Gene related to corn kernel quality and application thereof

Abstract

The invention belongs to the technical field of molecular genetics, and particularly relates to a gene related to corn kernel quality and application, and the nucleotide sequence of the gene is as shown in SEQ ID NO.1. The gene provided by the invention has the functions of regulating and controlling the content of asparagine, tryptophan, phenylalanine, histidine, arginine and serine in corn kernels and the content of amylose, amylopectin and total starch. According to the knockout mutant of the gene created by a gene editing technology, the contents of asparagine, tryptophan, phenylalanine, histidine, arginine and serine as well as the contents of amylose, amylopectin and total starch in corn kernels are increased, and meanwhile, the plant height and the ear height are accidentally reduced, so that the yield and the quality of corn are increased at the same time; and the density resistance of the variety is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetics, and in particular relates to a gene related to corn grain quality and an application thereof. Background Art

[0002] Starch is the main product of photosynthesis in most higher green plants and the main storage material in corn kernels. Starch is the main source of energy for humans and animals. It is not only used in daily diet, but also applied to food processing, new energy development and drug preparation because of its low price. It is an important raw material for food, feed and industry. Starch is mainly stored in the seeds of plants, the tubers of root crops, and a small amount in stems, leaves, fruits and pollen.

[0003] The starch content in ordinary corn kernels may be affected by many factors during the growth process, such as insufficient light and temperature during the development stage, lack of water and fertilizer during the filling period, etc., which may lead to a decrease in starch content.

[0004] Corn kernels are composed of embryo, endosperm, seed coat and other parts. Endosperm is the largest component of corn kernels, and amino acids are mainly stored in the endosperm aleurone layer. In ordinary corn kernels, the content of limiting amino acids such as methionine, lysine, and tryptophan that affect the growth and development of monogastric animals is low, so ordinary corn can only be used as a feed to provide energy, but not as a high-quality protein source. The amino acid composition and content play a key role in the nutritional quality of corn. From a nutritional point of view, it is divided into three categories: essential amino acids, semi-essential amino acids, and non-essential amino acids. Due to the lack of essential amino acids, especially lysine and tryptophan, the quality of corn endosperm protein is poor, which seriously affects the application value and scope of corn. It is particularly important to study the quality of corn kernels - protein and amino acid content.

[0005] Therefore, there is an urgent need to provide a gene that can improve the quality of corn kernels. Summary of the invention

[0006] The purpose of the invention is to provide a gene related to corn kernel quality to increase the amino acid content and starch content of corn kernels.

[0007] The technical solution adopted by the present invention is:

[0008] The present invention provides a gene related to corn kernel quality, and the nucleotide sequence of the gene is shown as SEQ ID NO.1.

[0009] The invention provides an application of the gene, and the gene is used for increasing the amino acid content of corn kernels.

[0010] Preferably, the amino acid content includes at least one of asparagine content, tryptophan content, phenylalanine content, histidine content, arginine content and serine content.

[0011] Preferably, the gene is used to increase the starch content of corn kernels.

[0012] Preferably, the starch content is the amylose content and / or the amylopectin content.

[0013] Preferably, the gene is used to reduce plant height and ear height of corn.

[0014] Preferably, the expression of the gene is inhibited by constructing a knockout vector or a low expression vector to improve the quality of corn kernels.

[0015] Preferably, the method for constructing the knockout vector or low expression vector includes homologous recombination, RNA interference technology, TALEN technology, Gateway technology or CRISPR / Cas9 system.

[0016] The present invention also provides a host cell, wherein the host cell contains the knockout vector or the low expression vector.

[0017] Preferably, the method for constructing the host cell includes microinjection, liposome transfection, calcium phosphate co-precipitation or Agrobacterium-mediated transformation.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention provides a gene related to corn kernel quality, the nucleotide sequence of the gene is shown in SEQ ID NO. 1. The gene provided by the present invention has the function of regulating the contents of asparagine, tryptophan, phenylalanine, histidine, arginine and serine, and the contents of amylose, amylopectin and total starch in corn kernels.

