Sorghum double-grain character related gene DG1 and application thereof

Abstract

The invention discloses a sorghum double-grain character related gene DG1 and application thereof. The invention provides application of any one of the following substances (A1)-(A3) in regulation and control of the grain number per ear of a plant, regulation and control of the yield of the plant and / or cultivation of a compound-grain plant: A1) protein DG1; a2) a nucleic acid molecule encoding a protein DG1; a3) a recombinant vector, an expression cassette or a recombinant bacterium containing a nucleic acid molecule encoding the protein DG1; the protein DG1 is a gene for regulating and controlling the grain number per ear of a plant, and the grain number per ear of the plant can be increased by overexpression of the protein DG1, so that the sorghum is re-granulated, and the high yield is realized.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a sorghum double-grain trait-related gene DG1 and an application thereof, and particularly relates to an application of the sorghum double-grain trait-related gene DG1 in improving sorghum ear grain number and yield. Background Art

[0002] Sorghum is one of the world's important dryland crops, widely used in brewing, food, feed and other industries. Sorghum is native to Africa and was introduced to China from India. It is mainly distributed in Asia, Africa and America. Sorghum has strong adaptability, is drought-resistant and waterlogged, and is extremely resistant to salinity and alkali, and can grow normally in harsh environments. In the context of global climate change, vigorously promoting sorghum planting is conducive to improving the utilization rate of saline-alkali land, ensuring the safety of food, feed, animal husbandry and energy without occupying staple food arable land. It has an important strategic position in maintaining crop diversity, efficient resource utilization and responding to climate change.

[0003] The multiple-grain trait is a common phenomenon in crops. It is manifested as two or more seeds in a spikelet during maturity, which is of great significance for increasing crop yields. The spikelet is the basic component unit of the inflorescence structure of Gramineae plants, and is composed of florets of varying numbers. Two florets initially develop in each spikelet of sorghum. The inferior florets are usually aborted, and only the superior florets develop normally to form one seed. If the florets develop abnormally, double or multiple grains will occur. As early as the 1930s, there were reports on the double-grain trait of sorghum, but the genetic basis and molecular mechanism of the double-grain trait of sorghum are still blank. Therefore, exploring the genes related to the double-grain trait of sorghum and modifying the multiple-grain trait of sorghum through genetic engineering are of great significance to increasing the yield of sorghum and other Gramineae crops and alleviating the food crisis. Summary of the invention

[0004] The technical problem solved by the invention is to provide genes related to mining the double-grain trait of sorghum and applications thereof.

[0005] In order to solve the above technical problems, the first aspect of the present invention provides the use of any one of the following substances A1)-A4) in regulating the number of grains per ear in plants, regulating plant yield and / or cultivating multiple grain plants:

[0006] A1) Protein DG1;

[0007] A2) a nucleic acid molecule encoding protein DG1;

[0008] A3) a recombinant vector, expression cassette or recombinant bacterium containing a nucleic acid molecule encoding protein DG1;

[0009] A4) the DNA molecule shown in positions 1 to 2576 of SEQ ID NO: 1;

[0010] The protein DG1 is as follows B1) or B2):

[0011] B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing;

[0012] B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

[0013] The protein mentioned above is derived from sorghum.

[0014] The one or more amino acid residues mentioned above may specifically be within ten amino acid residues.

[0015] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0016] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a Myc tag, a GST tag and / or a SUMO tag, etc.

[0017] In the above application, the nucleic acid molecule encoding protein DG1 is any one of the following DNA molecules C1)-C3):

[0018] C1) the coding region includes the DNA molecule shown in SEQ ID NO: 1 or positions 2577-4072 of SEQ ID NO: 1 in the sequence list;

[0019] C1) The coding region includes the DNA molecule shown in Sequence 2 in the sequence list;

[0020] C2) a DNA molecule that hybridizes with the DNA sequence defined in C1) under stringent conditions and encodes a protein with the same function;

[0021] C3) is a DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in C1) and encodes a protein with the same function.

[0022] In the above, the nucleic acid molecule may be a DNA or cDNA or CDS molecule.

[0023] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0024] The expression cassette containing the nucleic acid molecule encoding protein DG1 mentioned above refers to a DNA capable of expressing the protein in the above application in a host cell, and the DNA may include not only a promoter for initiating transcription of the protein encoding gene, but also a terminator for terminating transcription of the protein encoding gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters.

[0025] The recombinant vector containing the nucleic acid molecule encoding protein DG1 mentioned above is a recombinant expression vector containing the protein encoding gene expression cassette constructed using an existing plant expression vector.

[0026] In the embodiment of the present invention, the recombinant vector is pCAMBIA2300-Promoter-ORF1-Myc, specifically, the vector obtained by replacing the fragment between the MfeI and KpnI restriction sites of the pCambia2300-Myc vector with the fragment shown in Sequence 1.

[0027] The recombinant bacteria can specifically be yeast, bacteria, algae and fungi.

[0028] In the above application, the regulating the number of grains per ear of the plant is to increase the number of grains per ear of the plant;

[0029] Alternatively, the regulating plant yield is increasing plant yield.

