Vacuolar amino acid transporter gene derived from tartary buckwheat, expression vector thereof and application
Isolating and overexpressing the FtYPQ1 vacuolar amino acid transporter gene in plants addresses the lack of understanding of zinc regulatory genes in buckwheat, enhancing zinc tolerance and accumulation.
Patent Information
- Application Number
- CN202510221142.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2045-02-27
AI Technical Summary
In the prior art, little is known about the genetic background and key regulatory genes of the content of thirst buckwheat, and it is difficult to effectively improve the tolerance of plants to zinc stress and zinc accumulation.
The vacuolar amino acid transporter FtYPQ1 gene was isolated and cloned from buckwheat. The gene was overexpressed in plants by constructing a recombinant plant expression vector to enhance its tolerance under zinc stress and improve zinc content in plants.
It improves the tolerance of plants under zinc stress and the zinc content in plants, and enhances the ability of plants to accumulate zinc.
Smart Images

Figure CN119685350B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a vacuolar amino acid transporter gene derived from plants, and particularly to a vacuolar amino acid transporter gene isolated from tartary buckwheat, its expression vector, and its application in regulating plant tolerance to zinc stress or regulating zinc accumulation in plants, belonging to the field of vacuolar amino acid transporter genes and their applications. Background Art
[0002] Zinc plays many crucial roles in life. Zn 2+ plays a central role in determining the structure and catalytic function of nearly 10% of the proteins in the proteomes of most eukaryotes. Plants are the ultimate source of zinc in the human diet. Multiple methods have been used to increase bioavailable zinc in the dietary system. Nutritional programs using supplements have proven to be particularly effective short-term strategies, and adding zinc oxide to flour has also proven to be a cost-effective strategy. Biofortification, which increases the micronutrient content and availability in the edible parts of crops during crop cultivation, is a more sustainable method.
[0003] Tartary buckwheat is a dicotyledonous plant of the genus Fagopyrum in the family Polygonaceae. It is a cultivated variety of buckwheat, rich in mineral nutrients and trace elements, and has characteristics such as strong environmental adaptability, short growth period, and tolerance to cold, cool, and barren environments. Compared with the major food crops wheat and rice, tartary buckwheat contains relatively high zinc. However, little is known about the genetic background and key regulatory genes of zinc content in tartary buckwheat. Summary of the Invention
[0004] One object of the present invention is to provide a vacuolar amino acid transporter gene isolated from tartary buckwheat and its encoded protein;
[0005] Another object of the present invention is to provide an expression cassette containing the vacuolar amino acid transporter gene, a recombinant expression vector, or a recombinant host cell containing the recombinant expression vector;
[0006] A third object of the present invention is to apply the vacuolar amino acid transporter gene isolated from tartary buckwheat, its encoded protein, the expression cassette containing the vacuolar amino acid transporter gene, the recombinant expression vector, or the recombinant host cell containing the recombinant expression vector, etc. to regulate plant tolerance to zinc stress or regulate zinc accumulation in plants.
[0007] To achieve the above objects, the main technical solutions adopted by the present invention include:
[0008] One aspect of the present invention provides a vacuolar amino acid transporter FtYPQ1 gene isolated from tartary buckwheat.
[0009] The vacuolar amino acid transporter described in the present invention FtYPQ1 The nucleotide sequence of the gene is the nucleotide sequence shown in (a) or (b):
[0010] (a) The polynucleotide sequence shown in SEQ ID NO.1;
[0011] (b) The polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2.
[0012] On the other hand, the present invention provides a protein FtYPQ1 encoded by the vacuolar amino acid transporter gene isolated from tartary buckwheat.
[0013] The amino acid sequence of the vacuolar amino acid transporter FtYPQ1 described in the present invention is shown in (a) or (b):
[0014] (a) The amino acid shown in SEQ ID NO.2;
[0015] (b) A protein variant that is derived from the amino acid shown in SEQ ID NO.2 by substitution, deletion, and / or insertion of one or more amino acid residues and still has the function or activity of transporting heavy metal ions.
[0016] The protein variants described in the present invention can be generated by genetic polymorphisms or artificial manipulations, which are generally known in the art. For example, amino acid sequence variants or fragments of the vacuolar amino acid transporter FtYPQ1 can be prepared by DNA mutations, and methods for mutagenesis or modification of polynucleotides are well known in the art. Among them, conservative substitution is to replace one amino acid residue with another amino acid having similar properties.
