Method for transforming fibroblasts and application of fibroblasts

Abstract

The invention discloses a method for transforming fibroblasts, which comprises the following steps: collecting peripheral blood of healthy people, extracting single cells of the peripheral blood by using lymphocyte separation liquid, and sorting and purifying B cells by using immunomagnetic beads; the preparation method comprises the following steps: constructing overexpression plasmids of human CXCL13, TNFSF13B and VCAM1 by using a molecular cloning technology, and infecting MRC-5 by using lentivirus to obtain MRC-5 fibroblasts which simultaneously overexpress the CXCL13, the TNFSF13B and the VCAM1. The invention also provides the modified fibroblasts obtained according to the method. The invention also provides application of the modified fibroblast in the aspects of inducing B cell chemotaxis, inducing B cell adhesion and promoting B cell antibody secretion. The method can be applied to chemotaxis and adhesion of B cells, promotes the B cells to secrete antibodies, and has good clinical application value.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a method for transforming fibroblasts and an application thereof. Background Art

[0002] Fibroblasts are multifunctional cells that play an important role in the normal physiological processes of tissues and organs, especially in immune diseases and tumor microenvironments. Fibroblasts regulate immune responses, tumor cell growth, invasion and metastasis by secreting immunomodulatory factors and extracellular matrix components. Especially in tumor-associated fibroblasts (CAFs), they play a key role in supporting tumor stroma, regulating tumor immunity and angiogenesis. Studies have shown that tertiary lymphoid structures (TLS) are important areas for the aggregation of immune cells in tumors, which can recognize tumor antigens presented by antigen-presenting cells (APCs) and produce effector T cells, memory B cells and plasma cells. These cells promote tumor cell apoptosis through antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP) mechanisms, thereby reducing tumor burden. Effectively inducing the activation of B cells in TLS in tumor tissues into plasma cells is of great significance for enhancing anti-tumor immune responses.

[0003] Studies have shown that tumor-associated fibroblasts and B cells exist in the tertiary lymphoid structure area, and the two are closely related in spatial distribution. Using or modifying fibroblasts to stimulate B cell activation and enhance their antibody secretion function, and obtaining relevant antibodies for tumor treatment will be of great significance for promoting anti-tumor immune response and improving patient survival rate. This strategy is not only expected to enhance tumor immune response, but also may provide new methods and ideas for tumor treatment. Summary of the invention

[0004] One object of the present invention is to provide a method for transforming fibroblasts in view of the above technical problems to be solved.

[0005] Another object of the present invention is to provide fibroblasts obtained by the method.

[0006] Another object of the present invention is to provide application of the fibroblasts.

[0007] In order to achieve the purpose of the present invention, the present invention provides a method for transforming fibroblasts, which comprises the following steps:

[0008] Step 1: Collect peripheral blood from healthy subjects, extract peripheral blood mononuclear cells (PBMC) in vitro using lymphocyte separation fluid, and purify B cells using immunomagnetic beads;

[0009] Step 2: Molecular cloning technology was used to construct human CXCL13, TNFSF13B and VCAM1 overexpression plasmids, and lentivirus was used to infect MRC-5 to obtain MRC-5 fibroblasts that simultaneously overexpressed CXCL13, TNFSF13B and VCAM1.

[0010] Preferably, the method of the present invention further comprises: after obtaining MRC-5 fibroblasts that simultaneously overexpress CXCL13, TNFSF13B and VCAM1, detecting the overexpression efficiency of VCAM1, CXCL13 and TNFSF13B by real-time quantitative PCR.

[0011] Preferably, the method of the present invention further comprises step 3: using VCAM1 + CXCL13 + TNFSF13B + MRC-5 induced B cell chemotaxis. The supernatant of MRC-5 was collected after 48 hours of culture. The supernatant was co-cultured with B cells through a transwell chamber for 2 hours, and the percentage of B cell migration was calculated by cell counting.

[0012] More preferably, in step 3, the first conditioned medium for inducing B cells is RPMI 1640 medium containing 10% fetal bovine serum, 1 μg / ml CpG and 1 μg / ml anti-IgM.

