Reagent and kit for detecting canine liver cluster insect nucleic acid and application of reagent and kit

Abstract

The invention provides a reagent and a kit for detecting canine liver cluster insect nucleic acid and application of the reagent and the kit. The reagent comprises a reagent used for detecting a first region and / or a second region of the 18S rRNA gene of the canine hepatic cluster insect, the first region is selected from any segment between 748-842nd bases, the second region is selected from any segment between 53-150th bases, a nucleotide sequence between the 748-842nd bases is shown as SEQ ID NO: 7, and a nucleotide sequence between the 748-842nd bases is shown as SEQ ID NO: 6. The nucleotide sequence between the 53rd base and the 150th base is as shown in SEQ ID NO: 8. By applying the reagent or the kit provided by the invention, the canine hepatic cluster insect can be quickly, efficiently, sensitively and accurately identified.

Description

Technical Field

[0001] The present invention relates to the field of detection of Hepatozoon fasciatus, and in particular to a reagent and a kit for detecting Hepatozoon canis nucleic acid and an application thereof. Background Art

[0002] Hepatozoonosis is a protozoan disease caused by Hepatozoons of the family Heamogregarinidae and spread by ticks. More than 300 species of Hepatozoons have been reported to infect animals. Canine Hepatozoonosis is caused by two species of Hepatozoons, one is Hepatozoon canis (H. canis), which was first discovered in dogs in India in 1905; the other is Hepatozoon Americanum (H. americanum). In 1978, dogs on the Texas coast of the United States were confirmed to have Hepatozoonosis (ACH). Because the disease is more serious and often leads to death, based on the characteristics of the disease and parasites, this new species of Hepatozoon that infects dogs was identified in the United States in 1997. Compared with Hepatozoon Americanum, chronic infection caused by Hepatozoon canis causes milder clinical symptoms and can cause lifelong worms.

[0003] There are three main methods for detecting hepatitis, namely, etiological detection, immunological detection and molecular detection. The etiological detection methods of hepatitis mainly focus on blood smear and muscle section microscopy, but the efficiency of blood smear and muscle section microscopy is low and cannot be used as a reliable detection method. Immunological detection is mainly the indirect ELISA method, but this method cannot distinguish whether the animal is currently infected or has been infected, and cannot identify the carrier animal and the storage host. PCR technology is one of the most widely used methods for diagnosing hepatitis. Conventional PCR detection technology has a big disadvantage, which is low specificity and easy to produce false positives during amplification. In addition, in the process of detecting hepatitis, it was found that there would be cross-reactions between hepatitis and other sporozoans. Summary of the invention

[0004] The main purpose of the present invention is to provide a reagent, a kit and an application thereof for detecting Hepatozoon canis nucleic acid, so as to solve the problem of low specificity of the detection result of Hepatozoon canis existing in the prior art.

[0005] In order to achieve the above-mentioned object, according to the first aspect of the present invention, a reagent for detecting nucleic acid of Hepatozoon canis is provided, the reagent comprising a reagent for detecting a first region and / or a second region of the 18S rRNA gene of Hepatozoon canis, wherein the first region is selected from any fragment between bases 748-842, the second region is selected from any fragment between bases 53-150, the nucleotide sequence between bases 748-842 is shown in SEQ ID NO:7, and the nucleotide sequence between bases 53-150 is shown in SEQ ID NO:8.

[0006] Furthermore, the first region is selected from any fragment between bases (748-753) to (837-842); and / or the second region is selected from any fragment between bases (53-58) to (145-150).

[0007] Furthermore, the above-mentioned reagent includes a primer pair, the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary or identical to 25 to 31 consecutive nucleotides between bases (748 to 753) to (837 to 842) of the 18SrRNA gene of Hepatozoon canis; and / or the above-mentioned reagent includes a primer pair, the nucleotide sequence of the primer pair has a nucleotide sequence that is complementary or identical to 16 to 22 consecutive nucleotides between bases (53 to 58) to (145 to 150) of the 18SrRNA gene of Hepatozoon canis.