[0017] The present invention also provides a recombinant plant expression vector containing the above-mentioned vacuolar amino acid transporter FtYPQ1 gene and a host cell containing the recombinant plant expression vector.
[0018] The chimeric genes or expression cassettes obtained by chimerizing or ligating the gene shown in SEQ ID NO.1 of the present invention with other genes all belong to the protection scope of the present invention; the recombinant expression vectors containing the above-mentioned chimeric genes or expression cassettes also belong to the protection scope of the present invention.
[0019] On the other hand, the present invention is to apply the vacuolar amino acid transporter gene isolated from tartary buckwheat, its encoded protein, the expression cassette containing the vacuolar amino acid transporter gene, the recombinant expression vector, or the recombinant host cell containing the recombinant expression vector, etc. to regulate the tolerance of plants to zinc stress or the zinc accumulation in plants.
[0020] A preferred specific embodiment of the present invention is that regulating the tolerance of plants to zinc stress means improving the tolerance of plants under zinc stress treatment or promoting plant growth.
[0021] A preferred specific embodiment of the present invention is that regulating zinc accumulation in plants means increasing the zinc content in plants.
[0022] As a reference, the present invention provides an embodiment. That is, by overexpressing the coding gene of the vacuolar amino acid transporter, the expression level or activity of the vacuolar amino acid transporter is increased, thereby improving the tolerance of plants under zinc stress treatment or increasing the zinc content in plants.
[0023] A preferred specific embodiment of the present invention is a method for improving the tolerance of plants under zinc stress treatment or increasing the zinc content in plants, including: overexpressing the vacuolar amino acid transporter FtYPQ1 gene in plants to enhance the expression level of the vacuolar amino acid transporter FtYPQ1 gene or enhance the function or activity of the vacuolar amino acid transporter FtYPQ1; for example, connecting the vacuolar amino acid transporter FtYPQ1 gene derived from tartary buckwheat with an expression regulatory element to obtain a recombinant plant expression vector for expressing this gene in plants; transforming the recombinant plant expression vector into plants to overexpress the vacuolar amino acid transporter FtYPQ1 gene in plants, and the obtained transgenic plants have enhanced tolerance to zinc stress or increased zinc content in vivo.
[0024] As a reference, the present invention provides a recombinant plant expression vector of the vacuolar amino acid transporter FtYPQ1 gene, including: connecting the vacuolar amino acid transporter FtYPQ1 gene derived from tartary buckwheat with an expression regulatory element to obtain a recombinant plant expression vector; this recombinant plant expression vector can be composed of a 5′-untranslated region, the nucleotide shown in SEQ ID NO.1, and a 3′-untranslated region; wherein, the 5′-untranslated region may include a promoter sequence, an enhancer sequence, or / and a translation enhancer sequence; the promoter can be a constitutive promoter, an inducible promoter, a tissue- or organ-specific promoter; the 3′-untranslated region may contain a terminator sequence, an mRNA cleavage sequence, etc. A suitable terminator sequence can be taken from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination regions.
[0025] The recombinant plant expression vector may also contain a selectable marker gene for selecting transformed cells, which is used to select transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds, etc. In addition, the marker genes also include phenotypic markers, such as β-galactosidase and fluorescent proteins, etc.
[0026] Transformation protocols and protocols for introducing the polynucleotide or polypeptide into a plant may vary depending on the type of plant or plant cell available for transformation. Suitable methods for introducing the polynucleotide into a plant cell include: microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-velocity ballistic bombardment, etc. In certain embodiments, various transient transformation methods can be utilized to provide the tartary buckwheat vacuolar amino acid transporter FtYPQ1 gene to a plant. Transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5:81-84).
[0027] The present invention also provides a method for cultivating a plant variety with a high zinc content or strong tolerance to zinc stress, including: (1) constructing a recombinant plant expression vector containing the vacuolar amino acid transporter FtYPQ1 gene or its chimeric gene; (2) transforming the constructed recombinant plant expression vector into plant tissues or plant cells; (3) overexpressing the vacuolar amino acid transporter FtYPQ1 gene in the plant tissues or cells.
