Application of soybean GmGIF5 gene in regulation and control of sizes of plant organs

Abstract

The invention relates to application of a soybean GmGIF5 gene in regulation and control of the size of a plant organ, belongs to the technical field of genetic engineering, and analyzes potential functions of GmGIF5 by overexpressing the soybean GmGIF5 gene in arabidopsis thaliana. Heterologous expression of GmGIF5 in arabidopsis thaliana leads to increase of leaf size, plant height, stem width and seed size. The enlarged organs in the GmGIF5 overexpression system are mainly derived from the increase of the cell size instead of the expansion of the cell number, so that a new target is provided for improving the soybean yield through genetic engineering.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to soybean GmGIF5 The application of genes in regulating plant organ size. Background Art

[0002] Soybean ( Glycine max L.) is a crop with important applications worldwide. Soybean was first domesticated in China, with a history of more than 5,000 years, and its cultivation range has rapidly expanded to the United States, Brazil, Argentina, and India. Soybean is rich in oil and protein, providing humans with a nutritious food source. At the same time, soybean is used as a green manure to maintain soil fertility and feed livestock. With the growth of population, the demand for food increases, which further requires the optimization of germplasm resources. Given the important role of soybean in social development, rapidly increasing soybean yields through biotechnology methods is an effective way to meet the growing demand. Therefore, understanding the molecular mechanisms that control soybean growth and development is crucial to improving soybean yields.

[0003] Transcription factors (TFs) play a key role in plant genetic engineering and regulate multiple aspects of plant growth and development. Recent studies have also shown that some important transcription factors also regulate yield. GmNF-YC9 can activate the expression of GmSQE1 under drought and salt stress conditions in soybean, ensuring high content of sterol compounds, thereby improving grain filling and yield per plant. MYB is one of the largest transcription factor families in plants, and its main function is to regulate plant metabolism. Stable overexpression of GmMYB14 can regulate plant morphology and achieve high yield by increasing the number of pods, seeds, and seed weight per plant. The Dof transcription factor family increases soybean yield by affecting related biosynthetic pathways. Overexpression of GmDof4 and GmDof11 increased total fatty acid content and seed size in transgenic Arabidopsis. The bHLH transcription factor TabHLH489 in wheat was identified as a factor regulating grain length and weight. Its overexpression led to reduced grain length and weight because genes related to cell elongation (TaEXPA4 and TaEXPA4) were downregulated in the early stages of seed development. In addition, the role of growth regulatory factors (GRFs) and GRF interacting factor (GIF) modules in regulating plant cell proliferation and leaf development has attracted increasing research attention. Oryza sativa ), OsGRF4 interacts with OsGIF1 to regulate grain size, while OsGRF6 and OsGRF10 interact with OsGIF1 to activate the expression of OsJMJ706 and OsCR4, thereby regulating spikelet development. Sedum plumbizincicola), overexpression of SpGRF4-SpGIF1 increased transgenic efficiency and accelerated the process of shoot regeneration. However, this effect was accompanied by tissue enlargement and abnormal growth. To date, most studies on this module have focused on the role of GRF, while GIF was considered a secondary factor.

[0004] The GIF family is a family of plant-specific transcription factors found in seed plants. As a known interacting protein of GRF, GIF was first identified in Arabidopsis and can promote the growth of leaves and aboveground organs. Overexpression of AtGIF1 can promote leaf development by increasing cell number, while it can inhibit cell differentiation during the cell proliferation stage. OsGIF1 positively regulates the size of multiple organs, including leaves, stems, and grains. Overexpression of PbGIF1 promoted cell proliferation and fruit size in transgenic tomatoes and pears. According to these previous studies, the GIF family plays a vital role in the cell proliferation process. However, the functions of GIF family genes in soybean are still unclear. Summary of the invention

[0005] In view of the above problems, the present invention aims to provide soybean GmGIF5 The invention discloses a method for regulating plant organ size by heterologous expression in Arabidopsis thaliana. GmGIF5 , analyzed its role in providing plant organ size, leading to increases in leaf size, plant height, stem width, and seed size, which provides a new target for improving soybean yield through genetic engineering.