[0030] In a second aspect, the present invention provides a method for cultivating transgenic plants with increased grain number per ear, which is as follows D1) or D2):

[0031] D1) The method comprises the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant;

[0032] D2) The method comprises the following steps: increasing the expression of a nucleic acid molecule encoding protein DG1 in a target plant to obtain a transgenic plant;

[0033] The transgenic plant has a greater number of grains per ear than the target plant;

[0034] The protein DG1 is as follows B1) or B2):

[0035] B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing;

[0036] B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

[0037] In a third aspect, the present invention provides a method for cultivating transgenic plants with increased yield, which is as follows D1) or D2):

[0038] D1) The method comprises the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant;

[0039] D2) The method comprises the following steps: increasing the expression of a nucleic acid molecule encoding protein DG1 in a target plant to obtain a transgenic plant;

[0040] The transgenic plant has a greater yield than the target plant;

[0041] The protein DG1 is as follows B1) or B2):

[0042] B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing;

[0043] B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

[0044] In the above, increasing yield is reflected in increasing the number of grains per ear per plant, the grain weight per plant and / or the yield in the plot.

[0045] In a fourth aspect, the present invention provides a method for preparing a multi-grain transgenic plant, which is as follows D1) or D2):

[0046] D1) The method comprises the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant;

[0047] D2) The method comprises the following steps: increasing the expression of a nucleic acid molecule encoding protein DG1 in a target plant to obtain a transgenic plant;

[0048] The transgenic plant is a multi-grain plant;

[0049] The protein DG1 is as follows B1) or B2):

[0050] B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing;

[0051] B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

[0052] The above-mentioned multiple grains are double grains.

[0053] In the above, increasing the content and / or activity of protein DG1 in the target plant or increasing the expression of the nucleic acid molecule encoding protein DG1 in the target plant can be achieved by expressing or changing the gene promoter, such as using the DNA molecule shown in positions 1-2576 of SEQ ID NO: 1 to drive the expression of CDS of DG1.

[0054] In the embodiment of the present invention, the method is specifically implemented by introducing a nucleic acid molecule encoding protein DG1 (sequence 1) into the target plant via a recombinant vector.

[0055] In a fifth aspect, the present invention provides a protein, which is the following B1) or B2):

[0056] B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing;

[0057] B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

[0058] In a sixth aspect, the present invention provides a nucleic acid molecule, an expression cassette, a recombinant vector or a recombinant bacterium encoding the protein described in the fifth aspect;

[0059] Or the DNA molecule shown in position 1-2576 of sequence 1.

[0060] In the above, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0061] The plant is a grass plant.

[0062] The plant is sorghum.

[0063] The experiments of the present invention prove that the protein DG1 was discovered, which is a gene regulating the number of grains per ear of plants. Overexpression of the protein DG1 can increase the number of grains per ear of plants, make sorghum grains multiple, and achieve high yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 This is the genetic analysis of the double-grain trait materials of sorghum, where A is the phenotype of the double-grain parent and the single-grain parent, and B is the statistics of the double-grain spikelet ratio of the parents and their hybrid F1 generation.

[0065] Figure 2 For the fine positioning of the DG1 locus.

[0066] Figure 3This is an analysis of gene sequences and expression levels in the candidate interval for the double-grain trait of sorghum. A is a schematic diagram of the chromosome structural variation at the DG1 locus, and B is an analysis of the PCR amplification results of the chromosome structural variation at the DG1 locus.

[0067] Figure 4 This is the expression analysis of five ORFs in the candidate interval of NIL-DG1 and NIL-dg1.

[0068] Figure 5 The figure shows the construction and phenotype of ORF1 overexpressing plants; A is a schematic diagram of the ORF1 overexpressing vector, B is the phenotype of two ORF1 overexpressing materials, C is the ORF1 expression level of the wild type and the two overexpressing materials, and D is the ratio of double-grain spikelets of the two ORF1 overexpressing materials.

[0069] Figure 6 The construction and phenotype of ORF5 knockout material plants, where A is the first target sequence of ORF5 gene and the knockout plant ORF5 ko Sequences, B is the amino acid sequence of ORF5 protein in wild type and knockout plants, C is the amino acid sequence of ORF5 in ORF5 knockout plants ko Spikelet phenotype.

[0070] Figure 7 The phenotypes of the near-isogenic lines NIL-DG1 and NIL-dg1, among which A is the phenotype of NIL-DG1 (left) and NIL-dg1 (right), B is the ratio of double-grain spikelets of NIL-DG1 and NIL-dg1, C is the comparison of the number of grains per ear of NIL-DG1 and NIL-dg1, D is the comparison of the thousand-grain weight of NIL-DG1 and NIL-dg1, E is the comparison of the grain weight of the whole ear of NIL-DG1 and NIL-dg1, and F is the comparison of the yield of NIL-DG1 and NIL-dg1. DETAILED DESCRIPTION

[0071] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0072] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0073] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0074] Example 1. Discovery and genetic analysis of sorghum double-grain trait materials