[0028] In a preferred specific embodiment of the present invention, the plant is tartary buckwheat or Arabidopsis thaliana.
[0029] The present invention cloned the vacuolar amino acid transporter FtYPQ1 gene from tartary buckwheat, and transferred the pYES2- FtYPQ1 recombinant plasmid into a zinc-sensitive yeast strain for functional analysis, and found that the vacuolar amino acid transporter FtYPQ1 has the ability to transport zinc and can increase the accumulation of zinc in plants. The present invention genetically transformed tartary buckwheat explants with the FtYPQ1 gene to obtain transgenic buckwheat hairy roots overexpressing the FtYPQ1 gene. Compared with the hairy roots of the control group, the hairy roots of tartary buckwheat overexpressing the FtYPQ1 gene have stronger tolerance under zinc stress treatment; the present invention overexpressed the FtYPQ1 gene in Arabidopsis thaliana and found that the zinc content in Arabidopsis thaliana overexpressing the FtYPQ1 gene is higher than that of wild-type Arabidopsis thaliana; it is proved that the FtYPQ1 gene can regulate the tolerance of plants to zinc stress or regulate the accumulation of zinc in plants. The present invention enriches the research on the functions of vacuolar amino acid transporter family proteins and provides guidance for the molecular breeding of future high-zinc tartary buckwheat and other crops.
[0030] Terminology Definitions Related to the Present Invention
[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0032] The terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides in single- or double-stranded form, and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, including PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioates, phosphoroamidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as the explicitly specified sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue.
[0033] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, a description of a polypeptide applies equally to a description of a peptide and a description of a protein, and vice versa. The term applies to both naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked by covalent peptide bonds.
[0034] As used in this invention, "stringent hybridization conditions" means conditions of low ionic strength and high temperature known in the art. Typically, under stringent conditions, a probe hybridizes to its target sequence with a detectable degree that is higher than that of hybridization to other sequences (e.g., at least 2-fold above background). Stringent hybridization conditions are sequence-dependent and will vary in different environmental conditions. Longer sequences hybridize specifically at higher temperatures. By controlling the stringency of hybridization or wash conditions, a target sequence that is 100% complementary to the probe can be identified. Exhaustive guidance for nucleic acid hybridization can be found in the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acidassays.1993). More specifically, the stringent conditions are usually selected to be about 5-10 °C below the thermal melting point (T m ) of the specific sequence at a specified ionic strength and pH. T mThe temperature at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (at a specified ionic strength, pH, and nucleic acid concentration) (since the target sequence is present in excess, 50% of the probes are occupied at equilibrium at T m ). Stringent conditions can be as follows: where the salt concentration is less than about 1.0 M sodium ion concentration at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ion concentration (or other salts), and the temperature is at least about 30 °C for short probes (including (but not limited to) 10 to 50 nucleotides), and at least about 60 °C for long probes (including (but not limited to) greater than 50 nucleotides). Stringent conditions can also be achieved by adding destabilizers such as formamide. For selective or specific hybridization, the positive signal can be at least twice the background hybridization, or 10-fold background hybridization as appropriate. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5×SSC, and 1% SDS, incubated at 42 °C; or 5×SSC, 1% SDS, incubated at 65 °C, washed in 0.2×SSC and washed in 0.1% SDS at 65 °C. The washing can be carried out for 5, 15, 30, 60, 120 minutes or longer.
[0035] The term "recombinant host cell line" or "host cell" means a cell containing the polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f - mating, or other methods known in the art. The exogenous polynucleotide can be maintained as a non - integrating vector such as a plasmid or can be integrated into the host genome. The host cell can be a prokaryotic cell or a eukaryotic cell, and the host cell can also be a monocotyledonous or dicotyledonous plant cell.
[0036] The term "operably linked" refers to a functional linkage between two or more elements, and the elements that are operably linked can be adjacent or non - adjacent.
[0037] The term "recombinant plant expression vector" means one or more DNA vectors for achieving plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors together with vectors having helper plasmids are most commonly used for Agrobacterium tumefaciens - mediated transformation. Binary vectors typically include: cis - acting sequences required for T - DNA transfer, selectable markers engineered to be able to be expressed in plant cells, heterologous DNA sequences to be transcribed, etc.