[0020] The knockout mutant of the gene created by the gene editing technology of the present invention increases the content of asparagine, tryptophan, phenylalanine, histidine, arginine, serine, amylose, amylopectin and total starch in corn grains, while unexpectedly reducing plant height and ear height, which is beneficial to simultaneously increase corn yield and quality, and improve variety density tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the QTL mapping result for aspartyl content in maize grains.

[0022] Figure 2 is the genotype after gene editing.

[0023] Figure 3Comparison of grain starch content between ZmASN2 wild type WT and knockout lines KO-1 and KO-2.

[0024] Figure 4 Comparison of amino acid content between ZmASN2 wild type WT and knockout lines KO-1 and KO-2. DETAILED DESCRIPTION

[0025] The present invention is further described below by specific examples, but the scope of the present invention is not limited thereto. The details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0026] The inventive concept of the present invention is as follows:

[0027] In order to enable those skilled in the art to better understand the technical solution of the present invention and implement it, the present invention is further described below in conjunction with specific embodiments. In the description of the present invention, unless otherwise specified, the reagents used are all commercially available, and the methods used are all conventional techniques in the art.

[0028] Experimental method: The amino acid content of corn kernels was detected by hydrolysis method.

[0029] (1) Principle: Protein is hydrolyzed into amino acids by hydrochloric acid, separated by an ion exchange column, and then reacts with ninhydrin solution to produce a color reaction. The amino acid content is then determined by spectrophotometry.

[0030] (2) Reagents:

[0031] 6mol / L hydrochloric acid: Mix 12mol / L high-grade pure concentrated hydrochloric acid and water in a volume ratio of 1:1.

[0032] Buffer for amino acid analyzer: four sodium citrate buffers, pH: 3.3, 3.2, 4.0, 4.9.

[0033] The reaction solution for amino acid analyzer: ninhydrin and its buffer solution shall be prepared by the instrument manager.

[0034] (3) Sample pretreatment, as follows:

[0035] Accurately weigh a certain amount of uniform sample to 0.0001 g and place it in a hydrolysis tube. Add 6 mol / L HCl to the hydrolysis tube and mix.

[0036] After sealing with an alcohol torch, place in a 110℃ thermostat for hydrolysis for 22 hours, and cool to room temperature. Open the hydrolysis tube, filter the hydrolyzate, rinse with deionized water several times, and dilute to a 50mL volumetric flask with deionized water. Take 1mL of the filtrate, dry at 65℃, open the lid for two days to remove the solvent, and finally dissolve with 1mL of 0.02N HCl. Pass the sample through a 0.22μm filter membrane for testing.

[0037] (4) Calculation of amino acid content of samples is as follows:

[0038]

[0039] Where:

[0040] X: amino acid content in the sample, in g / 100g;

[0041] C: amino acid content in the test solution, in ng / 20μL;

[0042] F: sample dilution multiple;

[0043] V: fixed volume after hydrolysis, in mL;

[0044] M: sample mass, in g.

[0045] (5) Starch testing steps are as follows:

[0046] 5.1 Extraction: Accurately weigh 0.1000g of defatted sample, place it in a 50mL volumetric flask, add 10mL of 1mol / L potassium hydroxide solution, fully dissolve in a 75℃ water bath for 20min, dilute to the scale with distilled water after cooling, shake well, let stand for 15min and then filter.

[0047] 5.2 Determination: Take 5 mL of the filtrate and place it in a 50 mL volumetric flask, add 25 mL of distilled water, adjust the pH to 3.0 with 0.1 mol / L hydrochloric acid solution, add 0.5 mL of iodine reagent, and dilute to the mark with distilled water. After standing at room temperature for 25 minutes, use the sample blank solution as a control and use a 1 cm colorimetric cup to measure the absorption values ​​Aλ1, Aλ2, Aλ3, and Aλ4 of the sample solutions λ1, λ2, λ3, and λ4, respectively, to obtain the △A sample 直 , △A type 支 , and then compared quantitatively with the standardized series.