[0006] In order to achieve the above object, the specific scheme adopted by the present invention is: In a first aspect, the present invention provides soybean GmGIF5 The application of genes in regulating plant organ size.

[0007] Furthermore, the GmGIF5 The amino acid sequence encoded by the gene is shown in SEQ ID NO: 1, and the cDNA sequence is shown in SEQ ID NO: 2.

[0008] The plant is soybean or Arabidopsis thaliana.

[0009] The regulation of plant organ size refers to heterologous expression in Arabidopsis GmGIF5 Resulting in an increase in leaf size, plant height, stem width, and seed size.

[0010] In a second aspect, the present invention provides a transgenic method for promoting plant growth and development, overexpressing in a target plant GmGIF5 gene; GmGIF5 The amino acid sequence encoded by the gene is shown in SEQ ID NO: 1, and the cDNA sequence is shown in SEQ ID NO: 2.

[0011] Furthermore, the method specifically comprises the following steps: Step 1: Amplification GmGIF5 Gene: Design primers and obtain by amplification GmGIF5 Gene; Step 2: Construction of pUBQ10 promoter-driven GmGIF5 Overexpression vector; Step 3: Use the flower soaking method to soak the GmGIF5 The overexpression vector is introduced into the target plant, and a transgenic strain is obtained through positive identification.

[0012] Beneficial effect: The present invention overexpresses soybean in Arabidopsis GmGIF5 Gene, analyzed GmGIF5 Potential functions of heterologous expression in Arabidopsis GmGIF5 This resulted in an increase in leaf size, plant height, stem width, and seed size. GmGIF5 The enlarged organs in the overexpression lines were mainly due to the increase in cell size rather than the expansion of cell number, which provides a new target for improving soybean yield through genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 yes GmGIF5 Overexpression of promotes leaf development.

[0014] Figure 2 yes GmGIF5 The result of overexpression promoting stem development.

[0015] Figure 3 yes GmGIF5 Result diagram of regulating seed size.

[0016] Figure 4 It is constructed GmGIF5 Overexpression vector map. DETAILED DESCRIPTION

[0017] The present invention analyzes GmGIF5 Potential functions of heterologous expression in Arabidopsis GmGIF5 This resulted in an increase in leaf size, plant height, stem width, and seed size.

[0018] Said GmGIF5 (Gene number: Glyma.10G164100 ) The amino acid sequence encoded by is shown in SEQ ID NO: 1, the cDNA sequence is shown in SEQ ID NO: 2, and the gene sequence is shown in SEQ ID NO: 3.

[0019] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0020] In the following examples, unless otherwise specified, the materials or reagents used are commercially available, and the operations used are conventional technical means.

[0021] 1. Plant materials and phenotypic data collection The wild-type and background Arabidopsis plants used in the present invention were of Columbia-0 (Col-0) ecotype. Arabidopsis seeds were vernalized at 4°C for two days before sowing and then sown on 1 / 2 Murashige and Skoog dishes. Eight days later, seedlings were transplanted to experimental plots. To construct the GmGIF5 overexpression (OE) vector, we used the pCAMBIA 1300 plant expression vector containing the constitutive promoter pUBQ10. The primers are listed in Tables 1-3 below. The constructed overexpression vector map is shown in Figure 4 As shown (vector restriction site: Spe I and Sma I). Transgenic lines were obtained by floral dip method. The mRNA level of the T3 generation overexpression lines was detected. GmGIF5 The leaf size and leaf epidermal cell size were measured 45 days after transplantation, while plant height, stem width and seed phenotype were measured 75 days after transplantation. For phenotypic collection, 12 plants were used for each OE line and wild type (WT). Statistical significance analysis was performed using Excel 2019.