[0038] The term "transformation" refers to a method of introducing a heterologous DNA sequence into a host cell or organism.
[0039] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] Figure 1 The FtYPQ1 cloning result diagram of the CDS of the gene.
[0041] Figure 2 is FtYPQ1 the zinc transport activity of the gene in yeast; wherein, Figure 2 -a is the growth situation of yeast in the culture medium; Figure 2 -b is the growth curve of yeast.
[0042] Figure 3 is the relative expression level detected by qRT-PCR of the FtYPQ1 gene in the hairy roots containing the empty vector pCAMBIA 1307 and the overexpressed FtYPQ1 gene hairy roots.
[0043] Figure 4 is the determination of zinc tolerance of wild-type hairy roots and overexpressed FtYPQ1 gene hairy roots; wherein, Figure 4 -a is the phenotype diagram of wild-type hairy roots and overexpressed FtYPQ1 gene hairy roots under the treatment of excessive ZnCl2; Figure 4 -b is the statistical chart of fresh weight of wild-type hairy roots and overexpressed FtYPQ1 gene hairy roots under the treatment of excessive ZnCl2.
[0044] Figure 5 is the positive identification result of Arabidopsis thaliana overexpressing the FtYPQ1 gene; wherein, N is the negative control, and the material is wild-type Arabidopsis thaliana; P is the positive control, and the material is the pCAMBIA 1307- FtYPQ1 recombinant plasmid constructed according to the CDS sequence of the FtYPQ1 gene.
[0045] Figure 6 is the phenotype diagram of wild-type Arabidopsis thaliana and Arabidopsis thaliana overexpressing the FtYPQ1 gene under ZnCl2 treatment.
[0046] Figure 7 is the statistical chart of the content of Zn FtYPQ1 in wild-type Arabidopsis thaliana and Arabidopsis thaliana overexpressing the 2+ gene. Specific implementation manners
[0047] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, it should be understood that the described embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that without departing from the spirit and scope of the present invention, modifications or substitutions can be made to the details and forms of the technical solutions of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.
[0048] Example FtYPQ1 CDS cloning of gene
[0049] Select 4-week-old tartary buckwheat seedlings, take 100 mg of leaves, grind them thoroughly with liquid nitrogen, and then extract total RNA using the Trizol method. Using this RNA as a template, reverse transcription is performed using the HiScript® III 1st Strand cDNA Synthesis Kit (+gDNAwiper) kit (Nanjing Novoprotein Biotechnology Co., Ltd.) to obtain the cDNA of 'Pin Ku'.
[0050] Using the cDNA of tartary buckwheat 'Pin Ku' as a template, using primers FtYPQ1- F / R, PCR amplification is performed using Phanta high-fidelity enzyme (Phanta® Max Master Mix, Vazyme, Beijing) to clone and obtain FtYPQ1 The nucleotide sequence of the CDS of the gene ( Figure 1 ).
[0051] The PCR program is 95°C for 3 min; 95°C for 30 s, 57°C for 60 s, 72°C for 90 s, for 32 cycles. After sequencing, analysis, and splicing of the PCR purified product, the full-length sequence of the CDS of the FtYPQ1 gene is obtained.
[0052] FtYPQ1
[0053] The amino acid sequence of the vacuolar amino acid transporter FtYPQ1 is shown in SEQ ID NO.2: MNPMLFNSKQSNSIVEYCYKENKPCIAWIQTYFSDCLCNFRDRISFGFGFISVLAWIVAEVPQIITNFQTKSSHGLSFLFLFTWVIGDVFNVAGCLLEPATLPTQYYTALLYTVSTLVLVFQSLYYDHFYKWWKCRQKKARTTQQVEDEKTPLKPSKQEDEQGRGGIPIPSAAEPQAQTARKEFYYMSARSLVGSNTPPFRSYLRIAKSGPSAMAIGGDHHFSSEDENENDSTVSAVAPVKTQPRSIPRSVGRGAFVAASLNLPAQSNAIAAVYQGFTGRRFLQESDVDYSAFGQWLGWTMAAIYMGGRIPQIVLNIKRGSVEGLNPLMFIFALIGNVTYVASILVRSTEWEKLKANLPWLLDAVVCVALDLFILLQYVYYKYLRKKDFDGDDDKKDYYVEVHPKAFVA (SEQ ID NO.2).
