Application of pyrus betulaefolia E3 ubiquitin ligase PbXBAT31 in negative regulation of plant cold resistance and method thereof

Abstract

The invention discloses a low-temperature response gene PbXBAT31 separated and cloned from pyrus betulaefolia and an application of the gene in the aspect of reducing the cold resistance of plants, an overexpression strain is obtained by constructing an overexpression vector of the PbXBAT31 and introducing the gene into calluses of arabidopsis thaliana and pyrus betulaefolia by utilizing an agrobacterium-mediated transformation technology. A test result of a cold resistance function shows that the cloned PbXBAT31 gene has a remarkable capability of negatively regulating the cold resistance of the plant.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to an application of a pear E3 ubiquitin ligase PbXBAT31 in negatively regulating plant cold resistance and a method thereof. Background Art

[0002] Low temperature stress is one of the important environmental factors affecting plant growth and development. Depending on the temperature, low temperature stress can be divided into chilling injury (0–15 °C) and freezing injury (<0 °C) (Ding et al., 2019). Chilling injury reduces the fluidity of plant cell membranes, destroys protein stability, impairs enzyme function, and changes gene expression and protein synthesis (Shi et al., 2018). Freezing injury causes ice crystals to form in the extracellular cytoplasm, causing irreversible damage such as cell dehydration and membrane damage (Dowgert et al., 1984; Pearce et al., 2001). These two forms of stress not only lead to a decrease in plant yield and quality, but also limit the growth and distribution of plants in different geographical regions (Ding and Yang, 2022). However, most temperate plants have a certain ability to adapt to low temperatures, the so-called low temperature adaptation, and can show stronger antifreeze ability after experiencing non-freezing low temperatures. Many physiological and molecular changes occur during cold adaptation. These include transcriptional, translational, and metabolic changes that increase or decrease the levels of specific proteins, metabolites, and phytohormones, among others (Uemura et al., 1995; Thomashow et al., 1999).

[0003] Regulating the levels of key proteins that play important roles in plant growth and development is essential for maintaining homeostasis and protein turnover (Gagne et al., 2002; Wang et al., 2014; Kumar et al., 2019). Proteolysis or protein degradation is one of the important post-translational regulatory mechanisms in response to intracellular signals and environment (Gagne et al., 2002; Shu and Yang, 2017). Eukaryotes often utilize the ubiquitin-proteasome machinery to regulate protein load by degrading proteins in an irreversible manner (Gagne et al., 2002; Lechner et al., 2006; Brenner et al., 2017; Yumimoto et al., 2020). It is estimated that more than 80% of cellular proteins are degraded by the ubiquitin-proteasome system (UPS) (Wang et al., 2014). Ubiquitin ligases play an important role in regulating protein abundance, ensuring that stress responses are initiated only when needed, maintained at an appropriate intensity, and rapidly eliminated when no longer needed.

[0004] Most RING zinc finger proteins have E3 ubiquitin ligase activity (Joazeiro and Weissman, 2000). Compared with other eukaryotic organisms, plant genomes contain more RING protein encoding genes. For example, Arabidopsis, rice, and poplar contain 469, 378, and 399 RING-type E3 encoding genes, respectively, while humans and Saccharomyces cerevisiae contain only 300 and 47, respectively (Stone et al., 2005; Li et al., 2008; Du et al., 2009). RING zinc finger proteins have characteristic RING zinc finger domains. They bind to specific gene sequences, interact with a variety of proteins, participate in signal transduction and gene expression, and mediate growth, development, and environmental adaptation (An et al., 2017c; Sun et al., 2019; Han et al., 2020b). RING zinc finger proteins regulate photomorphogenesis, floral organ size, rosette leaf shape, root development, flowering time, fruit development, and symbiotic nodulation (Han et al., 2022). In addition, RING zinc finger proteins play an important role in abiotic stress tolerance (Lu et al., 2017), especially in drought, temperature, salt, and ROS stress (Kim et al., 2019).

