Molecular markers associated with low nitrogen tolerance in wheat

Abstract

The application discloses a molecular marker related to wheat low nitrogen tolerance. The molecular marker related to wheat low nitrogen tolerance disclosed by the application is a nucleotide corresponding to the 4097th nucleotide in SEQ ID No. 1 in the sequence listing in the wheat genome, and the nucleotide corresponding to the 4097th nucleotide in SEQ ID No. 1 in the sequence listing in the wheat genome is A or G. Experiments prove that the low nitrogen tolerance of wheat with the homozygous wheat low nitrogen tolerance molecular marker A is significantly lower than that of wheat with the homozygous wheat low nitrogen tolerance molecular marker G, and the homozygous wheat with the wheat low nitrogen tolerance molecular marker G has stronger low nitrogen tolerance, which is an excellent nucleotide type of the wheat low nitrogen tolerance molecular marker. The wheat low nitrogen tolerance molecular marker disclosed by the application can be used for wheat breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and relates to a molecular marker related to low nitrogen tolerance of wheat. BACKGROUND

[0002] Nitrogen is a major mineral nutrient element for plants, and is one of the important nutrient elements for determining crop yield and quality. The nitrogen use efficiency (NUE) of wheat in China is only 33%, and over-fertilization not only wastes resources, but also causes environmental pollution. Improving the nitrogen use efficiency of wheat varieties not only reduces the amount of nitrogen fertilizer used in wheat production and improves the utilization efficiency of fertilizers, but also reduces environmental pollution. Therefore, analyzing the genetic basis of crop nitrogen use efficiency, mining crop nitrogen use efficiency genes, elucidating the molecular mechanism of high nitrogen use efficiency of wheat, and cultivating wheat varieties with high nitrogen use efficiency are of great significance for wheat production. SUMMARY

[0003] The technical problem to be solved by the present application is how to detect the low nitrogen tolerance of wheat.

[0004] To solve the above technical problem, the present application first provides an application of a substance for detecting a molecular marker of wheat in detecting or assisting in detecting the low nitrogen tolerance of wheat.

[0005] The molecular marker of wheat is a nucleotide corresponding to position 4097 of SEQ ID No. 1 in the sequence listing, and the nucleotide corresponding to position 4097 of SEQ ID No. 1 in the sequence listing is A or G.

[0006] In the above application, the substance for detecting the molecular marker of wheat can contain a primer set composed of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

[0007] In the above application, the substance for detecting the molecular marker of wheat contains a primer set composed of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

[0008] The substance can also include 2xMastermix (LGC Genomics, Hoddesdon, UK). The substance can be only a primer group consisting of three single-stranded DNAs shown in SEQ ID No. 2, 1-23, SEQ ID No. 3, 1-23 and SEQ ID No. 4 in the sequence listing, or only a primer group consisting of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 in the sequence listing, or a primer group consisting of three single-stranded DNAs shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4 in the sequence listing and 2xMastermix (LGC Genomics, Hoddesdon, UK).

[0009] The single-stranded DNAs in each primer group can be independently packaged, and the molar number of each single-stranded DNA can be the same.

[0010] In the above application, the low nitrogen tolerance of the wheat homozygous for G at the nucleotide corresponding to position 4097 of SEQ ID No. 1 in the sequence listing in the genome is higher than or is candidate to be higher than the low nitrogen tolerance of the wheat homozygous for A at the nucleotide corresponding to position 4097 of SEQ ID No. 1 in the sequence listing in the genome.

[0011] The application also provides a method for detecting or assisting in detecting the low nitrogen tolerance of wheat, which comprises detecting the wheat molecular marker, and determining the low nitrogen tolerance of wheat according to the following method: the low nitrogen tolerance of the wheat homozygous for G at the nucleotide corresponding to position 4097 of SEQ ID No. 1 in the sequence listing in the genome is higher than or is candidate to be higher than the low nitrogen tolerance of the wheat homozygous for A at the nucleotide corresponding to position 4097 of SEQ ID No. 1 in the sequence listing in the genome.