[0008] Further, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 1 to 2, and / or the nucleotide sequences shown in SEQ ID NOs: 4 to 5; preferably, the reagent also includes a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 3; and / or the nucleotide sequence shown in SEQ ID NO: 6; wherein, SEQ ID NO: 1 is 5'-GCATATTCAGGACTTTTACTTTGAGAA-3', SEQ ID NO: 2 is 5'-CTAAAATCCTATCTTATTATTCCATGCTG-3', SEQ ID NO: 3 is 5'-TTTCTAGCAGGCCGACGCTTTGAATACT-3', SEQ ID NO: 4 is 5'-GCATGTCTAAGTATAAGCAA-3', SEQ ID NO: 5 is 5'-CCACGGTTATCCATGTAA-3', and SEQ ID NO: 6 is 5'-CCATAACTGTTTTAATGAGCCATTTGC-3'.

[0009] Furthermore, the 5' end and 3' end of the probe have a fluorescent reporter group and a fluorescent quencher group, respectively; preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, AlexaFluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse; more preferably, the 5' end of the probe is a FAM group and the 3' end is a BHQ group.

[0010] In order to achieve the above object, according to a second aspect of the present invention, a kit is provided, the kit comprising any of the above reagents for detecting Hepatozoon canis nucleic acid in a sample to be tested.

[0011] Furthermore, the kit also includes at least one of the following: a qPCR premix, the qPCR premix includes a qPCR buffer and an AK Taq DNA polymerase, preferably, the concentration of the AK Taq DNA polymerase is 5 U / μL.

[0012] According to a third aspect of the present invention, a method for detecting Hepatozoon canis by fluorescence quantitative PCR is provided, wherein any one of the above reagents or any one of the above kits is used for fluorescence quantitative PCR detection.

[0013] Furthermore, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C for 30s-90s; denaturation at 92-98°C for 2-8s, annealing at 58-62°C for 8-12s and collecting fluorescence signal processing, for a total of 40-44 cycles.

[0014] According to one aspect of the present invention, there is provided a use of any one of the above reagents or kits in the detection of Hepatozoon canis.

[0015] By applying the technical solution of the present invention, the reagent for detecting Hepatozoon canis nucleic acid of the present application has high specificity for Hepatozoon canis and also has higher sensitivity. Therefore, compared with existing detection reagents, it has significant advantages in rapid, efficient, sensitive and accurate identification of Hepatozoon canis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0017] Figure 1 The standard curve amplification graph according to Example 2 of the present invention is shown, wherein A is the amplification graph of primer-probe combination 1, and B is the amplification graph of primer-probe combination 2;

[0018] Figure 2 A standard curve diagram according to Example 2 of the present invention is shown, wherein A is a standard curve diagram of primer-probe combination 1, and B is a standard curve diagram of primer-probe combination 2;

[0019] Figure 3 The PCR amplification diagram of 20 replicates of 1000, 500, and 250 copies / ml plasmids in the primer-probe combination 1 in Example 3 of the present invention is shown;

[0020] Figure 4 The PCR amplification diagram of 20 replicates of 1000, 500, and 250 copies / ml plasmids in primer-probe combination 2 in Example 3 of the present invention is shown;

[0021] Figure 5 The PCR amplification diagram of the comparative experiment conducted in Example 4 of the present invention and the prior art is shown;

[0022] Figure 6 A positive sample amplification diagram according to Example 5 of the present invention is shown;

[0023] Figure 7 The diagram of DNA amplification of Haemophilus canis and Babesia in Example 6 of the present invention is shown.

[0024] In the above figures, primer probe 1 refers to primer probe combination 1, primer probe 2 refers to primer probe combination 2, and primer probe 3 refers to primer probe combination 3. DETAILED DESCRIPTION

[0025] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0026] As mentioned in the background technology, the existing technology has the problem of low specificity in the detection results of Hepatozoon canis. In order to improve this situation, the present application analyzes and compares the existing detection schemes, and compares the 18S rRNA gene sequence of Hepatozoon canis logged in Genbank. It is found that the above-mentioned amplification segment is relatively conservative. Based on this, two sets of specific primer pairs and probe combinations are designed, and further experiments prove that the two sets of reagents have high specificity in detecting Hepatozoon canis, and also have higher sensitivity. Compared with the existing detection reagents, the detection accuracy is higher. Based on the above research results, the applicant proposes a series of technical solutions of the present application.

[0027] In a first typical embodiment, a reagent for detecting Hepatozoon canis nucleic acid is provided, the reagent comprising: a reagent for detecting the first region and / or the second region of the 18S rRNA gene of Hepatozoon canis, wherein the first region is selected from any fragment between bases 748-842, the second region is selected from any fragment between bases 53-150, the nucleotide sequence between bases 748-842 is shown in SEQ ID NO:7, and the nucleotide sequence between bases 53-150 is shown in SEQ ID NO:8.