[0013] More preferably, in step 3, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 - CXCL13 - TNFSF13B - The cell number of MRC-5 was 1.4×10 5 cells / well, the number of B cells is 1×10 6 cells / well, and the culture plate is a 24-well plate.

[0014] More preferably, in step 3, the CXCL13 neutralizing antibody has a content of 4 μg / ml and is added to the supernatant of MRC-5 cells for incubation 1 hour before co-culturing with B cells.

[0015] More preferably, in step 3, the percentage of B cell migration is equal to the number of B cells that migrate to the lower chamber divided by the total number of B cells.

[0016] Preferably, the method of the present invention further comprises step 4: using VCAM1 + CXCL13 + TNFSF13B +MRC-5 induced B cell adhesion. After co-culture of MRC-5 and B cells for 30 min, non-adherent B cells were removed. The OD value at 450 nm was detected by CCK8 assay, and the OD value generated by B cells was calculated.

[0017] More preferably, in step 4, the number of MRC-5 cells is 1×10 4 cells / well, the number of B cells is 6×10 4 cells / well, and the culture plate specification is 96-well plate.

[0018] More preferably, in step 4, the VCAM1 neutralizing antibody has a content of 30 μg / ml and is added to the culture medium of MRC-5 1 hour before co-culturing with B cells to neutralize the VCAM1 protein on MRC-5.

[0019] More preferably, in step 4, the OD value generated by the B cells is equal to the OD value of the well where MRC-5 and B cells are co-cultured minus the OD value of the well where MRC-5 is cultured alone.

[0020] Preferably, the method of the present invention further comprises step 5: using VCAM1 + CXCL13 + TNFSF13B + MRC-5 induced B cell antibody secretion. After co-culture of MRC-5 and B cells in the second conditioned medium containing or not containing TNFSF13B neutralizing antibody for 6 days, the cell supernatant was collected and the IgG content in the supernatant was detected by ELISA experiment.

[0021] More preferably, in step 5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 - CXCL13 - TNFSF13B - The number of cells for MRC-5 was 3000 cells / well, and the number of cells for B cells was 6×10 4 cells / well, and the specification of the culture plate is 96-well plate.

[0022] More preferably, in step 5, the second conditioned medium is RPMI1640 medium containing 10% fetal bovine serum and 1 μg / ml CpG.

[0023] More preferably, in step 5, the content of TNFSF13B neutralizing antibody is 20 μg / ml.

[0024] Preferably, the fibroblasts are tumor-associated fibroblasts, but are not limited thereto. In addition to tumor-associated fibroblasts, the fibroblasts may also include any one or more of tissue-specific fibroblasts, disease-specific fibroblasts, inflammation-associated fibroblasts, myofibroblasts or antigen presentation-associated fibroblasts.

[0025] In another aspect, the present invention also provides modified fibroblasts obtained according to the method.

[0026] On the other hand, the present invention also provides the use of the modified fibroblasts in inducing B cell chemotaxis.

[0027] On the other hand, the present invention also provides the use of the modified fibroblasts in inducing B cell adhesion.

[0028] On the other hand, the present invention also provides the use of the modified fibroblasts in promoting B cells to secrete antibodies.

[0029] The method for transforming fibroblasts of the present invention can induce the transformed fibroblasts to be used for chemotaxis and adhesion of B cells and promote B cells to secrete antibodies, which involves simultaneously overexpressing VCAM1, CXCL13 and TNFSF13B in fibroblasts to obtain VCAM1 + CXCL13 + TNFSF13B + Fibroblasts. Then VCAM1 + CXCL13 + TNFSF13B + Fibroblasts are co-cultured with B cells, and the modified fibroblasts are used in chemotaxis and adhesion of B cells and in promoting B cell secretion of antibodies. This system can promote B cells to chemotaxis and adhesion to fibroblasts, and then fibroblasts promote B cell antibody secretion, which has great clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Normalized mean expression of cluster markers, complement, adhesion molecules, and chemokines (rows) is shown for each CAF cluster (columns). Fill colors from blue to red indicate proportional expression levels from low to high.