[0075] 1. Discovery and genetic analysis of sorghum double-grain trait materials

[0076] 1. Discovery and identification of sorghum double-grain trait materials

[0077] In order to identify sorghum double-grain trait materials, the present invention uses 571 sorghum germplasm resources introduced from the U.S. Department of Agriculture germplasm resource bank to carry out screening (each sorghum germplasm resource is recorded in the following documents: Morris GP, Ramu P, et al. (2013) Population genomic and genome-wide association studies of agroclimatic traits in sorghum. Proc Natl Acad Sci USA 110: 453-458; Burks PS, Kaiser CM, et al. (2015) Genome-wide association for sugar yield in sweets orghum. Crop Sci 55: 2138-2148. W197 is PI 660624 in the document, P126 is PI534167 in the document, P243 is PI 655993 in the document; P185 is PI in the document 597945; P210 is PI613536 in the literature). These materials were planted in Beijing (39.5°N, 116.4°E) in summer and in Ledong, Hainan (18.3°N, 108.8°E) in winter for seed propagation and phenotypic observation. The field planting conditions were 4-meter row length, 0.5-meter row spacing, 20-centimeter plant spacing, and about 15-20 plants per row. At the seed maturity stage, the spikelet phenotype of these 1577 sorghum materials was investigated. The results showed that the double-grain trait could be observed in some spikelets of 2 sorghum materials, numbered W197 (PI 660624) and P126 (PI 534167). The double-grain trait of these two materials was observed in both Beijing and Hainan, indicating that their double-grain trait is genetically stable and less affected by the environment.

[0078] 2. Genetic analysis of sorghum double-grain trait materials

[0079] In order to analyze the inheritance characteristics of the double-grain trait of W197 and P126, W197 and P126 were hybridized with single-grain trait sorghum materials P185, P210 and P243 to form F1. The F1 generation materials all showed double-grain traits, indicating that the double-grain phenotype of W197 and P126 was controlled by a dominant locus (Table 1). In order to further perform genetic analysis and gene mapping on the double-grain phenotype, the present invention selected W197 for subsequent analysis. The phenotypes of the double-grain trait material W197 and the single-grain trait materials P185, P210 and P243 are as follows: Figure 1 As shown in A, the ratios of double-grain spikelets in the three different hybrid combinations are similar to that of the parent W197, further proving that the locus controlling the double-grain trait of W197 is dominant ( Figure 1 B). The phenotypes of all individual ears in the F2 population obtained by self-pollination of the F1 plants of the three W197 hybrid combinations were further investigated. The results showed that in the three F2 populations, the ears showed separation of the double-grain trait and the single-grain trait. The chi-square test found that the phenotypic separation ratio of the two was 3:1 (Table 2), indicating that the double-grain trait of W197 is controlled by a single dominant locus, which was named Double-Grain 1 (DG1).

[0080] Table 1 shows the genetic analysis of double-grain sorghum materials

[0081]

[0082] Table 2 shows the genetic segregation from the W197 F2 population.

[0083] <![CDATA[F2 population]]> Double Grain Single grain <![CDATA[X 2 0.05 =3.84]]> W197×P185 302 90 0.77 W197×P210 236 76 0.04 W197×P243 135 36 1.22

[0084] 2. Cloning of the double-grain trait gene DG1 in sorghum

[0085] 1. Preliminary localization of the double-grain trait gene DG1 in sorghum

[0086] The present invention adopts the method of positional cloning to clone DG1. First, three F2 segregation populations were constructed by hybridization of W197 with P185, P210 and P243, which contained 875 individual plants in total. The population was preliminarily located using 53 pairs of polymorphic molecular markers between W197 and P210, and it was found that the marker S6-29 located at the end of chromosome 6 was closely linked to the double-grain phenotype. S6-29 also showed polymorphism between the parents W197 and P185, and W197 and P243. Therefore, the marker S6-29 was used to analyze the F2 (W197×P185) and F2 (W197×P243) populations, and it was also detected that the S6-29 marker was closely linked to the double-grain phenotype. We further designed and screened new polymorphic markers near S6-29, used these markers to detect three F2 populations, and finally located DG1 in the approximately 800 kb interval between markers SSR6-46 and SSR6-66 on chromosome 6 by screening recombinant strains ( Figure 2 ).

[0087] 2. Fine mapping of the double-grain trait gene DG1 in sorghum

[0088] In the F2 population of W197 and P243, two plants F2-445 and F2-465 with heterozygous genotypes at the DG1 locus were selected to plant into two F3 populations. The exchange plants of 1449 F3 populations were screened using SSR6-46 and SSR6-66 and 15 newly developed SNP markers between the two. A total of 4 types of 16 exchange plants were identified. Through the identification of these four exchange plants, the DG1 locus was narrowed down to an interval of about 140kb between the two markers SNP6-33 and SNP6-43. The same strategy was adopted to further screen a new exchange type in the F4 population composed of 737 plants, and the DG1 interval was narrowed down to an interval of 49.5kb between SNP6-46 and SNP6-43 on chromosome 6. According to the annotation information of the sorghum genome on the Phytozome website, this interval contains five coding genes, namely Sobic.006G254900, Sobic.006G255000, Sobic.006G255100, Sobic.006G255200 and Sobic.006G255300, which are hereinafter referred to as ORF1, ORF2, ORF3, ORF4 and ORF5, respectively ( Figure 2 and Figure 3 A).