[0022] Table 1: Vector Primers 1300 - GIF5 - F AGTTTTTCTGATTAACAGACTAGTATGCAGCAGCACCTGATG 1300 - GIF5 - R GACCTGAGGTAATTATAACCCGGGGTTTCCATCACCAGC Table 2: Quantification Primers qRT - GmGIF5 - F GCTCCTGTACTCCCAACA qRT - GmGIF5 - F CCAATGCGTACAAAGTCC Table 3: Internal reference primers ATACTIN2 - F GTCGTACAACCGGTATTGTGCT ATACTIN2 - R TGTCTCTTACAATTTCCCGCTCT 2. GmGIF5 Overexpression of For further research GmGIF5 To investigate its functional role in plant development, we constructed a pUBQ10 promoter-driven GmGIF5Overexpressing Arabidopsis transgenic lines. Potential transformants were detected by RT-qPCR, and three positive lines (OE2, OE5, and OE6) were selected for further study (Figure 1A). We observed the growth and development of wild-type (WT) and OE lines and found that the number of rosette leaves in OE lines was comparable to that in WT, but the leaf size of OE lines was significantly larger than that of WT (Figure 1B-D). Further statistical analysis showed that the projected area of ​​leaves in OE lines was 1.2 to 1.4 times larger than that in WT, and the petiole length of OE lines was 1.4 to 1.6 times longer than that in WT (Figure 1F and G). In order to understand the mechanism of increased leaf size in OE lines, we examined the leaf epidermal cells of WT and OE lines under a microscope and calculated the cell number and cell size (Figure 1E, H, I). The results showed that the leaf epidermal cell size of the three OE lines was significantly larger than that of WT. In addition, the number of cells per unit area in the OE line was significantly less than that in the WT line. These findings suggest that GmGIF5 Influences leaf development by regulating leaf cell size. Overall, these results suggest that GmGIF5 It plays a key role in plant leaf growth and development.

[0023] 3. GmGIF5 Overexpression promotes stem development because GmGIF5 The expression of α-terminal ... GmGIF5 The average height of the overexpressing plants was 1.15 to 1.21 times that of the wild type (Fig. 2A and B). In addition, the stems of the overexpressing lines were significantly thicker than those of the wild type, and the average stem width of the OE lines was 1.51 to 1.75 times that of the wild type (Fig. 2C and D). We hypothesized that cell expansion might be the cause of the increased height and thickened stems of the overexpressing lines. Microscopic observation of the main stem epidermis collected 1 cm above the rosette leaves confirmed this hypothesis (Fig. 2E-H). These findings suggest that GmGIF5 Involved in stem development; its overexpression in Arabidopsis increases plant height and enhances stem thickness.

[0024] 4. GmGIF5 Regulating seed size Given that GmGIF5Overexpression affected the cell size of leaves and stems, and we observed the mature seeds of the wild-type and overexpression lines to determine whether it also had an effect on the seeds. The results showed that the seed length and width of the overexpression lines were larger than those of the wild type (Figure 3A and B). Further statistical analysis confirmed that the seed projection area of ​​the three overexpression lines was significantly larger than that of the wild type (Figure 3C). In addition, the thousand-grain weight of the overexpression lines was also significantly higher than that of the wild type (Figure 3D). In summary, GmGIF5 It can promote cell expansion, enhance plant biomass accumulation, and promote seed development.

[0025] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. Soybeans GmGIF5 The application of genes in regulating plant organ size.

2. The use according to claim 1, characterized in that: Said GmGIF5 The amino acid sequence encoded by the gene is shown in SEQ ID NO: 1, and the cDNA sequence is shown in SEQ ID NO:

2.

3. The use according to claim 1, characterized in that: The plant is soybean or Arabidopsis thaliana.

4. The use according to claim 1, characterized in that: The regulation of plant organ size refers to heterologous expression in Arabidopsis GmGIF5 Resulting in an increase in leaf size, plant height, stem width, and seed size.

5. A transgenic method for promoting plant growth and development, characterized in that: Overexpression in target plants GmGIF5 gene; GmGIF5 The amino acid sequence encoded by the gene is shown in SEQ ID NO: 1, and the cDNA sequence is shown in SEQ ID NO:

2.

6. The method according to claim 1, characterized in that: The specific steps include: Step 1: Amplification GmGIF5 Gene: Design primers and obtain by amplification GmGIF5 Gene; Step 2: Construction of pUBQ10 promoter-driven GmGIF5 Overexpression vector; Step 3: GmGIF5 The overexpression vector is introduced into the target plant, and a transgenic strain is obtained through positive identification.

Images