[0031] Figure 2 showed that CXCL13 is involved in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B +Relative mRNA levels in MRC-5 cells (overexpression group) (left panel; n=3). The bar graph shows the migration ability of B cells and MRC-5 under different co-culture conditions (right panel; n=8). B cells and VCAM1 - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + MRC-5 fibroblasts were co-cultured with CXCL13-specific neutralizing antibodies.

[0032] Figure 3 Schematic diagram of B cell adhesion experiment (left). The middle bar graph shows VCAM1 in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B + Relative mRNA levels in MRC-5 cells (overexpression group) (middle graph; n=3), and the bar graph on the right shows the adhesion ability of B cells to MRC-5 (right graph; n=3). - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + MRC-5 was co-cultured with VCAM1 neutralizing antibody. The relative number of B cells bound to MRC-5 was quantitatively determined by CCK8 method (OD value). Figure 4 Schematic diagram of B cell co-culture experiment (left). The middle bar graph shows the expression of TNFSF13B in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B +Relative mRNA levels in MRC-5 cells (overexpression group) (middle graph; n=3). The right bar graph shows the expression of VCAM1 in B cells. - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + IgG produced by co-culture of MRC-5 and TNFSF13B-specific neutralizing antibody (right panel; n=3). ELISA was used to detect the IgG level in the supernatant. DETAILED DESCRIPTION

[0033] In order to more clearly understand the above-mentioned objects, features and advantages of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention; the sequencing and analysis methods used in the following examples are conventional methods unless otherwise specified.

[0034] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0035] Example 1

[0036] Differentially expressed gene analysis

[0037] The inventors used single-cell mRNA sequencing technology to study and group tumor-associated fibroblasts (CAFs) according to their expression characteristics, and found that nasopharyngeal carcinoma contains five cell subpopulations. Further, through systematic bioinformatics calculations, the specific highly expressed genes of each subpopulation were mined, and it was found that among the five cell subpopulations, the fibroblasts of subpopulation 3-CXCL13 expressed higher subpopulation markers (PTGDS, TNFSF13B, CYP1B1 and PDPN), complement component-related genes (C2 and C3), cell adhesion molecules (VCAM1 and ICAM1) and chemokines (CXCL13, CCL19, CCL21, etc.), indicating that it has the effect of promoting B cell antibody secretion, chemotaxis and adhesion. Figure 1 Normalized mean expression of cluster markers, complement, adhesion molecules, and chemokines (rows) for each CAF cluster (columns) is shown. Fill colors from blue to red indicate proportional expression levels from low to high.

[0038] Example 2

[0039] The specific steps for obtaining peripheral blood single cells (PBMC) are as follows:

[0040] (1) Add appropriate amount of PBS and mix the anticoagulated blood;

[0041] (2) Add lymphocyte separation solution of the same volume as the blood sample to a 15 ml centrifuge tube, carefully add anticoagulated blood to the upper layer, and centrifuge at 750 g for 20 min with a ramp rate of 1;

[0042] (3) Take another clean 15 ml centrifuge tube and add 5 ml PBS;

[0043] (4) Carefully pipette the middle white cell layer into the centrifuge tube in (3), add PBS to 10 ml, centrifuge at 550 g, 4°C for 5 min, and reduce the speed to 5;

[0044] (5) Discard the supernatant, add 2 ml of lysis buffer, lyse the cells at room temperature for 10 min, then add an appropriate volume of PBS, centrifuge at 550 g, 4 °C for 5 min;

[0045] (6) Discard the supernatant, resuspend the cell pellet, and blow it apart to obtain PBMCs.

[0046] The specific steps of immunomagnetic bead sorting and purification of B cells are as follows:

[0047] (1) Filter the resuspended PBMC cells with a 70 μm cell filter, centrifuge at 300 × g for 5 min, resuspend the cells, count and adjust the cell concentration to 1 × 10 7 cells / 100ul, add the cell suspension to the flow tube;

[0048] (2) In 1×10 7 Add 10ul Antibody Cocktail to each cell suspension, mix well, and incubate on ice for 15min;

[0049] (3) After mixing the magnetic beads, each 1×10 7 Add 10ul Streptavidin Nanobeads to each cell suspension, mix well, and incubate on ice for 15min;

[0050] (4) Add 2.5 mL of buffer, blow gently to mix well, and place on a magnetic stand for 5 min;

[0051] (5) Pour out and collect the liquid in a new centrifuge tube, add 2.5 mL of buffer to the flow tube again, blow gently to mix, place on a magnetic stand for 5 minutes, and collect the cells for the second time. The collected cells are B cells.

