6 protein; the product comprises any one or more of a kit, a detection chip, and a chromatography detection device.

[0039] The present invention also provides the use of the above-mentioned nucleic acid aptamer binding to T IDG6 protein and the derivative of the above-mentioned nucleic acid aptamer binding to T IDG6 protein, including at least one of the following:

[0040] (1) Quantitative or qualitative detection of TIDG6 protein;

[0041] (2) Purification of TIDG6 protein;

[0042] (3) Imaging of TIDG6 protein;

[0043] (4) preparing drugs targeting TIDG6 protein;

[0044] (5) Prepare reagents or drugs for diagnosing and treating abnormal TIDG6 expression.

[0045] The present invention also provides a method for screening a nucleic acid aptamer that binds to a T IDG6 protein, comprising the following steps:

[0046] S1, synthesize random single-stranded DNA library and primers;

[0047] S2. Magnetic bead screening: Perform at least 7 rounds of counter-screening and screening, and add serum starting from the 4th round.

[0048] Furthermore, the step S2 described in which serum is added after the 4th round includes the following specific processes: 5% serum is added in the 4th round and 20% serum is added in the 5th round; the serum is normal human serum.

[0049] The method for screening nucleic acid aptamers binding to T IDG6 protein provided by the present invention is based on the SELEX screening method. In the step of magnetic bead screening, serum is added for blocking from the fourth round and the serum concentration is increased round by round to further improve the specificity and stability of the nucleic acid aptamer.

[0050] The conventional conditions for nucleic acid aptamer screening are carried out in ionic buffer, while a certain concentration of serum is gradually added under the screening conditions. On the one hand, because the serum contains abundant proteins, it can compete with the proteins on the surface of the magnetic beads to bind to the library, thereby removing those sequences that have weak binding ability to the target T IDG6 protein or are only adsorbed. On the other hand, the aptamer binds to the target in the serum environment, which can better meet the actual detection environment of the application based on nucleic acid aptamer development in the later stage.

[0051] Studies have shown that using higher concentrations of serum in the final rounds of screening can screen for nucleic acid aptamers with higher affinity and better specificity.

[0052] In summary, the nucleic acid aptamer binding to T IDG6 protein, application and screening method provided by the present invention have the following technical effects:

[0053] 1. By improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to TIDG6 protein with high affinity and high specificity, was screened out;

[0054] 2. The structure is relatively stable, simple, easy to modify, can be synthesized artificially in a short period of time, has stable chemical properties, and is easy to store and label;

[0055] 3. It can be used for detection, diagnosis, imaging and treatment, such as purification or high-sensitivity and high-specificity detection of TIDG6 protein; preparation of drugs targeting TIDG6 protein; reagents or drugs for diagnosis and treatment of abnormal TIDG6 expression, etc., and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 This is a schematic diagram of the binding ability of several rounds of enriched libraries obtained from the 1st to 7th rounds of screening with the target protein detected by QPCR (fluorescence quantitative PCR) in Example 1;

[0057] Figure 2 This is a schematic diagram of the melting curves of the enriched libraries and target proteins obtained by QPCR (fluorescence quantitative PCR) in the first to seventh rounds of screening in Example 1;

[0058] Figure 3 This is a schematic diagram of the library positive screen retention rate obtained from the 1st to 7th rounds of screening in Example 1;

[0059] Figure 4 This is a data diagram of affinity detection between nucleic acid aptamer TIGD6-05 and TIDG6 protein in Example 2;

[0060] Figure 5 This is a schematic diagram of the affinity detection data between the nucleic acid aptamer TIGD6-05 and B-Amyloid in Example 3;

[0061] Figure 6 This is a schematic diagram of the affinity detection data between the nucleic acid aptamer TIGD6-05 and TF in Example 3;

[0062] Figure 7 This is a schematic diagram of the affinity detection data between the nucleic acid aptamer TIGD6-05 and SNCA in Example 3;

[0063] Figure 8 This is a schematic diagram of the affinity detection data of nucleic acid aptamer TIGD6-05 and ADP7 in Example 3;

[0064] Fig. 9 This is a schematic diagram of the results of the spot hybridization experiment using nucleic acid aptamers in Example 4 to detect TIGD6 protein. DETAILED DESCRIPTION

[0065] For better understanding and implementation, the technical solutions in the embodiments of the present invention will be clearly and completely described and discussed below in conjunction with the accompanying drawings of the present invention. Obviously, what is described here is only a part of the examples of the present invention, not all the examples. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0066] In order to facilitate the understanding of the embodiments of the present invention, the following will be further explained by taking specific embodiments as examples in conjunction with the drawings, and each embodiment does not constitute a limitation on the embodiments of the present invention.