[0005] In plants, RING zinc finger proteins respond to a variety of abiotic stresses through different pathways, such as the expression of stress-responsive genes, the ABA pathway, the ubiquitination pathway, ROS, and Ca2+ signals. In ABA signaling, multiple RING-type E3 ligases (such as SDIR1, AtAIRP1, RHA2a, and RHA2b) have been found to be positive regulators. Plants lacking these genes are insensitive to ABA, while transgenic overexpressing plants show high sensitivity to ABA and improved drought tolerance by enhancing ABA-induced stomatal closure (Zhang et al., 2007; Bu et al., 2009; Ryu et al., 2010; Li et al., 2011). For example, SDIR1, as a membrane-bound protein, is upregulated under salt and drought stress and functions upstream of ABA-responsive transcription factors (Zhang et al., 2007). The expression of AtAIRP is induced by ABA, low temperature, salt and drought stress, and this process is regulated by ABA-activated protein kinases (Ryu et al., 2010; Fujita et al., 2009). RHA2a and RHA2b have redundant and parallel functions with transcription factors such as ABI3 and ABI5 in ABA response (Bu et al., 2009; Li et al., 2011). RING-type E3 ligases also play an important role in cold signal transduction. ICE1 (CBF expression inducer 1) is a MYC-type transcription factor that controls the expression of cold-responsive transcription factor CBF3 / DREB1A and regulates the transcription of multiple cold-responsive genes (Chinnusamy et al., 2003). Low temperature not only increases the expression of ICE1, but also activates the protein, but the abundance of ICE1 decreases under cold-induced conditions, and this process is associated with UPS (Dong et al., 2006). Studies have found that the RING-type E3 ligase HOS1 is a key regulator of ICE1 ubiquitination and degradation. Overexpression of HOS1 reduces plant cold tolerance and downregulates the expression of ICE1 target genes (Xiong et al., 2002; Dong et al., 2006). Despite the variation in the RING domain of HOS1, it can still catalyze the ubiquitination of ICE1. Cold-induced HOS1 is transferred from the cytoplasm to the nucleus, promoting the degradation of ICE1 (Lee et al., 2001; Stone et al., 2005). This mechanism of ICE1 degradation at low temperatures suggests that the expression of cold-responsive genes is a rapid and transient response to cold stress (Chinnusamy et al., 2003).

[0006] Pear is one of the three major fruits in my country. As a perennial woody plant, pear often suffers from low temperature damage, causing huge losses to the pear industry. Therefore, cultivating varieties resistant to low temperature damage is one of the important goals of plant breeding. However, pears have the characteristics of complex genetic background, self-incompatibility, and long juvenile period, making it difficult to obtain new resistant varieties using traditional hybridization methods. Pyrus betulaeformis is a widely used rootstock in the pear industry. It has strong stress resistance and is an ideal material for discovering cold-resistant genes in woody plants. PbXBAT31 The specific mechanism of regulating plant response to low temperature stress is still unclear, so using genetic engineering technology, we cloned the E3 ubiquitin ligase from Pyrus betula PbXBAT31 Transferring genes into other plants is of great significance for studying their functions and has great application prospects. Summary of the invention

[0007] The present invention aims to solve the technical problem and overcomes the shortcomings of the prior art to provide an application of Pyrus betulata E3 ubiquitin ligase PbXBAT31 in negatively regulating plant cold resistance and a method thereof, wherein the E3 ubiquitin ligase PbXBAT31 is isolated and cloned from Pyrus betulata leaves. PbXBAT31 Gene and its application in plant cold resistance. After the gene was overexpressed in Arabidopsis thaliana and Solanum lycopersicum, the plants showed sensitivity to low temperature.

[0008] The object of the present invention is to provide an E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 The gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0009] The technical solution further optimized by the present invention is as follows: The E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0010] The present invention also provides a method for cloning the E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 The primer pair of the gene cDNA sequence includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse gene is shown as SEQ ID NO.4.

[0011] The E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 In the method for amplifying a gene, the E3 ubiquitin ligase PbXBAT31 The cloning conditions for the gene were pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 90 seconds for 35 cycles, followed by extension at 72°C for 10 minutes.

[0012] The invention provides an E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 Expression patterns of genes that positively respond to low temperature.

[0013] The present invention also provides an E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 The application of genes in reducing plant cold resistance.

[0014] In the above application, construct PbXBAT31 Gene overexpression vectors were used to transform the PbXBAT31 The gene was introduced into the plant, making the E3 ubiquitin ligase in Pyrus betula PbXBAT31 Overexpression in plants can obtain transgenic plants with significantly reduced plant cold resistance.

[0015] In the above application, the plant is an Arabidopsis seedling, a Pyrus oleifera callus or a Pyrus betulaeformis seedling.