[0028] Due to the uniqueness of the first region and the second region, a fragment of any length selected from one or both regions for detection can achieve highly specific detection of Hepatozoon canis. To further improve the specificity and sensitivity of detection, in some preferred embodiments, the first region is selected from any fragment between bases (748-753) to (837-842); and / or the second region is selected from any fragment between bases (53-58) to (145-150).

[0029] For any length or any fragment in the above two regions, a suitable primer or primer-probe combination can be designed for detection. In some preferred embodiments, the above reagents include a primer pair, the nucleotide sequence of which has a nucleotide sequence complementary to or identical to 25 to 31 consecutive nucleotides between bases (748 to 753) to (837 to 842) of the 18S rRNA gene of Hepatozoon canis; and / or the nucleotide sequence of which has a nucleotide sequence complementary to or identical to 16 to 22 consecutive nucleotides between bases (53 to 58) to (145 to 150) of the 18S rRNA gene of Hepatozoon canis.

[0030] In some more preferred embodiments, the primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 1-2, and / or the nucleotide sequences shown in SEQ ID NOs: 4-5.

[0031] In some more preferred embodiments, the reagent further comprises a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 3; and / or the nucleotide sequence shown in SEQ ID NO: 6. Specifically, the primers and probes form two sets of primer-probe combinations.

[0032] Group 1:

[0033] Forward primer 1: 5′-GCATATTCAGGACTTTTACTTTGAGAA-3′ (SEQ ID NO: 1);

[0034] Reverse primer 1: 5'-CTAAAATCCTATCTTATTATTCCATGCTG-3' (SEQ ID NO: 2); Probe 1: 5'-TTTCTAGCAGGCCGACGCTTTGAATACT-3' (SEQ ID NO: 3).

[0035] Group 2:

[0036] Forward primer 2: 5′-GCATGTCTAAGTATAAGCAA-3′ (SEQ ID NO: 4);

[0037] Reverse primer 2: 5'-CCACGGTTATCCATGTAA-3' (SEQ ID NO: 5);

[0038] Probe 2: 5'-CCATAACTGTTTTAATGAGCCATTTGC-3' (SEQ ID NO: 6).

[0039] The two sets of primer-probe combinations of the present application have the advantages of high specificity, high sensitivity and high detection accuracy in the detection of canine hepatozoon.

[0040] In the above primer-probe combination, the 5' end and 3' end of the probe have a fluorescent reporter group and a fluorescent quencher group, respectively. The fluorescent reporter group and the fluorescent quencher group facilitate accurate, efficient and rapid detection using the fluorescent quantitative PCR method. Therefore, any group that emits fluorescence and can absorb fluorescence of the corresponding wavelength is suitable for this application.

[0041] In some preferred embodiments, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7.; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse. When the fluorescent reporter group and the fluorescent quencher group are used, they are reasonably selected and matched according to the wavelength of the emitted fluorescence and the wavelength of the absorbed fluorescence.

[0042] From the perspective of cost, effect, wide application and convenience, in some more preferred embodiments, the 5' end of the probe uses a FAM group, and the 3' end uses a BHQ group (specifically, BHQ1, BHQ2 or BHQ3).

[0043] In a second typical embodiment of the present application, a kit is provided, which includes any of the above reagents. The kit is used to detect Hepatozoon canis, which has the advantages of rapidity, high efficiency, high specificity, high sensitivity and high detection accuracy.

[0044] In order to further improve the convenience of the detection of the kit, in some preferred embodiments, the above-mentioned kit also includes at least one of the following: a qPCR premix, the qPCR premix includes a qPCR buffer and an AK Taq DNA polymerase, preferably, the concentration of the AK Taq DNA polymerase is 5U / μL. The specific qPCR buffer can be selected from existing known products for application. It will not be described in detail here. It should be noted that the DNA polymerase used in the qPCR premix is ​​the AK Taq DNA polymerase produced by Feipeng Biology, and the use of other DNA polymerases with similar efficacy is not excluded here.