[0054] Primer FtYPQ1- The nucleotide sequences of F / R are as follows:
[0055] FtYPQ1- F: ATGAATCCAATGCTCTTCAACTCC (SEQ ID NO.3);
[0056] FtYPQ1- R: TTAAGCTACAAAGGCTTTTGGATG (SEQ ID NO.4).
[0057] Test Example 1 FtYPQ1 Functional analysis of the gene in yeast
[0058] 1 Test method
[0059] To verify whether the vacuolar amino acid transporter FtYPQ1 has the ability to transport zinc, a yeast expression vector was constructed. The plasmid pYES2 was linearized with restriction enzymes EcoR I and Xho I; Using the PCR purified product of the FtYPQ1 gene as a template and pYES2- FtYPQ1 -F / R as primers, the full-length sequence of the FtYPQ1 gene was amplified by PCR; FtYPQ1After the full-length sequence of the gene was recovered, ligated, and transformed, the amplified fragment of the CDS of the gene was inserted into the yeast expression vector pYES2 between the two restriction enzyme sites using a homologous recombination enzyme (2×MultiF Seamless Assembly Mix, ABclonal, Wuhan). Positive E. coli monoclonal colonies were picked for PCR amplification. After the amplified products were confirmed by 1% agarose gel electrophoresis, the target colonies were streaked and cultured overnight. The next day, plasmids were extracted using the Plasmid Mini Kit I (OMEGA). After sequencing identification, the recombinant plasmid, plasmid pYES2, and the positive control pYES2- FtYPQ1 The recombinant plasmid (OsIRT1 is a ferrous ion transporter with Zn transport ability reported in rice) was introduced into the zinc-sensitive yeast strain ( EcoRI and XhoI ) using a yeast transformation kit (Frozen-EZ Yeast Transformation Ⅱ TM, ZYMO research, T2001). The cells were cultured on SD / -Ura solid medium (purchased from Coolaber, Beijing) at 30 °C for 72 h. OsIRT1 The nucleotide sequences of the primers pYES2- Δzrc1 -F / R are shown below: BY4741 ; MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 YMR243c::kanMX4 ) using a yeast transformation kit (Frozen-EZ Yeast Transformation Ⅱ TM, ZYMO research, T2001). The cells were cultured on SD / -Ura solid medium (purchased from Coolaber, Beijing) at 30 °C for 72 h.
[0060] pYES2- FtYPQ1 -F: gccgccagtgtgctggaattcATGAATCCAATGCTCTTCAACTCC (SEQ ID NO.5);
[0061] pYES2- FtYPQ1 -F: gccgccagtgtgctggaattcATGAATCCAATGCTCTTCAACTCC (SEQ ID NO.5);
[0062] pYES2- FtYPQ1 -R: ccctctagatgcatgctcgagTTAAGCTACAAAGGCTTTTGGATG (SEQ ID NO.6).
[0063] Prepare a yeast seed solution and culture the transformed yeast monoclonal strain overnight (about 12 - 16 h) in SD / -Ura liquid medium until the logarithmic growth phase (OD 600= 0.8 - 1.0), and the culture conditions were 30 °C and a shaking incubator at 200 rpm. Transfer 1 mL of the bacterial solution to 5 mL of untreated SD / -Ura liquid medium, and culture it at 30 °C and 200 rpm until the logarithmic growth phase. Centrifuge the bacterial solution at 4000 rpm for 5 min at 4 °C using a pre-cooled centrifuge to enrich the bacteria, then pour off the supernatant. Repeat this process 3 times, resuspend the bacteria with sterile water and centrifuge to precipitate the bacteria. During this period, repeatedly pipette the bacterial clumps at the bottom of the centrifuge tube with a 1 mL pipette gun to completely suspend the bacteria.
[0064] Take the prepared bacterial solution with an OD 600 = 1.0 and perform 4 serial 10-fold dilutions (10 0 , 10 -1 , 10 -2 , 10 -3 and 10 -4 ). Take 5 μL of the bacterial solution with different dilution factors and titrate it onto galactose / glucose SD / -Ura plates containing ZnCl2 (0 μM, 200 μM, 400 μM), and culture it upside down in the dark in an incubator at 30 °C for 3 - 5 days. Observe and take pictures regularly for recording.