[0016] The present invention PbXBAT31 The gene is an E3 ubiquitin ligase containing a RING domain, which was isolated and cloned from Pyrus betula rootstock. By constructing an overexpression vector and using Agrobacterium-mediated genetic transformation technology, the gene was introduced into Arabidopsis thaliana and Pyrus betula callus to achieve stable expression, obtain overexpression strains, and analyze their low temperature resistance function. The results showed that under low temperature stress, the overexpression strains showed poor growth, higher malondialdehyde content and lower antioxidant capacity compared with the wild type. The above results indicate that PbXBAT31 Genes have the function of reducing cold resistance in plants. The study revealed PbXBAT31 Genes can be used as negative regulatory targets in cold-resistance breeding, providing new theoretical support and genetic resources for improving plant cold-resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is a technical flow chart of the present invention.

[0018] Figure 2 For the present invention PbXBAT31 Schematic diagram of low temperature expression pattern analysis and subcellular localization. PbXBAT31 Figure 1 is the result of low-temperature expression pattern analysis, and B is a schematic diagram of subcellular localization.

[0019] Figure 3 For the present invention PbXBAT31 Positive identification results after gene transformation in Arabidopsis seedlings. PbXBAT31 A is the result of DNA identification of Arabidopsis thaliana, and B is the result of RNA identification of transgenic Arabidopsis thaliana.

[0020] Figure 4 For the present invention PbXBAT31The results of the cold resistance analysis of overexpressed Arabidopsis. PbXBAT31 Phenotype of Arabidopsis seedlings treated with low temperature of 0℃ for 3 days and after recovery for 5 days, B is the result of the measurement of conductivity after low temperature treatment, C is the result of the measurement of malondialdehyde (MDA) after low temperature treatment, D is the result of the measurement of hydrogen peroxide (H2O2) content after low temperature treatment, E is the result of the measurement of anti-superoxide anion (Anti-O2 - ) Activity determination results.

[0021] Figure 5 For the present invention PbXBAT31 The results of positive identification of gene-transformed eggplant and pear callus. PbXBAT31 Figure 2. Results of positive DNA identification of gene-transformed eggplant and pear callus; B is PbXBAT31 Figure 2. Identification results of positive RNA in gene-transformed eggplant and pear callus.

[0022] Figure 6 For the overexpression of the present invention PbXBAT31 The results of cold resistance analysis in eggplant and pear callus. In the figure, A is the overexpression after 14 days of low temperature treatment. PbXBAT31 Phenotypic diagram of callus in eggplant and pear; B is overexpression after low temperature treatment for 14 days PbXBAT31 Weight graph in eggplant pear callus; C is the MDA determination result graph under normal conditions and after low temperature treatment for 14 days, D is the proline determination result graph under normal conditions and after low temperature treatment for 14 days, E is the H2O2 determination result graph under normal conditions and after low temperature treatment for 14 days, F is the Anti-O2 determination result graph under normal conditions and after low temperature treatment for 14 days - Measurement result diagram. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0024] In the present invention, a pCAMBIA1300-35S-EGFP vector is constructed by a homologous recombination method. First, the pCAMBIA1300 vector is linearized by using restriction endonucleases BamHI and SalI. Subsequently, the EGFP gene is amplified by PCR using primers containing BamHI and SalI restriction sites, and an amplified product is obtained. The product is connected with the linearized pCAMBIA1300 vector by using a homologous recombinase. The connected product is transformed into competent Escherichia coli DH5α, and positive clones are obtained by kanamycin screening. Finally, the positive clones are verified by sequencing analysis, and it is confirmed that the construction is successful and the recombinant vector is obtained. Example 1

[0025] like Figure 1 Pyrus betulata E3 ubiquitin ligase PbXBAT31 The specific process of application in reducing plant cold resistance is as follows: (1) Pyrus betula PbXBAT31 Gene cloning and vector construction Using the cDNA of Pyrus betulae leaves as a template, PCR amplification was performed using the high-fidelity DNA polymerase from Novagen. The amplification system is shown in Table 1, and the amplification program is shown in Table 2. PbXBAT31 The primers used for full-length amplification were SEQ ID NO.3 and SEQ ID NO.4.