[0045] The positive control in the kit is usually a gene fragment containing the object to be detected. In a preferred embodiment of the present application, the positive control is a gene fragment containing 95 bp and 98 bp of Hepatozoon, which is shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0046] SEQ ID NO: 7:

[0047] GCATATTCAGGACTTTTACTTTGAGAAAATTAGAGTGTTTCTAGCAGGCCGACGCTTT GAATACTGCAGCATGGAATAATAAGATAGGATTTTAG;

[0048] SEQ ID NO: 8:

[0049] GCATGTCTAAGTATAAGCAAAAATACAGCAAAACTGCAAATGGCTCATTAAAACAGT TATGGTTTACTTGATAATAGTTTTTACATGGATAACCGTGG.

[0050] The negative control in the kit is a plasmid that does not contain the target gene fragment and will not amplify the target fragment. Preferably, the negative control is deionized water.

[0051] In a third typical embodiment, a method for detecting Hepatozoon canis by using fluorescent quantitative PCR is provided. The method comprises using the above primer-probe combination or the above kit to perform fluorescent quantitative PCR detection.

[0052] Preferably, the combination of one or two sets of primer pairs and probes is used to perform fluorescence quantitative PCR detection on the 95 bp and 98 bp target gene fragments to be detected, respectively.

[0053] In some preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 92-98°C (preferably 95-98°C) for 30s-90s (preferably 30s-60s); denaturation treatment at 95-98°C for 2-8s (preferably 2-5s), 58-62°C (preferably 59-61°C), annealing for 8-12s or collecting fluorescence signal processing, for a total of 40-44 cycles.

[0054] In some more preferred embodiments, the conditions for fluorescence quantitative PCR detection are: pre-denaturation at 95°C for 1 min; denaturation at 95°C for 5 s, annealing at 60°C for 10 s or collecting fluorescence signal processing, for a total of 42 cycles.

[0055] In a fourth typical embodiment, the use of the above reagent or the above kit in the detection of Hepatozoon canis is provided. The present application can amplify the target fragment in the whole blood of animals by using primers or primer-probe combinations (one or two sets) that can identify Hepatozoon canis, and can quickly, efficiently, sensitively and accurately identify Hepatozoon canis.

[0056] The beneficial effects of the present application will be further explained in detail below in conjunction with specific examples. It should be noted that the primers in the following examples are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, the relevant reagents are all from commercially available products.

[0057] Example 1

[0058] 1. The canine hepatozoon nucleic acid detection kit in this embodiment includes the following components:

[0059] (i) qPCR premix: main components are 2×qPCR Mix (Runpeng Biotechnology) and AK Taq enzyme (5U / μL) (Feipeng Biotechnology);

[0060] (ii) the forward primer F, reverse primer R and probe P mentioned above;

[0061] (iii) Positive control: a recombinant plasmid containing the target gene fragment, wherein the plasmid contains the aforementioned 95 bp (as shown in SEQ ID NO: 7) or 98 bp gene fragment (as shown in SEQ ID NO: 8) of Hepatozoon.

[0062] (iv) Negative control: deionized water.

[0063] 2. Amplification system:

[0064] Table 1:

[0065]

[0066] 3. Reaction procedure:

[0067] Pre-denaturation treatment was 95°C, 1 min; denaturation treatment was 95°C, 5 s, and annealing / fluorescence signal collection treatment was 60°C, 10 s, for 42 cycles.

[0068] Example 2: Linear Detection

[0069] The recombinant plasmid containing the amplified fragment synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. was measured using a NanoDrop2000C (THCANAISrmo Scientific, America) ultra-micro spectrophotometer and converted into copies / mL as the plasmid standard. The constructed plasmid standard was diluted 10 times in 5 gradients (5×10 7 -5×10 3 copies / mL) for preparing the standard curve, with 4 replicates for each gradient.

[0070] Using this as a template, primer probe combination 1 (corresponding to SEQ ID NOs: 1-3) and primer probe combination 2 (corresponding to SEQ ID NOs: 4-6) were used to establish a 25 μL Real-time PCR reaction system, and amplified on the Shanghai Hongshi fully automatic fluorescent quantitative PCR instrument SLAN-96P. After the reaction was completed, a standard curve was prepared using EXCEL.

[0071] The results are as follows Figure 1 and 2 As shown, A shows the amplification efficiency of primer-probe combination 1 Efficiency = 97.6%, correlation coefficient R 2 =0.9983, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.381x + 44.464. B shows the amplification efficiency of primer probe combination 2 Efficiency = 93.8%, correlation coefficient R 2 =0.9926, indicating that there is a good linear relationship between the Ct value and the standard, y = -3.479x + 44.475.