[0089] 3. Analysis of gene sequences and expression levels in the candidate interval of double-grain trait in sorghum

[0090] In order to identify the gene controlling the double-grain trait, the present invention sequenced the coding regions and promoter regions of the five genes in the double-grain parent W197 and the single-grain parents P185, P210 and P243. The results showed that there was no difference in the sequences of the coding regions of the five genes between the parents, and there was no obvious difference in the promoter regions of ORF2, ORF3 and ORF4 between the parents. According to the reference genome information, primers F1 / R1 and F2 / R2 were designed for amplification of the ORF1 and ORF5 promoter regions of P243 (Table 3). In P243, F1 / R1 and F2 / R2 were used to amplify a band pattern consistent with the reference genome, while in W197, only F1 / F2 and R1 / R2 could amplify bands. Combined with the sequencing results, it was proved that the promoter regions of ORF1 and ORF5 in W197 had inversions within the chromosome arms, and the inversion interval was 35.7kb ( Figure 3 A and Figure 3 B) The same result was obtained in another double-grain sorghum P126 controlled by a dominant locus, suggesting that the double-grain trait of P126 is also caused by the variation of the DG1 locus.

[0091] Table 3 shows the PCR primer sequences

[0092] Primer Sequence(5'-3') F1 ATACCAGCATTAAGCAGCCTGAA R1 GCAGCCGTAGTAGAACTCCTTG F2 TCTACGTACCACAGGACGCAG R2 CCTGCGTTTCTCCCATGAGC

[0093] Inversion in the chromosome arm of the promoter region of ORF1 and ORF5 in the W197 candidate interval leads to variation in the promoter sequences of ORF1 and ORF5, and it is speculated that this may lead to changes in gene expression. The present invention constructs a pair of near-isogenic lines NIL-DG1 and NIL-dg1, and the specific construction process is: continuously select single plants with a heterozygous genotype in the target interval (sequence 1) from the hybrid offspring population of W197 and P243 (the target interval in one homologous chromosome contains the DG1 gene with a mutant promoter shown in sequence 1, and the target interval in another homologous chromosome contains the DG1 gene with a wild-type promoter shown in sequence 4), self-pollinate to the F6 generation, select single plants with a heterozygous genotype in the target interval, continue self-pollinating to the F7 generation, and select single plants with homozygous wild-type promoters in the target interval (sequence 1). The plants of the homozygous wild type (the target intervals in the two homologous chromosomes both contain the DG1 gene with the wild-type promoter shown in sequence 4) and the homozygous mutant type (the target intervals in the two homologous chromosomes both contain the DG1 gene with the mutant promoter shown in sequence 1) are taken as a pair of near-isogenic line materials. The homozygous wild-type near-isogenic line material in the pair of near-isogenic line materials is a single seed, recorded as NIL-DG1, and the homozygous mutant near-isogenic line material is a double seed, recorded as NIL-dg1, and the expression level of DG1 (ORF1) in NIL-dg1 is higher than that in NIL-DG1.

[0094] The expression levels of five candidate genes were detected using this pair of near-isogenic line materials. The results showed that compared with NIL-DG1, which exhibited a single-grain phenotype, the expression level of ORF1 in NIL-dg1, which exhibited a double-grain phenotype, was significantly upregulated, the expression level of ORF5 was significantly reduced, and the expression levels of ORF2, ORF3, and ORF4 were not significantly different ( Figure 4 ). This result indicates that the variation in the promoter regions of ORF1 and ORF5 affects the expression levels of these two genes at the same time, so ORF1 and ORF5 are identified as candidate genes controlling the DG1 locus of the double-grain trait of W197.

[0095] The full-length sequence of ORF1 and its promoter is shown in Sequence 1, wherein positions 1-2576 are the promoter region and positions 2577-4072 are the gene coding region. The CDS sequence of ORF1 is shown in Sequence 2, encoding a protein containing 327 amino acids, wherein the amino acid sequence from positions 33-98 is the homeodomain, and the protein sequence is shown in Sequence 3.

[0096] The amino acid sequence encoded by the ORF5 gene is Figure 6 B is shown for WT.

[0097] Example 2: Functional verification of the sorghum double-grain trait gene DG1

[0098] In order to verify whether the up-regulation of ORF1 expression or the down-regulation of ORF5 expression leads to the double-grain trait of W197, the present invention used sorghum Wheatland (gift from the U.S. germplasm resource bank USDA, Population genomic and genome-wide association studies of agroclimatic traits in sorghum. (2013). Proceedings of the National Academy of Science of the United States of America 110: 453-458., hereinafter also referred to as wild-type sorghum) as the recipient material to carry out ORF1 overexpression and ORF5 gene knockout experiments.