[0026] Table 1 PCR reaction procedure

[0027] Table 2 PCR reaction procedure

[0028] The PCR product was purified and recovered using a gel recovery kit (Vazyme, Nanjing, China). The recovered product was ligated to the linearized pCAMBIA1300-35S:GFP expression vector, which was maintained by the Horticulture and Plant Protection Laboratory of Yangzhou University. To achieve the fusion of the gene with GFP, the stop codon TAG was removed from the 3′ end of the gene. The pCAMBIA1300-35S:GFP vector plasmid was digested with XbaI and BamHI restriction endonucleases and purified and recovered after reacting at 37°C for 4 hours. Subsequently, the digested pCAMBIA1300-35S:GFP vector was ligated to the recovered PbXBAT31 The fragments were connected by recombinant ligase at 37°C for 30 minutes, and the ligation products were transferred into DH5α competent E. coli cells, plated and cultured, and the bacteria were propagated by shaking to screen and identify positive clones. After screening the positive clones, they were sent to Sangon Biotech for sequencing, and the sequencing results confirmed that PbXBAT31 The full-length cDNA sequence of the gene. The double restriction enzyme digestion system of the pCAMBIA1300-35S vector is shown in Table 3, and the recombination reaction system is shown in Table 4.

[0029] Table 3 Double enzyme digestion system

[0030] Table 4 Recombination system

[0031] The plasmids of Escherichia coli with correct sequencing results were extracted using a plasmid DNA minipreparation kit (Vazyme, Nanjing, China). PbXBAT31:GFP . The constructed sequence is correct PbXBAT31-GFP The recombinant vector was transformed into the Agrobacterium competent strain GV3101 purchased from Weidi Company for use.

[0032] (2) PbXBAT31 Analysis of low temperature expression patterns To verify PbXBAT31 To investigate the response of genes to low temperature stress, an analysis experiment of low temperature expression patterns was conducted. 45-day-old pear seedlings were placed in a 4°C environment and sampled at 0, 3, 6, 9, and 12 hours. RNA was extracted from samples at each time point and cDNA was generated by reverse transcription. Real-time quantitative PCR was used to detect the expression of genes in the gene expression profile using forward primer SEQ ID NO.5 and reverse primer SEQ ID NO.6. PbXBAT31 The expression level of , the internal reference primer is SEQ ID NO.7 and the reverse primer is SEQ ID NO.8, the reaction system is shown in Table 5, and the amplification system is shown in Table 6. The results are shown in Figure 2 As shown in A, with the extension of low temperature treatment time, PbXBAT31 The gene expression level gradually increased, indicating that the gene was responsive to low temperature stress.

[0033] Table 5 qRT-PCR reaction procedure

[0034] Table 6 qRT-PCR reaction system

[0035] (3) PbXBAT31 Subcellular localization analysis Healthy, mature, 4-6 week-old tobacco plant leaves were selected as materials for transient expression. The constructed PbXBAT31-GFP vector was transformed into the GV3101 strain using the Agrobacterium-mediated method. The transformed Agrobacterium was cultured to an OD600 value of approximately 0.5-0.8, and then the bacterial solution was injected into the tobacco leaf cells by the infiltration method. The injected tobacco plants were left to stand for 24 hours in a dark environment to promote the expression of the PbXBAT31-GFP fusion protein in tobacco leaf cells. After 48 hours of transient expression, the GFP signal in the leaf cells was observed using a confocal fluorescence microscope. The specific location of PbXBAT31 in the cell can be determined based on the fluorescence localization of GFP. Figure 2 B shows the results of bright field, mixed field, fluorescent field and DAPI field of the control GFP gene and the PbXBAT31 gene. The fluorescence of the control GFP gene is distributed in the cell nucleus and cell membrane, while the fluorescence of the PbXBAT31 gene only appears in the cell nucleus. The above results indicate that PbXBAT31 is localized in the cell nucleus.