[0072] Example 3: Sensitivity detection

[0073] 1. The recombinant plasmid containing the amplified fragment synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. was measured using a NanoDrop2000C (THCANAISrmo Scientific, America) ultra-micro spectrophotometer, and converted into copies / mL, and then diluted to 1000, 500, and 250 copies / mL. Each concentration was tested 20 times for sensitivity testing.

[0074] Using this as a template, primer probe combination 1 and primer probe combination 2 (same as Example 2) were used to establish a 25 μL real-time PCR reaction system, and amplified on Shanghai Hongshi fully automatic fluorescent quantitative PCR instrument SLAN-96P.

[0075] The results are as follows Figure 3 and Figure 4 As shown, primer-probe combination 1 has 100% detection at 1000 copies / ml, 100% detection at 500 copies / ml, and 30% detection at 250 copies / ml. Primer-probe combination 2 has 100% detection at 1000 copies / ml, 100% detection at 500 copies / ml, and 15% detection at 250 copies / ml. The detection limit of the kit of the present invention is 500 copies / ml.

[0076] Example 4: Comparative experiment:

[0077] The sequence in the patent with publication number CN108950019A, including the designed primer F, primer R and probe P, denoted as primer-probe combination 3, was used for comparative experiments with the primer-probe combinations 1 and 2 of the present invention.

[0078] The specific sequence of primer probe combination 3 is as follows:

[0079] Primer F: 5'-TGAAAACAGGCGATAAATCATT-3' (SEQ ID NO: 9);

[0080] Primer R: 5'-ACTGCCACGGTAAGCCAAT-3' (SEQ ID NO: 10);

[0081] Probe P: 5'-FAM-AGTTTCTGACCTATCAGCTTTTCGACGGT-BHQ-3' (SEQ ID NO: 11).

[0082] Two cases of clinical nucleic acid of Hepatozoon canis were selected as samples, with 4 replicates for each sample. The above-mentioned primer-probe combination 1 and 2 and the above-mentioned primer-probe combination 3 used for comparison were used to establish a 25 μL Real-time PCR reaction system, and amplified on the Shanghai Hongshi fully automatic fluorescent quantitative PCR instrument SLAN-96P.

[0083] The results are as follows Figure 5 It shows that primer probe combination 1 and 2 are primer probes of the present invention, and primer probe combination 3 is a primer probe for comparison. It can be seen that the primer probe combination of the present invention has a smaller amplification Ct value (sample 1: primer probe combination 1: Ct value is 28, primer probe combination 2: Ct value is 29, primer probe combination 3: Ct value is 31; sample 2: primer probe combination 1: Ct value is 31, primer probe combination 2: Ct value is 32, primer probe combination 3: Ct value is 34).

[0084] Example 5: Positive Detection

[0085] The kit assembled in the present invention was used, and the blood DNA of dogs suffering from canine hepatozoonosis was used as the sample to be tested. The viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology, RK1001) was used to extract DNA. The specific operation steps were carried out with reference to the instructions. The recombinant plasmid was used as a positive control, and ddH2O was used as a negative control. A 25 μL Real-time PCR reaction system was established and amplified on a Shanghai Hongshi fully automatic fluorescent quantitative PCR instrument SLAN-96P. The reaction parameters in Example 1 were run, and the Realtime PCR amplification curve was obtained by computer analysis software, and compared with the PCR amplification curve of the positive control to determine whether the 18s rRNA gene of canine hepatozoon was present.

[0086] The results are as follows Figure 6 The results show that the kit containing the primer-probe combination 1 and 2 of the present invention has an amplification curve for the blood DNA of dogs suffering from hepatozoonosis, and the 18s rRNA gene of hepatozoonosis is present.

[0087] Example 6: Specificity Detection

[0088] The kit assembled in Example 1 was used, and the blood DNA of dogs with canine hemophilus mycoplasma and babesiosis was used as the sample to be tested. The viral DNA / RNA extraction kit (magnetic bead method) (Guangdong Runpeng Biology, RK1001) was used to extract DNA. The specific operation steps were carried out according to the instructions. The recombinant plasmid was used as a positive control and ddH2O was used as a negative control. A 25μL real-time PCR reaction system was established and amplified on a Shanghai Hongshi fully automatic fluorescent quantitative PCR instrument SLAN-96P. The reaction parameters in Example 1 were run, and the Realtime PCR amplification curve was obtained by computer analysis software, and compared with the PCR amplification curve of the positive control to determine whether there was a non-canine hepatozoon 18s rRNA gene crossover.