[0052] Example 3

[0053] The specific steps for constructing human MRC-5 cells overexpressing VCAM1, CXCL13 and TNFSF13B are as follows:

[0054] (1) Design primers. The primer sequences are as follows:

[0055] CXCL13-F: CTAGCTAGCATGAAGTTCATCTCGACATCTCTGCTT,

[0056] CXCL13-R: CGCGGATCCTCAGGGAATTCTTTCTCTTAAACACTGGAACT;

[0057] VCAM1-F:CTAGCTAGCATGCCTGGGAAGATGGTCGTGAT,

[0058] VCAM1-R:ATTTTGCGGCCGCCTACACTTTTGACTTCTGTGCTTCTAC;

[0059] TNFSF13B-F:CTAGCTAGCATGGATGACTCCACAGAAAGGG,

[0060] TNFSF13B-R: CGCGGATCCTCACAGCAGTTTCAATGCACC;

[0061] Human VCAM1, CXCL13, and TNFSF13B gene fragments were extracted by PCR amplification from a human cDNA library;

[0062] (2) Selecting pcDNA3.1 lentiviral vector, and selecting NheI and NotI sites for double restriction digestion according to the VCAM1 gene sequence; selecting pCDH-puro lentiviral vector, and selecting NheI and BamHI sites for double restriction digestion according to the CXCL13 gene sequence; selecting pCDH-Hygro lentiviral vector, and selecting NheI and BamHI sites for double restriction digestion according to the TNFSF13B gene sequence;

[0063] (3) using T4 DNA ligase, the digested pcDNA3.1 vector was connected to VCAM1, the pCDH-puro vector was connected to CXCL13, and the pCDH-Hygro vector was connected to TNFSF13B;

[0064] (4) Transform and extract plasmids and perform plasmid sequence sequencing;

[0065] (5) lentiviral packaging using 293T cells to produce lentivirus;

[0066] (6) MRC-5 cells were infected with lentivirus, G418 was selected for positive cell screening when VCAM1 was overexpressed, puromycin was selected for positive cell screening when CXCL13 was overexpressed, and hygromycin was selected for positive cell screening when TNFSF13B was overexpressed.

[0067] Example 4

[0068] VCAM1 + CXCL13 + TNFSF13B + The specific steps of MRC-5-induced B cell chemotaxis are as follows:

[0069] (1) The B cells obtained in Example 2 were washed once with RPMI1640 medium containing 10% fetal bovine serum, and cultured with conditioned medium of RPMI 1640 containing 10% fetal bovine serum, CpG (1 μg / ml), and anti-IgM (1 μg / ml) to activate the B cells. After 48 hours, a B cell chemotaxis assay was performed;

[0070] (2) 2×10 5 The MRC-5 cells obtained in Example 3 were resuspended in RPMI 1640 medium containing 10% fetal bovine serum at a density of cells / ml;

[0071] (3) 700 μl of MRC-5 cell suspension was added to a 24-well plate. After culturing for 24 hours, the cell supernatant was collected and centrifuged to obtain 600 μl of the supernatant, which was then added to the lower chamber of the transwell chamber.

[0072] (4) One hour before the chemotaxis assay, neutralizing antibodies against human CXCL13 were added to the culture medium in the lower chamber with or without 4 μg / ml;

[0073] (5) The B cells activated for 48 hours were collected and 1×10 7 Resuspend the cells in RPMI 1640 medium containing 10% fetal bovine serum at a density of 10 cells / ml, and add 100 μl of the cell suspension to the upper chamber of the transwell chamber;

[0074] (6) After culturing for 2 hours in a cell culture incubator at 37°C and 5% CO2, the B cells that migrated to the lower chamber of the transwell chamber were counted and divided by the total number of B cells to calculate the percentage of B cell migration.