[0067] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0068] Example 1: Screening of ssDNA nucleic acid aptamers binding to TIDG6 protein

[0069] The method for screening ssDNA nucleic acid aptamers binding to TIDG6 protein in this embodiment comprises the following steps:

[0070] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence:

[0071] Random single-stranded DNA library:

[0072] 5'-TTCAGCACTCCACGCATAGC(36N)CCTATGCGTGCTACCGTG AA-3'(SEQ ID NO.2);

[0073] Among them, "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases. The library was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0074] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0075] Table 1. Primers and their sequences

[0076]

[0077]

[0078] Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0079] The primers were prepared into 100 μM storage solution with DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25°C) and stored at -20°C for later use.

[0080] 2. Magnetic bead screening

[0081] The magnetic bead method was used for screening, with a total of 7 rounds of screening. The screening process of each round is shown in Table 2.

[0082] Table 2. TIDG6 protein aptamer screening process

[0083] Number of rounds Anti-screening Buffer solution First round Conjugated His magnetic beads DPBS buffer Round 2 Conjugated His magnetic beads DPBS buffer Round 3 Conjugated His magnetic beads DPBS buffer Round 4 Conjugated His magnetic beads DPBS buffer with 5% serum Fifth round Conjugated His magnetic beads DPBS buffer with 20% serum Round 6 Conjugated His magnetic beads DPBS buffer Round 7 Conjugated His magnetic beads DPBS buffer

[0084] The specific screening process is as follows:

[0085] 1) Carboxyl magnetic beads to immobilize TIDG6 protein

[0086] Take 250μl carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., item number: FM2221), wash once with 500μl NaOH (5mM), wash twice with 500μl ultrapure water, fish the magnetic beads with a magnet, and remove the supernatant. Take 250μl of the prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mix equal volumes, add to the magnetic beads, incubate at 25℃ for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads, and wash the magnetic beads twice with DPBS buffer for use.

[0087] Take 32 μl of TIDG6 protein (purchased from IBOSON (Suzhou) Science and Technology Co., Ltd., P03209PA, the concentration after dissolution is 1 mg / ml), add 468 μl of 10 mM sodium acetate at pH 3.6, mix well, and add to the above-mentioned activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes, and the TIDG6 protein is coupled to the surface of the magnetic beads through the amino groups on the protein surface.

[0088] After the coupling is completed, place the coupling tube on a magnetic stand, discard the supernatant, take 500μl BSA (0.45mg / ml) and add it to the magnetic beads, incubate on a 25℃ vertical mixer for 10 minutes to block the unreacted activation sites on the surface of the magnetic beads. Then take 500μl 1M ethanolamine pH8.5 and add it to the magnetic beads, incubate on a 25℃ vertical mixer for 10 minutes to block the unreacted activation sites on the surface of the magnetic beads. Place it on a magnetic stand and discard the blocking solution. Wash the magnetic beads 4 times with 200μl DPBS and mark them as MB-TIDG6.

[0089] 2) Counter-screening and screening

[0090] Preparation of reverse screening magnetic beads: The His peptide was coupled to the magnetic beads. The His peptide was chemically synthesized by Nanjing GenScript Biotechnology Co., Ltd. The steps of coupling the His peptide were the same as those of coupling the TIDG6 protein. The concentration of the His peptide was 10 mg / ml and it was diluted with a 10 mM NaAC solution at pH 4.5. Specifically, 10 μl of the His peptide was taken and 90 μl of a 10 mM NaAc solution at pH 4.5 was added and mixed. The rest of the steps were the same. The coupled magnetic beads were labeled MB-His.