[0089] The results are as follows Figure 7 As shown, the kit of the present invention has no cross-talk with Haemophilus canis DNA and Babesia DNA.

[0090] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: using the primer-probe combination of the present application, not only the specificity is high, but also the sensitivity is greatly improved, so that can efficiently and accurately identify canine hepatozoon. The target fragment is amplified in the whole blood of animals, which is fast, efficient, accurate and cost-controlled.

[0091] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A reagent for detecting nucleic acid of Hepatozoon canis, characterized in that: The reagent comprises: a reagent for detecting the first region and / or the second region of the 18SrRNA gene of Hepatozoon canis, wherein the first region is selected from any fragment between bases 748-842, and the second region is selected from any fragment between bases 53-150, The nucleotide sequence between bases 748-842 is shown in SEQ ID NO: 7, The nucleotide sequence between bases 53-150 is shown in SEQ ID NO:

8.

2. The reagent according to claim 1, characterized in that The first region is selected from any fragment between bases (748-753) to (837-842); and / or The second region is selected from any fragment between bases (53-58) to (145-150).

3. The reagent according to claim 2, characterized in that The reagent comprises a primer pair, the nucleotide sequence of the primer pair having a nucleotide sequence complementary to or identical to 25 to 31 consecutive nucleotides between bases (748 to 753) to (837 to 842) of the 18S rRNA gene of Hepatozoon canis; and / or The reagent comprises a primer pair, the nucleotide sequence of which has a nucleotide sequence complementary to or identical to 16 to 22 consecutive nucleotides between bases (53 to 58) to (145 to 150) of the 18S rRNA gene of Hepatozoon canis.

4. The reagent according to claim 3, characterized in that The primer pair is selected from the nucleotide sequences shown in SEQ ID NOs: 1 to 2, and / or the nucleotide sequences shown in SEQ ID NOs: 4 to 5; Preferably, the reagent further comprises a probe, and the probe is selected from the nucleotide sequence shown in SEQ ID NO: 3; and / or the nucleotide sequence shown in SEQ ID NO: 6; Wherein, SEQ ID NO: 1 is 5'-GCATATTCAGGACTTTTACTTTGAGAA-3', SEQ ID NO: 2 is 5'-CTAAAATCCTATCTTATTATTCCATGCTG-3', SEQ ID NO: 3 is 5'-TTTCTAGCAGGCCGACGCTTTGAATACT-3'; SEQ ID NO: 4 is 5'-GCATGTCTAAGTATAAGCAA-3', SEQ ID NO: 5 is 5'-CCACGGTTATCCATGTAA-3', SEQ ID NO: 6 is 5'-CCATAACTGTTTTAATGAGCCATTTGC-3'.

5. The reagent according to claim 4, characterized in that The 5' end and 3' end of the probe respectively have a fluorescent reporter group and a fluorescent quencher group; Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, Quasar 570, Cy3, TAMRA, ROX, Texas Red, Alexa Fluor633, Cy5, Quasar 670, Cy5.5 or Cy7; the fluorescent quencher group is selected from BHQ, TAMRA, Dabcyl or Eclipse; More preferably, the 5' end of the probe is a FAM group, and the 3' end is a BHQ group.

6. A kit, characterized in that: The kit comprises the reagent for detecting Hepatozoon canis nucleic acid according to any one of claims 1 to 5.

7. The kit according to claim 6, characterized in that The kit further comprises at least one of the following: a qPCR premix, wherein the qPCR premix comprises a qPCR buffer and an AK Taq DNA polymerase. Preferably, the concentration of the AK Taq DNA polymerase is 5 U / μL.

8. A method for detecting Hepatozoon canis by fluorescence quantitative PCR, characterized in that: The fluorescent quantitative PCR detection is performed using the reagent for detecting Hepatozoon canis nucleic acid according to any one of claims 1 to 5 or the kit according to claim 6 or 7.

9. The method according to claim 8, characterized in that The conditions of the fluorescence quantitative PCR detection are: pre-denaturation at 92-98° C. for 30s-90s; denaturation at 92-98° C. for 2-8s, annealing at 58-62° C. for 8-12s and collecting fluorescence signal processing, for a total of 40-44 cycles.

10. Use of the reagent for detecting Hepatozoon canis nucleic acid according to any one of claims 1 to 5 or the kit according to claim 6 or 7 in detecting Hepatozoon canis.

Images