[0075] Figure 2 showed that CXCL13 is involved in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1+ CXCL13 + TNFSF13B + Relative mRNA levels in MRC-5 cells (overexpression group) (left panel; n=3). The bar graph shows the migration ability of B cells and MRC-5 under different co-culture conditions (right panel; n=8). B cells and VCAM1 - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + MRC-5 fibroblasts were co-cultured with CXCL13-specific neutralizing antibodies.

[0076] like Figure 2 As shown, compared with the control group, VCAM1 + CXCL13 + TNFSF13B + MRC-5 (overexpression group) significantly enhanced the ability of B cells to chemotaxis toward MRC-5, while the use of CXCL13 neutralizing antibody weakened the ability of VCAM1 + CXCL13 + TNFSF13B + MRC-5 enhances B cell chemotaxis, indicating that VCAM1 + CXCL13 + TNFSF13B + MRC-5 has the function of promoting the chemotaxis of B cells to fibroblasts.

[0077] Example 5

[0078] VCAM1 + CXCL13 + TNFSF13B + The technique of MRC-5 inducing B cell adhesion is as follows:

[0079] (1) One day in advance, the MRC-5 cells obtained in Example 3 were cultured at 1×10 4 Cells / well were plated in 96-well plates, and the medium containing or not containing 30 μg / ml neutralizing antibody against VCAM1 was replaced 1 hour before the adhesion assay;

[0080] (2) 6×10 4The B cells obtained in Example 2 were resuspended in RPMI 1640 medium containing 10% fetal bovine serum at a density of cells / 100 μl;

[0081] (3) Aspirate and discard the MRC-5 cell culture medium, add 100 μl of B cell suspension, and culture in a 37° C., 5% CO 2 incubator for half an hour.

[0082] (4) Remove the cells, tap the cell culture plate twice, then remove the culture medium and non-adherent B cells, add 100 μl of diluted CCK8 solution to each well, culture for 2 hours at 37°C and 5% CO2, and then measure the OD value at 450 nm. In order to exclude the difference in OD values ​​caused by the difference in the number of MRC-5 cells, the OD value generated by B cells is equal to the OD value of MRC-5 and B cell co-culture minus the OD value of MRC-5 cultured alone.

[0083] Figure 3 Schematic diagram of B cell adhesion experiment (left). The middle bar graph shows VCAM1 in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B + Relative mRNA levels in MRC-5 cells (overexpression group) (middle graph; n = 3), and the bar graph on the right shows the adhesion ability of B cells to MRC-5 (right graph; n = 3). - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + MRC-5 was co-cultured with VCAM1 neutralizing antibody. The relative number of B cells bound to MRC-5 was quantitatively determined by CCK8 method (OD value).

[0084] like Figure 3 As shown, compared with the control group, VCAM1 + CXCL13 + TNFSF13B + MRC-5 (overexpression group) can bind to more B cells, while the use of VCAM1 neutralizing antibody reduces VCAM1 + CXCL13 + TNFSF13B+ Binding of MRC-5 to B cells indicates that VCAM1 + CXCL13 + TNFSF13B + MRC-5 can enhance the ability of B cells to adhere to fibroblasts MRC-5.

[0085] Example 6

[0086] VCAM1 + CXCL13 + TNFSF13B + The specific steps of MRC-5 stimulating B cell antibody IgG secretion are as follows:

[0087] (1) One day in advance, the MRC-5 cells obtained in Example 3 were plated on a 96-well plate at a density of 3000 cells / well and allowed to adhere completely.

[0088] (2) The B cells obtained in Example 2 were washed once with RPMI 1640 medium containing 10% fetal bovine serum; 3×10 5 B cells were resuspended in conditioned medium containing 10% fetal bovine serum and CpG (1 μg / ml) at a density of 10 cells / ml; in order to neutralize TNFSF13B, 20 μg / ml of anti-human TNFSF13B neutralizing antibody was added to the medium, and 200 μl of the B cell suspension was added to the above-mentioned fibroblast MRC-5 for co-culture;

[0089] (3) On the third day of co-culture, carefully collect 100 μl of cell supernatant without touching the cells, and add 100 μl of RPMI1640 conditioned medium containing 10% fetal bovine serum and CpG (1 μg / ml) for re-culture. In the neutralization group, 20 μg / ml of anti-human TNFSF13B neutralizing antibody was still added;

[0090] (4) On day 6, collect the cell supernatant and centrifuge at 500 g for 10 min at room temperature, then reduce the speed to 4.