[0091] Library dissolution and denaturation treatment: Take 1OD random single-stranded nucleotide library, centrifuge at 14000rpm for 5 minutes, centrifuge the library to the bottom of the tube, dissolve it to 10μM with DPBS buffer, mix it and dispense it into PCR tubes for denaturation treatment. The treatment process is as follows: The PCR instrument is set to 95℃ for 10 minutes. The purpose of this step is to unwind the folded chain, then keep it at 4℃ for 5 minutes, and then balance it to room temperature. Add the treated library to 50μl MB-His magnetic beads, mix it and incubate it at room temperature for a period of time on a vertical mixer. Place it on a magnetic stand, collect the supernatant, mark it as pool-, and use the supernatant as a single-stranded nucleic acid library for positive screening with MB-TIDG6 magnetic beads. In each round of magnetic bead screening, MB-his is used for counter-screening before the positive screening targeting TIDG6 protein, and the counter-screening supernatant is used as a single-stranded nucleotide library for positive screening with MB-TIDG6 magnetic beads. Specifically, add the library pool- after counter-screening to 50μl MB-TIDG6 magnetic beads and incubate at 25°C for 40 minutes on a vertical mixer. Place on a magnetic stand, discard the supernatant, retain the magnetic beads, and wash the magnetic beads 4 times with 200μl DPBS. Finally, add 200μl DPBS to the washed magnetic beads, boil in a boiling water bath for 10 minutes, collect the supernatant, and mark it as elution-TIDG6.

[0092] The nucleic acid molecules in elution-TIDG6 were used as templates and amplified by ordinary PCR. The method is as follows: add all template elution-TIDG6 to 1ml PCR mix and mix well, divide the template and PCR mix mixture into 100μl / tube and add it to the PCR tube. The amplification conditions are as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, a total of 25 cycles, and store at 4℃. PCR mix is ​​prepared with dNTPs (P031-02) purchased from Novozymes and rtaq enzyme (R500Z) purchased from Takara Biotech.

[0093] The amplified product was purified using commercially purchased Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. Add 1 / 5 volume of 4M sodium chloride to 1mL of PCR product, and then add 40uL of SA magnetic beads that have been washed with DPBS and the supernatant removed. After incubation on a shaker at room temperature for 30 minutes, remove the supernatant of the PCR product. Wash the magnetic beads three times with DPBS containing 0.02% Tween20, add 50uL of 40mM sodium hydroxide solution after removing the supernatant, and remove the magnetic beads by magnetic attraction after incubation for three minutes. Then add 2uL of 1M hydrochloric acid to the supernatant to neutralize the single chain, and then add 52uL of 2*DPBS to dilute and neutralize the salt concentration, and finally obtain 104uL of the secondary library dissolved in 1*DPBS, which can be used as the library for the next round of screening.

[0094] The magnetic bead method was repeated for 7 rounds of screening. Each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. After the library was renatured, it was incubated with MB-TIDG6 magnetic beads. During the screening process, QPCR was used to detect the changes in the recognition ability of the DNA single-stranded library for the TIDG6 protein. When the recognition ability of the DNA single-stranded library for the TIDG6 protein met the requirements, that is, the binding ability of the screened DNA single-stranded library with the target protein was higher than that of the library input at the beginning of the screening ( Figure 1 ), Figure 1 Among them, p1, p2, p3, p4, and p6 represent the initial library, the libraries obtained in the first, second, third, fourth, and sixth rounds of screening, respectively. It can be seen that the affinities of the library targets obtained in the fourth and sixth rounds are high, and p6 is much higher than p1 and p2, which meets the sequencing requirements. The obtained libraries are analyzed by high-throughput sequencing.

[0095] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewise Biotechnology (Jiangsu) Technology Co., Ltd., and the affinity was tested.

[0096] In subsequent tests, one sequence with the strongest binding ability was identified from the 100 sequences obtained from the final 7th round of sequencing. It was a nucleic acid aptamer with a nucleotide sequence as shown in SEQ ID NO: 1. It was named TIGD6-05, and its sequence was TTCAGCACTCCACGCA TAGCCCACCTGGGACAGGTCTTGTGACGCGGTTGTTCAGTCCTATGC GTGCTACCGTGAA.

[0097] Example 2: Surface Plasmon Resonance (SPR) Detection of Affinity between TIDG6 Protein Aptamer and TIDG6 Protein

[0098] Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid aptamer TIGD6-05 (SEQ ID NO. 1), which was diluted to 500 nM with DPBS buffer.

[0099] 1. The TIDG6 protein was coupled to the second channel on the surface of the CM5 chip. The specific method was as follows: first, the chip was cleaned with 50mM NaOH, 20μl was injected, and the flow rate was 10μl / min. Then, equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) were mixed and 50μl was injected to activate the chip at a flow rate of 5μl / min. The TIDG6 protein was diluted with 10mM sodium acetate at pH 3.6 to a final concentration of 20μg / mL and then injected. The injection volume was 50μL, the flow rate was 5μL / min, and the TIDG6 protein coupling amount was 2342Ru. After the injection was completed, ethanolamine was injected to block the chip at a flow rate of 10μL / min and 100μL was injected. The first channel was treated as above, and the steps of coupling His protein, activation and blocking were exactly the same, as the control channel.