[0099] 1. Functional verification of sorghum ORF1 gene

[0100] 1) Construction of sorghum ORF1 gene overexpression vector

[0101] The overexpression vector pCambia2300-Myc is preserved by this laboratory (i.e., a recombinant vector with Ubi promoter and OCS terminator added to the pCAMBIA2300 commercial vector and a Myc tag sequence, which can be obtained by the public from the applicant to repeat the present invention. Literature: Xie P, Tang S, et al. Natural variation in Glume Coverage1 causes naked grains in sorghum. Nat Commun. 2022 Feb 25; 13(1): 1068.). First, the vector pCambia2300-Myc was linearized by restriction endonucleases MfeI and KpnI. Then, using W197 DNA as a template, primers carrying a linker were used to amplify the ORF1 promoter and the full length of the gene (the nucleotide sequence is shown in Sequence 1 in the sequence table) to obtain the target fragment with a linker. Finally, the obtained target fragment with a linker (promoter + ORF1 gene fragment) and the obtained linearized vector were seamlessly cloned and connected using the seamless cloning kit pEASY-Uni Seamless Cloning and Assembly Kit (CU101-01) to obtain the recombinant product.

[0102] The seamless cloning and connection system is: 2×Assembly mix 5μL, add appropriate amount of linearized vector and DNA fragment according to the recovery concentration and fragment length, and fill to 10μL with deionized water.

[0103] Seamless cloning and ligation reaction conditions: 50°C for 20 min.

[0104] After the reaction, the centrifuge tube was placed on ice to cool for a few seconds, and then the recombinant product was transformed into E. coli XL1-Blue, the plasmid was extracted, and the positive recombinant plasmid was determined by restriction digestion (MfeI and KpnI digestion, and the 4074 bp obtained was a positive plasmid) and named pCAMBIA2300-Promoter-ORF1-Myc ( Figure 5 A) and sent to Ruibo Company for further sequencing verification.

[0105] pCAMBIA2300-Promoter-ORF1-Myc is a vector obtained by replacing the fragment shown in Sequence 1 with the fragment between the MfeI and KpnI restriction sites of the pCambia2300-Myc vector.

[0106] 2) Obtaining ORF1 gene overexpression plants

[0107] Take 1 μg of the prepared recombinant vector plasmid pCAMBIA2300-Promoter-ORF1-Myc to transform the competent cells of Agrobacterium EHA105, and the positive bacteria obtained by PCR identification are named recombinant Agrobacterium EHA105 / pCAMBIA2300-Promoter-ORF1-Myc. The recombinant Agrobacterium is transferred into the recipient material Wheatland (hereinafter referred to as wild-type sorghum) of sorghum by Agrobacterium-mediated method, and T0 transgenic plants are screened on a medium containing kanamycin resistance. The genetic transformation method of sorghum is as follows:

[0108] (1) Preparation of sorghum receptor material:

[0109] Wheatland sorghum plants were planted in a greenhouse. When the plants reached the 15th day of flowering, the ears were cut off and the immature embryos in the grains were squeezed out as much as possible in a sterile clean bench and evenly placed on callus medium for callus culture.

[0110] (2) Preparation of infection solution:

[0111] The recombinant Agrobacterium EHA105 / pCAMBIA2300-Promoter-ORF1-Myc stored at -80°C was streaked in YEP solid medium supplemented with Kan. The grown single colony was inoculated in 10mL YEP liquid medium (containing Kan) for one activation (28°C, 220rpm shaking overnight). The activated bacterial solution was inoculated in 80mL YEP liquid medium (containing Kan) at a ratio of 1:1000, and cultured at 28°C, 220rpm shaking until OD 600nm was 0.8-1.0 to obtain Agrobacterium bacterial solution.

[0112] (3) Infection process:

[0113] The Agrobacterium bacterial solution obtained in (2) that reaches the desired OD value is transferred to a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 min to enrich the bacteria. Then, the bacteria are fully resuspended with a resuspension buffer to obtain a resuspended infection solution, and the callus obtained in (1) is added to the resuspended infection solution for infection and transformation. The infected callus is transferred to a differentiation and regeneration medium, and after regeneration and emergence, it is transferred to a rooting medium (containing Kan) for rooting culture. If the medium turns brown, the rooting medium needs to be transferred multiple times.

[0114] (4) Obtaining positive seeds

[0115] Transplant the T0 generation sorghum transformed seedlings with a plant height of about 5-7 cm and good root growth into the soil, cultivate them in a greenhouse and maintain a certain humidity to ensure the survival rate of the regenerated seedlings.

[0116] The T0 generation transgenic plants were obtained.

[0117] RNA from panicles of T0 transgenic plants was extracted and RT-PCR amplified using ORF1-qPCR-F and ORF1-qPCR-R primers, with sorghum SbEIF gene as an internal reference (primers Sb-EIF-F and Sb-EIF-R) and wild-type sorghum as a control.

[0118] The nucleotide sequences of the primers are as follows:

[0119] ORF1-qPCR-F: 5'-AGTGCCACTTCCATTGGGAT-3';

[0120] ORF1-qPCR-R: 5'-CCTCTCACATGGTCCCTGC-3';

[0121] Sb-EIF-F: 5'-CAACTTTGTCACCCGCGATGA-3';

[0122] Sb-EIF-R: 5'-TCCAGAAACCTTAGCAGCCCA-3'.