[0065] Transfer yeast cells in the logarithmic growth phase to 30 mL of SD / -Ura liquid medium (galactose as the carbon source), adjust the initial OD 600 = 0.05, set up treatment groups and a control group (adding the same volume of sterile water), each treatment contains 3 biological replicates, and the culture conditions are 30 °C and a shaking incubator at 200 rpm. Measure the OD 600 of the bacterial solution at different time points using a UV / visible spectrophotometer.
[0066] 2 Experimental Results
[0067] The experimental results are as Figure 2 shown. Yeasts containing empty vectors pYES2, pYES2- FtYPQ1 and pYES2- OsIRT1 recombinant plasmids showed the same growth state in yeast media supplemented with glucose and different concentrations of Zn 2+ . Compared with yeasts containing the empty vector pYES2, yeasts containing pYES2- FtYPQ1 and pYES2- OsIRT1 recombinant plasmids grew significantly weaker in media supplemented with galactose and 200 μM, 400 μM Zn 2+ ( Figure 2 -a), indicating that the transformed pYES2- FtYPQ1 and pYES2- OsIRT1 recombinant plasmid yeasts have Zn 2+Transport capacity, with a high concentration of zinc in the body, which in turn affects yeast growth. Similarly, at 200 μM Zn 2+ treatment, yeast containing pYES2- FtYPQ1 and pYES2- OsIRT1 The yeast growth curve values of the recombinant plasmid were significantly lower than those of the yeast containing the empty vector pYES2 ( Figure 2 -b).
[0068] Experimental Example 2 FtYPQ1 Experiment on the tolerance of tartary buckwheat to zinc stress regulated by genes
[0069] 1 Construction of hairy roots of tartary buckwheat overexpressing FtYPQ1 genes
[0070] Using the PCR purified product of the FtYPQ1 gene as a template, 1307- FtYPQ1 -F / R as primers, PCR amplification of the full-length sequence of the FtYPQ1 gene. After recovery, ligation and transformation, the full-length sequence of the FtYPQ1 gene was inserted forward downstream of the CaMV35S promoter of the pCAMBIA 1307 vector. After complete sequencing, the overexpression vector pCAMBIA 1307- FtYPQ1 .
[0071] The nucleotide sequences of primers 1307- FtYPQ1 -F / R are shown as follows:
[0072] 1307- FtYPQ1 -F: gtatctagaactagtggatccATGAATCCAATGCTCTTCAACTCCA (SEQ ID NO.7);
[0073] 1307- FtYPQ1- R: gtcgacggtatcgataagcttAGCTACAAAGGCTTTTGGATGAACT (SEQ ID NO.8).
[0074] The pCAMBIA 1307- FtYPQ1 recombinant plasmid verified by sequencing and the pCAMBIA 1307 empty vector plasmid were respectively transformed into the competent cells of Agrobacterium tumefaciens A4 and GV3101 by heat shock method. After colony PCR identification, the positive bacteria containing the pCAMBIA1307- FtYPQ1 recombinant plasmid and the positive bacteria containing the pCAMBIA 1307 empty vector were obtained. The pCAMBIA 1307- FtYPQ1The colonies of Agrobacterium rhizogenes A4 containing the recombinant plasmid and Agrobacterium rhizogenes A4 containing the pCAMBIA 1307 empty vector were picked into a liquid medium and shaken at 28 °C and 200 rpm until OD 600 = 0.8. The leaves and stems of tartary buckwheat cultivar Pikou No. 1 were infected with the bacterial solution and placed on an MS solid medium containing 25 mg / L hygromycin (Hyg) resistance. After culturing for 1 - 2 weeks, hairy roots that grew were initially identified as candidate positive hairy roots. qRT-PCR was performed using FtYPQ1 -qPCR-F / R to detect FtYPQ1 gene expression levels. The FtACTIN gene constitutively expressed in buckwheat was used as an internal reference gene, and qRT-PCR was performed using the primers FtACTIN-qPCR-F / R. Quantitative real-time PCR (qRT-PCR) was used to detect FtYPQ1 gene expression levels on a BAI7500 real-time fluorescence quantitative PCR instrument. The relative expression level was calculated using the RQ (relative expression level) = 2 -ΔΔCT algorithm. The expression level value of the hairy roots containing the pCAMBIA 1307 empty vector was set to 1, and 3 biological replicate experiments were performed. FtYPQ1 The nucleotide sequences of the primers
[0075] -qPCR-F / R and FtACTIN-qPCR-F / R are as follows: FtYPQ1 -qPCR-F: CCATGTATAGCCTGGATTCAAACC (SEQ ID NO.9);
[0076] FtYPQ1 -qPCR-R: ATGATCTGAGGGACTTCAGCGAC (SEQ ID NO.10).