[0100] 2. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) to set the detection parameters. The diluted 6 aptamer samples flow through channels 1 and 2 in turn. The program for each aptamer is as follows: injection 30 μL / min, time 2 minutes, dissociation 30 μL / min, time 2 minutes, regeneration 1 M NaCl 30 μL / min, time 30 seconds, and the diluted 1 nucleic acid aptamer is injected in turn.

[0101] The affinity test data of nucleic acid aptamer TIGD6-05 and TIDG6 protein are shown in Figure 4 , where the initial concentration of the aptamer is 500 nM, Figure 4 The affinity test diagram of TIGD6-01 and TIDG6 protein is shown in Table 3 below, and the KD value shows the binding ability of the corresponding nucleic acid aptamer with the target protein TIDG6 protein. These data show that these nucleic acid aptamers are detected to have strong binding with TIDG 6 protein by SPR instrument.

[0102] Table 3. Affinity of nucleic acid aptamers to TIDG6 protein (the smaller the KD value, the greater the affinity)

[0103] Aptamers Affinity KD for TIDG6 protein (nM) TIGD6-05 (SEQ ID NO: 1) 3.75

[0104] As can be seen from Table 3, one nucleic acid aptamer (SEQ ID NO. 1) screened from 100 sequences has a particularly high affinity for the TIDG6 protein.

[0105] Example 3: Study on the specificity of nucleic acid aptamers

[0106] In this example, B-Amyloid, TF, SNCA, and ADP7 were used to replace TIDG6 protein, respectively. The method of fixing TIDG6 protein to the SPR chip for testing was the same as in Example 4. B-Amyloid, TF, SNCA, and ADP7 proteins were coupled to the second channel of four Channals on the surface of the CM5 chip, and the coupling amounts were 322RU, 2268RU, 1413RU, and 3824RU, respectively. The diluted TIGD6-05 nucleic acid aptamer was injected in sequence.

[0107] The affinity test data of nucleic acid aptamer TIGD6-05 and B-Amyloid can be found in Figure 5 , the affinity test data with TF can be found in Figure 6 , the affinity test data with SNCA can be found in Figure 7 , the affinity test data with ADP7 can be found in Figure 8 ;

[0108] It can be seen that the nucleic acid aptamer TIGD6-05 has very good specificity.

[0109] Example 4: Detection of TIDG6 protein by dot blot hybridization assay based on nucleic acid aptamers

[0110] The steps of the dot hybridization experiment performed on a nucleic acid aptamer TIGD6-05 with high affinity and high specificity in this example are as follows:

[0111] 1. Take two 8cm×2cm nitrocellulose membranes (purchased from Millipore), dilute TIDG6 protein to 1mg / ml with DP BS, and dilute control proteins B-Amyloid, TF, SNCA, and ADP7 to 1mg / ml respectively. Spot 2ul onto the nitrocellulose membrane and air dry for 40 minutes.

[0112] 2. After drying, block with 10% BSA at room temperature for 1 hour. After blocking, wash with DPBS-T (DPBS containing 2 / 10,000 tween20) for 3 times and aspirate clean.

[0113] 3. After the cellulose membrane is washed, the nucleic acid aptamer synthesized by Jinweizhi in Example 3 is modified with biotin and diluted to 0.5uM, and then the diluted nucleic acid aptamer is incubated with the protein on the nitrocellulose membrane on a shaker at room temperature for 30min. After the incubation, it is washed three times with DPBST, and placed on a shaker for 5 minutes each time.

[0114] 4. Transfer the test strip to a new centrifuge tube, dilute HRP-Streptavidin (purchased from Beyotime Biotech 1 mg / ml): DPBS buffer at a ratio of 1:2000, take 3 mL and add it to soak it, incubate it at room temperature in the dark for 30 minutes. After the incubation, wash it with DPBS-T for 2 minutes, repeat the washing 3 times, and aspirate it clean.

[0115] 5. Transfer the test strip to a clean PE glove, take the ECL color development kit (purchased from Beyotime Biotech), mix 100uL of solution A and 100uL of solution B, soak the surface of the test strip, and incubate in the dark for 5 minutes.

[0116] 6. Observation and photography using the imaging system: The instrument used was the ImageQuantT MLAS 4000 digital imaging system from GE Healthcare Life Sciences.

[0117] The results are as follows Fig. 9 As shown, from top to bottom are the control protein result graph for detecting TIGD6-05 and the concentration gradient result graph of TIGD6 protein.