[0048] 5.3 The standard curve is drawn as follows:

[0049] 5.3.1 Select the measurement wavelength and reference wavelength of amylose and amylopectin.

[0050] Take 1.0mL and 5.0mL of standard stock solutions of amylose and amylopectin respectively and place them in a 50mL volumetric flask, add 25mL of distilled water, adjust the pH to 3.0 with 0.1mol / L hydrochloric acid solution, add 0.5mL of iodine reagent, and make up to volume with distilled water. Let stand at room temperature for 25 minutes. Using distilled water as a blank, use a double-beam spectrophotometer to perform a full-band visible light scan to draw the absorption curves of amylose and amylopectin. Determine the measurement wavelengths λ1 and λ2 of amylose and amylopectin, and the reference wavelengths λ3 and λ4.

[0051] 5.3.2 Drawing of dual-wavelength amylose standard curve.

[0052] Take 0.3mL, 0.5mL, 0.7mL, 0.9mL, 1.1mL and 1.3mL of amylose standard stock solution respectively, put them into a 50mL volumetric flask, add 25mL of distilled water, adjust the pH to 3.0 with 0.1mol / L hydrochloric acid solution, add 0.5mL of iodine reagent, and make up to volume with distilled water. After standing at room temperature for 25 minutes, use distilled water as blank, and use a 1cm colorimetric cup to measure Aλ1 and Aλ3 at wavelengths of λ1 and λ3 respectively, and then get △A 直 =Aλ1-Aλ3, with △A 直 The vertical axis is the concentration of amylose in mg / mL, and the horizontal axis is the concentration of amylose in mg / mL. A dual-wavelength amylose standard curve is prepared.

[0053] 5.3.3 Drawing of dual-wavelength pullulan standard curve.

[0054] Take 2.0mL, 2.5mL, 3.0mL, 3.5mL, 4.0mL, 4.5mL and 5.0mL of pullulan standard stock solution respectively and place them in a 50mL volumetric flask. The following operations are the same as 5.3.2. Use distilled water as blank and use a 1cm colorimetric cup to measure Aλ2 and Aλ4 at wavelengths of λ2 and λ4 respectively to obtain △A 支 =Aλ2-Aλ4, with △A 支 With 0.05477 W as the ordinate, the concentration of pullulan, mg / mL, as the abscissa, a dual-wavelength pullulan standard curve was prepared.

[0055] 5.4. The result calculation is as follows:

[0056] The contents of amylose and amylopectin in 100 g of fresh corn kernels were calculated according to formula (1) and formula (2), respectively.

[0057] Formula (1):

[0058] Formula (2):

[0059] Where:

[0060] Y1: the content of amylose in the sample, in g / 100g;

[0061] Y2: the content of amylopectin in the sample, in g / 100g;

[0062] C1: The concentration of amylose in the sample solution obtained from the standard curve, in mg / mL;

[0063] C2: the concentration of amylopectin in the sample solution obtained from the standard curve, in mg / mL;

[0064] M1: The mass of the defatted sample used for determination, in g;

[0065] W1: moisture content in the sample, in g / 100g;

[0066] W2: crude fat content in the sample, in g / 100g;

[0067] The calculation result is retained to 2 decimal places.

[0068] Example 1

[0069] A gene associated with corn kernel quality, as follows:

[0070] The present invention is analyzed by GWAS, and the results are shown in Figure 1 , a gene ZmASN2 related to the amino acid content and starch content of corn kernels was found at the same position in two different populations. The gene is located at 225163653bp~235330494bp on chromosome 3 of the corn genome. In the B73 reference genome, the ID number of the v3 version is GRMZM2G093175, the ID number of the v4 version is Zm00001d044608, and the ID number of the v5 version is Zm00001eb163240. The two populations used in the present invention are CUBIC of 1400 families and natural population of 513 families. The nucleotide sequence of ZmASN2 is shown in SEQ ID NO.1.