[0036] (4) PbXBAT31 Obtaining Overexpressed Arabidopsis Stored from -80°C PbXBAT31 Agrobacterium was inoculated in liquid LB medium containing appropriate antibiotics (kanamycin, rifampicin) and cultured at 28°C for 16-24 hours with shaking until the OD600 value of the bacterial solution reached 0.5-1.0. The cultured Agrobacterium was collected and resuspended to an appropriate concentration (OD600 of about 0.8-1.0) in liquid MS medium (containing 50 g / L sucrose and 0.02% surfactant Silwet L-77, pH 5.8). Healthy Arabidopsis plants that have grown for about 30 days, whose primary inflorescences have pods and whose secondary inflorescences have grown to 2-10 cm and have a small number of flowers were selected. The fully opened inflorescences were cut off before dipping to increase the transformation rate. The prepared Arabidopsis plants were turned upside down so that the inflorescences were immersed in the bacterial solution. Vacuum treatment was performed at a negative pressure of 0.05 MPa for 5 minutes to allow Agrobacterium to penetrate into the inflorescence tissue. After dipping, the plants were taken out, placed flat in a dark place, and cultured for 24 hours away from light to promote transformation efficiency. After inoculation, the plants are transferred to normal light conditions and cultivated in the usual way, maintaining humidity until the seeds mature (T0 generation). After surface disinfection, the harvested T0 generation seeds are evenly sown on MS medium containing selective antibiotics (such as 50 mg / L hygromycin). The medium is cultured at 22°C and 16 hours of light, and plants with good growth and long root systems are selected after about a week. These seedlings are transplanted into sterilized nutrient soil and continued to be cultured to the T3 generation to confirm the stability of the transgene.

[0037] DNA from T0 generation Arabidopsis plants was extracted and PCR amplified using specific primers SEQ ID NO.3 (agaacacgggggactctaga ATGGGTCAAGGGTTGAGT) and SEQ ID NO.4 (gcccttgctcaccatggatccAGGTTTGTCAACCCATTC) to confirm the presence of the target gene. RNA from the plants was extracted and reverse transcribed into cDNA, and qRT-PCR was performed using specific primers SEQ ID NO.5 and SEQ ID NO.6 for verification. Internal reference primers SEQ ID NO.11 and SEQ ID NO.12 were used to compare the expression levels between the transgenic lines and the wild type, thereby determining the overexpression lines.

[0038] The transformed Arabidopsis seedlings were screened and identified for positive strains. The test results were as follows: Figure 3 Through DNA level analysis, 5 positive strains were successfully screened (see Figure 3A). qRT-PCR analysis was performed on these five positive strains to evaluate the expression levels of their genes. Based on the analysis results, two strains with higher expression levels (#1 and #2) were selected for subsequent cold resistance identification (see Figure 3 B).

[0039] (5) PbXBAT31 Identification of cold resistance in overexpressed Arabidopsis To verify PbXBAT31 To investigate the effect of cold resistance on Arabidopsis, Arabidopsis plants that were about 30 days old and in the same state were selected and treated with low temperature of 0°C. After 3 days, they were transferred to a normal environment and cultured for 5 days. Figure 4 As shown in A, after 3 days of low temperature treatment at 0℃, WT and PbXBAT31 The leaves of the overexpressing lines all showed wilting and water-soaked symptoms, and the degree of damage in the transgenic plants was significantly higher than that in the transgenic lines. After returning these plants to normal temperature for 5 days, the transgenic plants survived poorly, while most WT plants recovered to normal growth. Further physiological analysis showed that compared with WT, the conductivity and MDA content of the transgenic lines were significantly increased, reflecting that their cell membranes were more severely damaged (see Figure 4 In addition, after low temperature treatment, the H2O2 content in the transgenic lines was significantly higher, while Anti-O2 - The levels were significantly lower (see Figure 4 D and E). In summary, PbXBAT31 The overexpression strains showed weaker cold tolerance under low temperature stress, with strong cell membrane damage and weakened antioxidant defense capacity.

[0040] (6) PbXBAT31 Callus transformation and acquisition of overexpression callus of Pyrus oleraceus The cryopreserved Agrobacterium tumefaciens strain was streaked onto LB plates containing 50 mg / L kanamycin and 50 mg / L rifampicin and cultured in a 28°C incubator for 36-48 hours until colonies formed. Subsequently, the colonies were scraped and added to liquid MS medium (pH=5.8) until the OD600 value of the bacterial solution reached 0.8-1.0. 500 μl / L of acetosyringone was added as a surfactant to facilitate impregnation. Select the 15-day-old eggplant pear callus, invert it into the prepared Agrobacterium bacterial solution, and shake it evenly at 100 rpm for 15 minutes. After impregnation, gently dry the liquid on the surface of the callus and spread it on the co-culture medium. After two days of co-culture under dark culture conditions, the callus was transferred to the screening medium for culture. After about 30 days, the vigorously growing callus blocks were selected and moved to the new screening medium for continued culture.