[0123] Results Compared with wild-type sorghum, the ORF1 gene expression level of the positive T0 transgenic plants was increased. The positive T0 transgenic plants were named T0 ORF1 overexpression plants. Two T0 ORF1 overexpression plant lines were retained. OE-1 and ORF1 OE-2 For subsequent experiments.

[0124] The T0 generation ORF1 overexpressing plant line ORF1 OE-1 and ORF1 OE-2 The T2 generation ORF1 overexpression plant line ORF1 was cultivated OE-1 and ORF1 OE-2 Homozygous strains were used for subsequent analysis.

[0125] 3) Phenotypic analysis of ORF1 overexpressing plants

[0126] Wild-type sorghum, T2 generation ORF1 overexpressing plant line ORF1 OE-1 and T2 generation ORF1 overexpressing plant lines ORF1 OE-2 The seeds are sown.

[0127] (1) Fluorescence quantitative PCR detection of young spikelets

[0128] During the panicle development period, wild-type sorghum and T2 generation ORF1 overexpressing plant lines were selected. OE-1 and T2 generation ORF1 overexpressing plant lines ORF1OE-2 Fluorescence quantitative PCR was performed on 1-2 cm young panicles of plants. RT-PCR amplification was performed using ORF1-qPCR-F and ORF1-qPCR-R primers, with sorghum SbEIF gene as an internal reference.

[0129] The nucleotide sequences of the primers are as follows:

[0130] ORF1-qPCR-F: 5'-AGTGCCACTTCCATTGGGAT-3';

[0131] ORF1-qPCR-R: 5'-CCTCTCACATGGTCCCTGC-3';

[0132] SbEIF-F: 5'-CAACTTTGTCACCCGCGATGA-3';

[0133] SbEIF-R: 5'-TCCAGAAACCTTAGCAGCCCA-3'.

[0134] The results showed that compared with wild-type sorghum Wheatland (WT), ORF1 OE-1 and ORF1 OE-2 The expression level of ORF1 gene in plants was about 10 times higher ( Figure 5 C).

[0135] (2) Ear-kernel phenotype

[0136] The phenotypes were observed at seed maturity stage.

[0137] The results showed that compared with the single-grain phenotype of wild-type sorghum Wheatland, ORF1 OE-1 and ORF1 OE-2 The panicles of the plants all showed a double-grain phenotype ( Figure 5 B).

[0138] The percentage of double-seed spikelets in one ear to the total number of spikelets was counted, and the results showed that ORF1 OE-1 The proportion of double-seed spikelets was about 34.2%, and ORF1 OE-2 The proportion of double spikelets is about 29.5% ( Figure 5 D).

[0139] This result proves that increasing the expression level of ORF1 in single-grain sorghum can indeed produce a two-grain spikelet phenotype. Therefore, ORF1 (Sobic.006G254900) is a sorghum double-grain spikelet regulatory gene.

[0140] 2. Functional verification of sorghum ORF5 gene

[0141] 1) Construction of sorghum ORF5 gene knockout vector

[0142] The plant gene editing vector pYLCRISPR / Cas9 Pubi-B and the intermediate vectors pYLsgRNA-OsU3 and pYLsgRNA-OsU6a were kindly donated by Professor Liu Yaoguang of South China Agricultural University (Related literature: Ma X, Zhang Q, Zhu Q, et al.. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015Aug;8(8):1274-84.doi:10.1016 / j.molp.2015.04.007.Epub 2015Apr 24.PMID:25917172.). The specific method refers to the operation steps in the literature, and the experimental scheme is as follows:

[0143] (1) Small-scale plasmid extraction: Streak the bacterial strain onto an LB plate containing the corresponding antibiotics. After colonies have grown, pick out a single clone and shake culture it in LB liquid containing the corresponding antibiotics to extract the plasmid.

[0144] (2) Preparation of target adapters: Add sterile distilled water to the designed target adapter primers to 100 μM. Then, add 0.5 μL of forward and reverse primers to 49 μL of sterile distilled water, heat at 90°C for 30 seconds, and cool to room temperature to obtain the target adapters ORF5-KO-Target1 (obtained by annealing ORF5-KO-F1 / R1) and ORF5-KO-Target2 (obtained by annealing ORF5-KO-F2 / R2).

[0145] The target primers are shown in Table 4, and the target positions are shown in Figure 6 As shown in A.

[0146] Table 4 shows the primers for ORF5 gene knockout target site adapter

[0147]

[0148] (3) Enzyme digestion of sgRNA vector: Take 2 μg of pYLgRNA-OsU3 and pYLgRNA-OsU6a plasmids, add 20 U of BsaI-HF, prepare 50 μL system, digest for 20 min, and store at -20°C to obtain enzyme-digested plasmids.