[0071] SEQ ID NO.1:

[0072]

[0073] Example 2

[0074] An application of a gene related to corn kernel quality, specifically as follows:

[0075] In order to further verify the function of the ZmASN2 gene, the present invention uses CRISPR / Cas9 gene editing technology to knock out the ZmASN2 gene and investigates the trait performance of corn after knockout.

[0076] Gene editing was performed using conventional operations commonly used in the art, wherein the selected editing target sequence is shown in SEQ ID NO. 2, and the maize receptor for the gene editing operation is KN5585. The obtained gene-edited materials KO-1 and KO-2 were investigated for grain traits and starch content.

[0077] SEQ ID NO. 2: CGACCAGCCCCTCTACAACG.

[0078] The grain phenotypes of gene-edited materials are shown in Table 1; the agronomic phenotypes of gene-edited materials are shown in Table 2. The results showed that in terms of 100-grain weight, the 100-grain weight of WT was 26.07g, and the 100-grain weight of KO-1 was 28.49g. Compared with WT, KO-1 increased by 9.28%, with no significant difference; the 100-grain weight of KO-2 was 25.50g, and KO-2 decreased by 2.19% compared with WT, with no significant difference. In terms of grain length, grain thickness and grain width, the grain length of WT was between 8.56mm and 9.82mm, with an average of 9.17mm, and the grain length of KO-1 was between 8.24mm and 9.67mm, with an average of 9.13mm. Compared with WT, the grain length of KO-1 was slightly smaller than that of WT, with no significant difference; the grain length of KO-2 was between 7.60mm and 9.32mm, with an average of 8.51mm. Compared with WT, the grain length of KO-2 was significantly smaller than that of WT, showing an extremely significant difference. The grain thickness of WT ranged from 4.61mm to 6.19mm, with an average value of 5.38mm. The grain thickness of KO-1 ranged from 5.18mm to 6.43mm, with an average value of 5.66mm. There was no significant difference between KO-1 and WT. The grain thickness of KO-2 ranged from 4.58mm to 6.37mm, with an average value of 5.49mm. There was no significant difference between KO-2 and WT. The grain width of WT ranged from 7.28mm to 9.33mm, with an average value of 8.23mm. The grain width of KO-1 ranged from 8.45mm to 9.02mm, with an average value of 8.65mm. Compared with WT, the grain width of KO-1 was slightly larger than that of WT, with no significant difference. The grain width of KO-2 ranged from 8.01mm to 9.02mm, with an average value of 8.41mm. There was no significant difference between KO-2 and WT.

[0079] Analysis of the agronomic traits of KO-1, KO-2 and WT showed that in terms of stem thickness, the average stem thickness of WT was 1.16 cm, the average stem thickness of KO-1 was 1.25 cm, and the average stem thickness of KO-2 was 1.32 cm. There was no significant difference between KO-1, KO-2 and WT. In terms of 100-grain weight, the 100-grain weight of WT was 26.07 g, and the 100-grain weight of KO-1 was 28.49 g. KO-1 increased by 9.28% compared with WT, with no significant difference. The 100-grain weight of KO-2 was 25.50 g, and KO-2 decreased by 2.19% compared with WT, with no significant difference. In terms of ear length, ear thickness, number of ear rows, and number of grains per row, the average ear length of WT in 2022 was 107.87 mm, the average ear length of KO-1 was 104.10 mm, and there was no significant difference between KO-1 and WT. The average ear length of KO-2 was 101.65 mm, with no significant difference compared with WT. The average ear diameter of WT was 40.98 mm, and the average ear diameter of KO-1 was 42.18 mm. There was no significant difference between KO-1 and WT; the average ear diameter of KO-2 was 37.96 mm, which was not significantly different from WT. The average number of ear rows of WT was 12.80, and the average number of ear rows of KO-1 was 12.20. There was no significant difference between KO-1 and WT; the average number of ear rows of KO-2 was 11.00, which was significantly different from WT. The average number of grains per row of WT was 17.00, and the average number of grains per row of KO-1 was 16.10, and the average number of grains per row of KO-2 was 14.70. There was no significant difference between KO-1 and KO-2 and WT. In terms of ear height, the average ear height of WT was 34.60 cm, the average ear height of KO-1 was 32.70 cm, and the average ear height of KO-2 was 30.40 cm. There was no significant difference among KO-1, KO-2 and WT.