[0118] Depend on Fig. 9 It can be seen that the biotin-modified aptamer TIGD6-05 can be used for the detection of membrane hybridization TIDG6 protein. Compared with the spots of control proteins B-Amyloid, TF, SNCA, and ADP7, the TIDG6 protein is obvious, indicating that this aptamer can be used to accurately detect the TIDG6 protein.

[0119] This example also uses TIGD6-05 for the detection of TIDG6 protein. The TIDG6 protein is diluted with DPBS to 1 mg / mL, 0.50 mg / mL, 0.250 mg / mL, 0.125 mg / mL, 0.063 mg / mL, and 0.032 mg / mL. Dot hybridization experiments are performed according to the above method. The results show that the nucleic acid aptamer TIGD6-05 can be used to accurately detect 0.032 mg / mL of TIDG6 protein, and the detection results have the highest sensitivity and accuracy.

[0120] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0121] The technical means disclosed in the scheme of the present invention are not limited to the technical means disclosed in the above-mentioned implementation mode, but also include technical schemes composed of any combination of the above-mentioned technical features. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications are also regarded as the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that binds to TIDG6 protein, characterized in that: The nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology with SEQ ID NO.1 and binding to TIDG6 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.

1.

2. The nucleic acid aptamer binding to TIDG6 protein according to claim 1, characterized in that: The nucleic acid aptamer includes a sequence obtained by modifying a nucleotide sequence that has at least 30% homology to SEQ ID NO. 1 and binds to the TIDG6 protein.

3. The nucleic acid aptamer binding to TIDG6 protein according to claim 2, characterized in that: The modification includes at least one of the following modification methods: (1) Phosphorylation; (2) Methylation; (3) Amination; (4) thiolation; (5) Isotopization; (6) Substituting sulfur for oxygen; (7) Replace oxygen with selenium.

4. The nucleic acid aptamer binding to TIDG6 protein according to claim 1, characterized in that: The nucleic acid aptamer has a sequence that is at least 30% homologous to SEQ ID NO.1 and is obtained by modifying the nucleotide sequence that binds to the TIDG6 protein.

5. The nucleic acid aptamer binding to TIDG6 protein according to claim 4, characterized in that: The transformation includes at least one of the following transformation methods: (1) Connecting a fluorescent marker to the aptamer; (2) Connecting radioactive substances to the aptamer; (3) Connecting therapeutic substances to the aptamer; (4) connecting biotin to the aptamer; (5) connecting digoxigenin to the aptamer; (6) connecting a nanoluminescent material to the nucleic acid aptamer; (7) Connecting a small peptide to the aptamer; (8) Connecting siRNA to the nucleic acid aptamer.

6. A derivative of a nucleic acid aptamer that binds to a TIDG6 protein, characterized in that: The derivatives include at least one of the following: (1) a phosphorothioate backbone sequence derived from the backbone of the nucleic acid aptamer binding to TIDG6 protein according to any one of claims 1 to 5; (2) A peptide nucleic acid sequence designed and synthesized by the nucleic acid aptamer binding to TIDG6 protein according to any one of claims 1 to 5.

7. A product for detecting TIDG6 protein, characterized in that: The invention comprises the nucleic acid aptamer binding to TIDG6 protein as claimed in any one of claims 1 to 5, or the derivative of the nucleic acid aptamer binding to TIDG6 protein as claimed in claim 6; the product comprises any one or more of a kit, a detection chip, and a chromatography detection device.

8. Use of the nucleic acid aptamer binding to TIDG6 protein according to any one of claims 1 to 5 and the derivative of the nucleic acid aptamer binding to TIDG6 protein according to claim 6, characterized in that: Include at least one of the following: (1) Quantitative or qualitative detection of TIDG6 protein; (2) Purification of TIDG6 protein; (3) Imaging of TIDG6 protein; (4) preparing drugs targeting TIDG6 protein; (5) Preparing reagents or drugs for diagnosing and treating abnormal TIDG6 expression.

9. A method for screening a nucleic acid aptamer that binds to a TIDG6 protein, characterized in that: The following steps are involved: S1, synthesize random single-stranded DNA library and primers; S2. Magnetic bead screening: Perform at least 7 rounds of counter-screening and screening, and add serum starting from the 4th round.

10. The method for screening a nucleic acid aptamer binding to TIDG6 protein according to claim 9, characterized in that: The step S2 described in which serum is added after the 4th round includes the following specific processes: 5% serum is added in the 4th round and 20% serum is added in the 5th round; the serum is normal human serum.

Images