[0149] (4) Connection of sgRNA expression cassette: Take the restriction enzyme-cut plasmid and connect it with the corresponding target linker (ORF5-KO-Target1 connects to pYLgRNA-OsU3, ORF5-KO-Target2 connects to pYLgRNA-OsU6a), and obtain the connection products sgRNA1 expression cassette connection product and sgRNA2 expression cassette connection product. The reaction system is: 20ng of restriction enzyme-cut plasmid, 0.5μL target linker, 0.2μL T4 DNA ligase and 1μL 10×T4 DNA ligase Buffer, add deionized water to 10μL, mix well and connect at 25℃ for 15min.

[0150] (5) PCR amplification of sgRNA expression cassette: divided into two rounds of amplification, the first round of amplification: the sgRNA1 expression cassette ligation product and the sgRNA2 expression cassette ligation product obtained in step (4) were subjected to the first round of PCR amplification, and the obtained amplification products were named product 1 and product 2, respectively. In the reaction system, 0.5 μL of ligation product, 0.2 μM primers UF and gRNA-R, 2×PCR buffer 7.5 μL, 2mM dNTPs 3 μL, KOD FX Neo 0.3 μL, and deionized water was added to 15 μL. The PCR reaction program was: 94°C 10 s, 60°C 15 s, 68°C 20 s, 28 cycles. Second round of amplification: Using B1' / B2 as primers, the second round of PCR amplification was performed on product 1, and the product was named sgRNA1 expression cassette (containing ORF5-KO-Target1); using B2' / BL as primers, the second round of PCR amplification was performed on product 2, and the product was named sgRNA2 expression cassette (containing ORF5-KO-Target2).

[0151] PCR amplification was performed using KOD FX Neo high-fidelity enzyme, and the reaction system was the same as above. The reaction program was: 95°C for 10 s, 58°C for 15 s, 68°C for 20 s, and 20 cycles.

[0152] The nucleotide sequences of the primers are as follows:

[0153] UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0154] gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0155] B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3';

[0156] B2: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3';

[0157] B2': 5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3';

[0158] BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3'.

[0159] (6) Connect the sgRNA1 expression cassette and the sgRNA2 expression cassette to the pYLCRISPR / Cas9 Pubi-B vector: Use the cutting and ligation method, and the reaction system is: in a 15μL reaction system, add 15ng of sgRNA1 expression cassette and sgRNA2 expression cassette, 80ng of pYLCRISPR / Cas9 Pubi-B plasmid, 1.5μL of 10×Cut Smart Buffer, 1.5μL of 10mM ATP, 0.2μL of BsaI-HF, and 0.2μL of T4 DNA ligase. The reaction program is: 37℃ 5min, 10℃ 5min, 20℃5min, 15 cycles; 37℃ 5min.

[0160] (7) The ligation product was transformed into E. coli and cultured upside down on a LB solid medium plate containing kanamycin. A single colony on the plate was picked and cultured overnight in a LB liquid medium containing kanamycin. PCR verification was performed using SP1 and SP2 as primers.

[0161] Wherein, the nucleotide sequences of primers SP1 and SP2 are as follows:

[0162] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0163] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3'.

[0164] The reaction system is: add 2×Taq mix 10μl, 10μM SP1, 10μM SP2 0.4μl each, and 2μl bacterial solution to a 20μl reaction system. Amplification program: 94℃5min; 94℃30s, 57℃30s, 72℃45s, 30 cycles; 72℃5min, 4℃ storage. Use agarose gel electrophoresis to identify the plasmid extracted from the bacterial solution with the target band of 1.2kb, and the correct one identified by sequencing is pYLCRISPR / Cas9Pubi-B-ORF5.

[0165] 2) Obtaining sorghum ORF5 gene knockout plants

[0166] The successfully constructed plasmid was transformed into Agrobacterium competent cells EHA105, and sorghum Wheatland immature embryos were genetically transformed using the same transformation process as above. T0 transgenic plants were screened on a medium containing glyphosate resistance.

[0167] The genomic DNA of the T0 transgenic seedlings was extracted and identified using SP1 and SP2 as primers. The plants that amplified the target fragment of 1.2 kb were the T0 transgenic positive plants. The ORF5 gene sequence amplification primers ORF5-F and ORF5-R were used to PCR amplify and sequence the DNA of the T0 transgenic positive plants to detect whether the target site was edited.

[0168] The nucleotide sequences of the primers are as follows:

[0169] SP1: 5'-CCCGACATAGATGCAATAACTTC-3';

[0170] SP2: 5'-GCGCGGTGTCATCTATGTTACT-3';

[0171] ORF5-F: 5'-GGCGTGGTAGAGTTCTCAGC-3';

[0172] ORF5-R: 5'-CATGTTCATTCACCTTGGGAC-3'.

[0173] The PCR reaction system is as follows: in a 50 μl reaction system, add KOD PCR Master mix 25μl, 10μM ORF5-F, 1.5μl ORF5-R, 1μl DNA. Reaction procedure: 94℃3min; 98℃10s, 54℃15s, 68℃45s, 30 cycles; 68℃5min, 4℃ storage.