[0080] By analyzing the gene sequence of the target site, it was found that the gene sequence edited by KO-2 caused an increase of 2 bases AC, and the gene sequence edited by KO-1 caused a decrease of 33 bases AACGAGGACCAGTCGGTGGTCGTCGCCGTCA, see Figure 2 , which results in truncation of the starch coding sequence.

[0081] The starch content and amino acid content of WT, KO-1 and KO-2 were tested. The results are shown in Figure 3 and Figure 4 , the contents of amylose, straight chain starch and total starch in KO-1 and KO-2 were significantly higher than those in W; the contents of serine, tyrosine and aspartic acid in KO-1 and KO-2 were significantly higher than those in WT.

[0082] Table 1. Grain phenotypes of gene-edited materials

[0083] Material Grain length, mm Grain width, mm Grain thickness, mm 100-grain weight, g WT 9.17±0.13 8.23±0.58 5.38±0.46 26.07±1.08 KO-1 9.13±0.14 8.65±0.05 5.66±0.15 28.49±0.17 KO-2 8.51±0.17** 8.41±0.09 5.49±0.19 25.50±1.22

[0084] Phenotypes are expressed as mean ± standard error, ** represents p value less than 0.01 in student-t test, * represents p value less than 0.05.

[0085] Table 2 Agronomic phenotypes of gene-edited materials

[0086] Material Stem diameter, cm Spike length, cm Ear diameter, cm Ear weight, g Number of ear rows Number of rows Ear height, cm WT 1.16±0.10 10.79±0.56 4.10±0.13 68.39±1.13 12.80±0.44 17.00±1.64 34.60±1.20 KO-1 1.25±0.10 10.41±0.33 4.22±0.13 72.13±1.69 12.20±0.70 16.10±0.75 32.70±1.58 KO-2 1.32±0.10 10.16±0.49 3.80±0.10 57.90±1.58 11.00±0.68* 14.70±1.25 29.10±1.74

[0087] Phenotypes are expressed as mean ± standard error, ** represents p value less than 0.01 in student-t test, * represents p value less than 0.05.

[0088] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0089] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A gene related to corn kernel quality, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The use of the gene according to claim 1, characterized in that: The gene is used to increase the amino acid content of corn kernels.

3. The use of the gene as claimed in claim 2, characterized in that: The amino acid content includes at least one of asparagine content, tryptophan content, phenylalanine content, histidine content, arginine content and serine content.

4. The use of the gene according to claim 1, characterized in that: The gene is used to increase the starch content of corn kernels.

5. The use of the gene as claimed in claim 4, characterized in that: The starch content refers to the amylose content and / or the amylopectin content.

6. The use of the gene according to claim 1, characterized in that: The gene is used to reduce the plant height and ear height of corn.

7. The use of the gene as claimed in claim 2, characterized in that: By constructing a knockout vector or a low expression vector, the expression of the gene is inhibited to improve the quality of corn kernels.

8. The use of the gene as claimed in claim 7, characterized in that: Methods for constructing the knockout vector or low expression vector include homologous recombination, RNA interference technology, TALEN technology, Gateway technology or CRISPR / Cas9 system.

9. A host cell, characterized in that Contains the knockout vector or low expression vector according to claim 7.

10. The host cell according to claim 9, characterized in that The methods for constructing the host cell include microinjection, liposome transfection, calcium phosphate co-precipitation or Agrobacterium-mediated transformation.

Images