[0077] FtYPQ1 FtACTIN-qPCR-F: ATGGCAGAATCTGAGGACATTCAG (SEQ ID NO.11);
[0078] FtACTIN-qPCR-R: GAAACACTTTCTGTGGACAATTGATG (SEQ ID NO.12).
[0079] The results of qRT-PCR are as shown in
[0080] . The expression level of the Figure 3 gene in the overexpressed FtYPQ1 gene hairy roots is higher than that in the hairy roots transformed with the pCAMBIA-1300 empty vector. FtYPQ1
[0081] 2 Overexpression FtYPQ1 Determination of the Tolerance of Hairy Roots Overexpressing Genes to Zinc Stress
[0082] Take the same amount of wild - type hairy roots (CK) and three positive lines (OE1, OE2, OE3) of hairy roots overexpressing genes, place them on MS solid medium supplemented with 1 mM ZnCl2, and culture them in the dark for 2 weeks. Set three biological replicates, observe the growth of hairy roots and weigh the fresh weight of hairy roots. FtYPQ1 As shown in the determination results, under zinc stress, the growth of hairy roots overexpressing genes is stronger than that of wild - type hairy roots (
[0083] -a), and the fresh weight of hairy roots overexpressing genes is higher than that of wild - type hairy roots ( Figure 4 -b), indicating that overexpression of genes enhances the zinc tolerance of tartary buckwheat. FtYPQ1 Figure 4 Overexpression FtYPQ1 Figure 4 Overexpression FtYPQ1 genes enhances the zinc tolerance of tartary buckwheat.
[0084] Experimental Example 3 FtYPQ1 Experiment on Regulating Zinc Content in Arabidopsis thaliana by Genes
[0085] 1 Construction of Arabidopsis thaliana Overexpressing Genes FtYPQ1 Infect Arabidopsis thaliana with the agrobacterium tumefaciens liquid containing the recombinant plasmid pCAMBIA 1307 -
[0086] using the floral - dipping method to obtain transgenic Arabidopsis thaliana seeds. After disinfecting the infected Arabidopsis thaliana seeds with 10% sodium hypochlorite for 8 minutes, wash them 4 - 5 times with sterile water. Then place the treated seeds on MS solid medium containing hygromycin (Hyg) resistance and culture for 1 - 2 weeks. Arabidopsis thaliana plants that can grow true leaves are preliminarily identified as candidate positive plants. Extract Arabidopsis thaliana DNA for PCR verification, and use the pCAMBIA 1307 vector primers 1307 - F / R to detect whether the gene transformation is successful. As shown in the detection results, Arabidopsis thaliana overexpressing genes has been constructed. FtYPQ1 Figure 5 Overexpression FtYPQ1 genes has been constructed.
[0087] The nucleotide sequences of primers 1307 - F / R are as follows:
[0088] 1307 - F: GAGAGCTTGGGCGACCTCA (SEQ ID NO.13);
[0089] 1307 - R: GAGAGAGACTGGTGATTTTTGC (SEQ ID NO.14).
[0090] Overexpression FtYPQ1 Determination of Zinc Content in Arabidopsis thaliana with Overexpressed
[0091] The Arabidopsis thaliana with overexpressed FtYPQ1 gene (OE#1, OE#2, OE#3) and wild-type Arabidopsis thaliana (Col-0) were sown on MS solid medium containing 0.2 mM ZnCl2 and cultured for 3 weeks. Three biological replicates were set up to observe the growth of Arabidopsis thaliana.