[0091] (5) Take the supernatant and detect IgG by ELISA.

[0092] Figure 4 Schematic diagram of B cell co-culture experiment (left). The middle bar graph shows the expression of TNFSF13B in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B +Relative mRNA levels in MRC-5 cells (overexpression group) (middle graph; n=3). The right bar graph shows the expression of VCAM1 in B cells. - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + IgG produced by co-culture of MRC-5 and TNFSF13B-specific neutralizing antibody (right panel; n=3). ELISA was used to detect the IgG level in the supernatant.

[0093] like Figure 4 As shown, compared with the control group, VCAM1 + CXCL13 + TNFSF13B + MRC-5 (overexpression group) significantly promoted B cell secretion of IgG antibodies, while the use of TNFSF13B neutralizing antibody weakened the VCAM1 + CXCL13 + TNFSF13B + MRC-5 promotes IgG secretion in B cells, indicating that VCAM1 + CXCL13 + TNFSF13B + MRC-5 has the ability to promote antibody secretion by B cells.

[0094] In summary, by overexpressing VCAM1, CXCL13 and TNFSF13B in fibroblasts, the ability of fibroblasts to chemotaxis, adhesion and antibody secretion of B cells can be significantly enhanced, thereby achieving an anti-tumor effect and ultimately improving the prognosis of patients.

[0095] The present application is described in detail above in conjunction with the embodiments, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method for transforming fibroblasts, characterized in that The following steps are involved: Step 1: Collect peripheral blood from healthy people, extract single cells from peripheral blood in vitro using lymphocyte separation fluid, and purify B cells using immunomagnetic beads; Step 2: Molecular cloning technology was used to construct human CXCL13, TNFSF13B and VCAM1 overexpression plasmids, and lentivirus was used to infect MRC-5 to obtain MRC-5 fibroblasts that simultaneously overexpressed CXCL13, TNFSF13B and VCAM1.

2. The method according to claim 1, characterized in that The method further comprises: after obtaining MRC-5 fibroblasts that simultaneously overexpress CXCL13, TNFSF13B and VCAM1, detecting the overexpression efficiency of VCAM1, CXCL13 and TNFSF13B by using real-time quantitative PCR.

3. The method according to claim 1, characterized in that: The method further comprises step 3: using VCAM1 + CXCL13 + TNFSF13B + MRC-5 induced B cell chemotaxis. The supernatant of MRC-5 was collected after 48 hours of culture. The supernatant was co-cultured with B cells through a transwell chamber for 2 hours, and the percentage of B cell migration was calculated by cell counting.

4. The method according to claim 1, characterized in that: The method further comprises step 4: using VCAM1 + CXCL13 + TNFSF13B + MRC-5 induced B cell adhesion. After co-culture of MRC-5 and B cells for 30 min, non-adherent B cells were removed. The OD value at 450 nm was detected by CCK8 assay, and the OD value generated by B cells was calculated.

5. The method according to claim 1, characterized in that The method further comprises step 5: using VCAM1 + CXCL13 + TNFSF13B + MRC-5 induced B cell antibody secretion. After co-culture of MRC-5 and B cells in the second conditioned medium containing or not containing TNFSF13B neutralizing antibody for 6 days, the cell supernatant was collected and the IgG content in the supernatant was detected by ELISA experiment.

6. The modified fibroblast obtained according to the method of any one of claims 1 to 5.

7. Use of the modified fibroblasts according to claim 6 in inducing B cell chemotaxis.

8. Use of the modified fibroblasts according to claim 6 in inducing B cell adhesion.

9. Use of the modified fibroblasts according to claim 6 in promoting B cells to secrete antibodies.

Images