[0174] T0 positive plants were self-pollinated to obtain T1 generation seeds, and T1 generation transgenic plants were planted. Primers ORF5-F and ORF5-R were used for PCR amplification and sequencing. Plants with homozygous mutations in the target site ORF5 were selected. KO In the recipient material Wheatland, ORF5 encodes a protein of 945 amino acids. KO It terminates prematurely near the first target site and is predicted to encode a protein of 55 amino acids ( Figure 6 B).

[0175] The nucleotide sequences of the primers are as follows:

[0176] ORF5-F: 5'-GGCGTGGTAGAGTTCTCAGC-3';

[0177] ORF5-R: 5'-CATGTTCATTCACCTTGGGAC-3'.

[0178] 3) Phenotypic analysis of sorghum ORF5 gene knockout plants

[0179] Observation of wild-type sorghum Wheatland, T1 generation ORF5 at seed maturity KO The spikelet phenotype of the plant was detected by ORF5 KO All spikelets of the plant showed single-grain characteristics, which was consistent with the wild-type recipient material ( Figure 6 C) This result demonstrates that ORF5 is not involved in the development of two-seed spikelets.

[0180] The above analysis proves that ORF1 is the double-grain trait controlling gene DG1 in sorghum. In W197, the chromosome structural variation leads to changes in the DG1 promoter region, which in turn leads to increased DG1 expression and the appearance of a double-grain phenotype.

[0181] In W197, the DG1 promoter and full gene length are shown in Sequence 1, where positions 1-2576 are the promoter region and positions 2577-4072 are the gene coding region. The DG1 CDS sequence is shown in Sequence 2, encoding a protein containing 327 amino acids, named DG1, where the amino acid sequence from positions 33-98 is the homeodomain, and the protein sequence is shown in Sequence 3.

[0182] Example 3: Application of the sorghum double-grain trait gene DG1 in increasing sorghum grain number and yield

[0183] Double-grain sorghum forms two seeds in a single spikelet, which has the potential to increase the number of grains per spike and yield. The present invention uses near-isogenic line materials NIL-DG1 and NIL-dg1 to analyze the effect of DG1 variation on yield-related traits.

[0184] The statistical results showed that about 56.7% of the spikelets in NIL-dg1 showed double-grain characteristics ( Figure 7 A and 7B). Compared with NIL-DG1, NIL-dg1 had significantly higher grain number per ear and lower thousand-grain weight, which ultimately resulted in higher yield per plant and plot yield ( Figure 7 C-7F).

[0185] Yield statistics showed that DG1, which controls the double-grain trait, is a key gene for increasing the number of grains per ear and yield, and has the potential to increase sorghum yield.

[0186] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of any one of the following substances A1)-A4) in regulating the number of grains per ear in plants, regulating plant yield and / or cultivating multi-grain plants: A1) Protein DG1; A2) a nucleic acid molecule encoding protein DG1; A3) a recombinant vector, expression cassette or recombinant bacterium containing a nucleic acid molecule encoding protein DG1; A4) the DNA molecule shown in positions 1 to 2576 of SEQ ID NO: 1; The protein DG1 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing; B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

2. The use according to claim 1, characterized in that: The nucleic acid molecule encoding protein DG1 is a DNA molecule of any one of the following C1)-C3): C1) the coding region includes the DNA molecule shown in SEQ ID NO: 1 or positions 2577-4072 of SEQ ID NO: 1 in the sequence list; C1) The coding region includes the DNA molecule shown in Sequence 2 in the sequence list; C2) a DNA molecule that hybridizes with the DNA sequence defined in C1) under stringent conditions and encodes a protein with the same function; C3) is a DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in C1) and encodes a protein with the same function.

3. The use according to claim 1 or 2, characterized in that: The regulating the number of grains per ear of the plant is to increase the number of grains per ear of the plant; Alternatively, the regulating plant yield is increasing plant yield.

4. A method for cultivating transgenic plants with increased grain number per ear, comprising the following steps D1) or D2): D1) The method comprises the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: increasing the expression of a nucleic acid molecule encoding protein DG1 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of grains per ear than the target plant; The protein DG1 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing; B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

5. A method for cultivating transgenic plants with increased yield, comprising the following D1) or D2): D1) The method comprises the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: increasing the expression of a nucleic acid molecule encoding protein DG1 in a target plant to obtain a transgenic plant; The transgenic plant has a greater yield than the target plant; The protein DG1 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing; B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

6. A method for preparing a multi-grain transgenic plant, comprising the following D1) or D2): D1) The method comprises the following steps: increasing the content and / or activity of protein DG1 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: increasing the expression of a nucleic acid molecule encoding protein DG1 in a target plant to obtain a transgenic plant; The transgenic plant is a multi-grain plant; The protein DG1 is as follows B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing; B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

7. A protein, which is the following B1) or B2): B1) a protein consisting of the amino acid sequence shown in Sequence 3 in the sequence listing; B2) A protein derived from B1) with the same function as the amino acid sequence shown in Sequence 3 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

8. A nucleic acid molecule, expression cassette, recombinant vector or recombinant bacterium encoding the protein of claim 7; Or the DNA molecule shown in position 1-2576 of sequence 1.

Images