[0092] ICP-MS analysis of Zn content in different Arabidopsis thaliana was carried out. Arabidopsis thaliana was dried at 80 °C for 5 days, crushed and filtered through a 40-mesh sieve. Exactly 0.2000 g (accurate to 0.0001 g) of the sample was weighed and placed into a 15-mL digestion tube. 1 mL of distilled water and 4 mL of HNO3-H2O2 mixture were added. After standing for a while, the digestion tube was placed into the inner barrel and digested using an ultra-microwave digestion system (EXPEC 790S, China). After digestion was completed, the sample was transferred to a 50-mL plastic volumetric flask, and the concentration of Zn element was determined by an inductively coupled plasma mass spectrometer (SUPEC 7000, Puyu Technology, Hangzhou, China). Three biological replicates were set up.
[0093] The growth of Arabidopsis thaliana was as Figure 6 shown. The growth vigor and root length of Arabidopsis thaliana with overexpressed FtYPQ1 gene were better than those of wild-type Arabidopsis thaliana; the Zn 2+ content in Arabidopsis thaliana was as Figure 7 shown. The zinc contents of the three lines of Arabidopsis thaliana with overexpressed FtYPQ1 gene were all higher than those of wild-type Arabidopsis thaliana, confirming that the FtYPQ1 gene could transport Zn 2+ and increase zinc accumulation, improving the zinc tolerance of plants.
Claims
1. Vacuolar Amino Acid Transporter Gene FtYPQ1 , FtYPQ1 The encoded protein of the gene, containing FtYPQ1 The expression cassette or recombinant expression vector containing the gene, or FtYPQ1 The application of the recombinant host cell containing the gene in improving plant tolerance or promoting plant growth under zinc excess stress, including: Overexpress the FtYPQ1 gene in plants; the vacuolar amino acid transporter gene FtYPQ1 has a polynucleotide sequence as shown in (a) or (b): (a) The polynucleotide sequence shown in SEQ ID NO.1; (b) The polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2; The described FtYPQ1 The amino acid sequence of the encoded protein of the gene is shown as SEQ ID NO.2; The plant described above is tartary buckwheat or Arabidopsis thaliana.
2. Vacuolar Amino Acid Transporter Genes FtYPQ1 , FtYPQ1 the encoded proteins of the genes, expression cassettes containing FtYPQ1 the genes, or recombinant expression vectors, or recombinant host cells containing FtYPQ1 the genes in increasing the zinc content in plants under zinc excess stress, including: Overexpress the FtYPQ1 gene in plants; the vacuolar amino acid transporter gene FtYPQ1 has a polynucleotide sequence shown in (a) or (b): (a) The polynucleotide sequence shown in SEQ ID NO.1; (b) The polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2; The described FtYPQ1 The amino acid sequence of the encoded protein of the gene is as shown in SEQ ID NO.2; The plant described above is Arabidopsis thaliana.
3. The application according to claim 1 or 2, characterized in that Comprising: (1) Construct a recombinant plant expression vector containing the FtYPQ1 gene described in claim 1; (2) Transform the constructed recombinant plant expression vector into plant tissues or plant cells; (3) Overexpress the FtYPQ1 gene in plant tissues or cells.
4. A method for cultivating a plant variety with strong tolerance to zinc toxicity, characterized in that, Comprising: (1) Construct a recombinant plant expression vector containing the gene described in claim 1; (2) Transform the constructed recombinant plant expression vector into plant tissue or plant cells; (3) Overexpress the gene in plant tissue or cells; the plant is tartary buckwheat or Arabidopsis thaliana. FtYPQ1 (2) Transform the constructed recombinant plant expression vector into plant tissue or plant cells; (3) Overexpress the gene in plant tissue or cells; the plant is tartary buckwheat or Arabidopsis thaliana. FtYPQ1 gene in plant tissue or cells; the plant is tartary buckwheat or Arabidopsis thaliana.
5. A method for cultivating a plant variety with a high zinc content, characterized in that, Comprising: (1) Construct a recombinant plant expression vector containing the gene described in Claim 1; (2) Transform the constructed recombinant plant expression vector into plant tissues or plant cells; (3) Overexpress the gene in plant tissues or cells; The plant is Arabidopsis thaliana. FtYPQ1 gene; (2) Transform the constructed recombinant plant expression vector into plant tissues or plant cells; (3) Overexpress the FtYPQ1 gene in plant tissues or cells; The plant is Arabidopsis thaliana.
Citation Information
Patent Citations
FtACA13 gene derived from tartary buckwheat and expression vector and application of FtACA13 gene
CN119685356A