[0041] DNA was extracted from PbXBAT31 transgenic callus using a DNA extraction kit and the operation was performed according to the kit instructions. The upstream primers of the designed gene and the downstream primers of the vector SEQ ID NO.9 and SEQ ID NO.10 were used for positive identification by PCR amplification. The reaction system and conditions are detailed in Tables 1 and 2. The sample with the expected band amplified was the positive transgenic line. Specific primers (SEQ ID NO.5 and SEQ ID NO.6) were used for qRT-PCR amplification. The internal reference primers were SEQID NO.7 and SEQ ID NO.8. The reaction conditions and system are detailed in Tables 3 and 4. The expression level difference between the transgenic line and the wild type was detected by fluorescent quantitative PCR to determine whether it was an overexpression transgenic line.

[0042] The transformed pear callus was screened and identified for positive strains. Figure 5 Through DNA level analysis, 5 positive strains were successfully screened (see Figure 5 A). qRT-PCR analysis was performed on these five positive strains to evaluate the expression levels of their genes. Based on the analysis results, two strains with higher expression levels (OE1 and OE2) were selected for subsequent cold resistance identification (see Figure 5 B).

[0043] (7) PbXBAT31 Identification of cold resistance of overexpressed eggplant pear callus To verify PbXBAT31 The function of pears was tested by selecting young and tender pear callus of the same state after 15 days of growth for cold resistance test. Figure 6 As shown in A, before low temperature treatment, there was no significant difference in the growth status between WT and overexpression callus (PbXBAT31-OE). However, after 14 days of cold stress treatment, the morphology of PbXBAT31-OE lines showed yellow-brown variation and the growth weight was lower than that of WT, especially in OE2 line (see Figure 6 Further analysis of physiological indicators showed that after low temperature treatment, the MDA content of the PbXBAT31-OE strain was significantly higher than that of the WT (see Figure 6 C), and at the same time, the proline content of the overexpression line was significantly reduced (see Figure 6 In addition, H2O2 accumulation increased in the PbXBAT31-OE line, and Anti-O2 - Significantly reduced activity (see Figure 6 E and F), indicating that its ability to scavenge ROS was significantly reduced. The above results show that PbXBAT31Overexpression of significantly reduced the cold resistance of transgenic pear callus under low temperature stress. This reduction in cold resistance may be related to the increase in membrane lipid peroxidation damage and the weakening of the antioxidant defense system, which further led to a significant decrease in the viability of callus under low temperature conditions.

[0044] In summary, the present invention provides a low temperature response gene isolated and cloned from Pyrus betulaeformis, and the application of the gene in reducing the cold resistance of plants. PbXBAT31 The overexpression vector was cloned and the gene was introduced into Arabidopsis thaliana and Pyrus callus using Agrobacterium-mediated transformation technology to obtain overexpression strains. PbXBAT31 The gene has the ability to significantly negatively regulate plant cold resistance.

[0045] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. An E3 ubiquitin ligase isolated from Pyrus betula PbXBAT31 A gene characterized by Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The E3 ubiquitin ligase isolated from Pyrus betulaeformis according to claim 1 PbXBAT31 The protein encoded by the gene is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. For cloning the E3 ubiquitin ligase isolated from Pyrus betulaeformis according to claim 1 PbXBAT31 A primer pair for a gene cDNA sequence, characterized in that: It comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.

4.

4. The E3 ubiquitin ligase isolated from Pyrus betulaeformis according to claim 3 PbXBAT31 A method for amplifying a gene, characterized in that The E3 ubiquitin ligase PbXBAT31 The cloning conditions for the gene were pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 90 seconds for 35 cycles, followed by extension at 72°C for 10 minutes.

5. The E3 ubiquitin ligase isolated from Pyrus betulaeformis as claimed in claim 1 PbXBAT31 Expression patterns of genes that positively respond to low temperature.

6. The E3 ubiquitin ligase isolated from Pyrus betulaeformis as claimed in claim 1 PbXBAT31 The application of genes in reducing plant cold resistance.

7. The use according to claim 6, characterized in that: Build PbXBAT31 Gene overexpression vectors were used to transform the PbXBAT31 The gene was introduced into the plant, making the E3 ubiquitin ligase in Pyrus betula PbXBAT31 Overexpression in plants can obtain transgenic plants with significantly reduced plant cold resistance.

8. The use according to claim 7, characterized in that: The plant is an Arabidopsis seedling, a Pyrus callus or a Pyrus betula seedling.

Images