[0012] In the above method, the detection of the wheat molecular marker is performed by using the substance for detecting the wheat molecular marker.

[0013] The substance for detecting the wheat molecular marker also belongs to the protection scope of the application.

[0014] The wheat molecular marker also belongs to the protection scope of the application.

[0015] The application also provides any one of the following applications:

[0016] X1) the application of the wheat molecular marker in wheat breeding;

[0017] X2) the application of the wheat molecular marker in detecting or assisting in detecting the low nitrogen tolerance of wheat;

[0018] X3) the use of the substance for detecting the wheat molecular marker in wheat breeding;

[0019] X4) the use of the substance for detecting the wheat molecular marker in the preparation of a wheat breeding product;

[0020] X5) the use of the substance for detecting the wheat molecular marker in the preparation of a product for detecting or assisting in detecting the low nitrogen tolerance of wheat;

[0021] X6) the use of the method for detecting or assisting in detecting the low nitrogen tolerance of wheat in wheat breeding;

[0022] X7) the use of the substance for detecting the nucleotide corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat in the breeding of wheat with low nitrogen tolerance;

[0023] X8) the use of the substance for detecting the nucleotide corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat in the preparation of a product for breeding wheat with excellent low nitrogen tolerance.

[0024] The present application also provides a method for breeding wheat, which comprises: detecting the nucleotide corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat, and selecting wheat with the nucleotide corresponding to the 4097th nucleotide of SEQ ID No. 1 in the sequence listing in the genome of wheat as G as a parent for breeding.

[0025] In an embodiment of the present application, the low nitrogen tolerance is reflected in the wheat low nitrogen tolerance index TKWR (relative thousand seed weight = thousand seed weight under low nitrogen / thousand seed weight under high nitrogen).

[0026] In the present application, the low nitrogen refers to the nitrogen content in the growth environment of the wheat being lower than the normal growth required nitrogen content of common wheat. The high nitrogen refers to the nitrogen content in the growth environment of the wheat meeting the normal growth required nitrogen content of common wheat.

[0027] Experiments have proved that the low nitrogen tolerance of wheat with the low nitrogen tolerance molecular marker A in homozygous type is significantly lower than that of wheat with the low nitrogen tolerance molecular marker G in homozygous type, and the wheat with the low nitrogen tolerance molecular marker G in homozygous type has stronger low nitrogen tolerance, which is an excellent nucleotide type of the low nitrogen tolerance molecular marker of wheat. It is proved that the low nitrogen tolerance molecular marker of wheat of the present application is related to the low nitrogen tolerance of wheat.

[0028] The present application will be further described in detail below in conjunction with the specific embodiments, and the examples given are only for illustrating the present application, but not for limiting the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the present application in any way. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 The low nitrogen tolerance index of the wheat is compared. Hap4 represents the low nitrogen tolerance index of the wheat homozygous for the wheat low nitrogen tolerance molecular marker G; other haplotypes represent the low nitrogen tolerance index of the wheat homozygous for the wheat low nitrogen tolerance molecular marker A. DETAILED DESCRIPTION

[0030] In the following examples, the experimental methods were conventional methods, and were carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples were commercially available, unless otherwise specified. In the following examples, at least three repeated experiments were set for the quantitative tests, and the results were averaged. In the following examples, the 1st position of each nucleotide sequence in the sequence listing was the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position was the 3' terminal nucleotide of the corresponding DNA / RNA, unless otherwise specified.

[0031] Example 1: Molecular marker related to the low nitrogen tolerance ability of wheat

[0032] This example found that there is a molecular marker related to the low nitrogen tolerance ability in the wheat genome, which is referred to as the wheat low nitrogen tolerance molecular marker, and is the nucleotide at position 4097 of SEQ ID No. 1 in the sequence listing. In the wheat genome, the wheat low nitrogen tolerance molecular marker is A or G.

[0033] 1. Wheat materials

[0034] The 223 wheat materials used are shown in Table 2.

[0035] 2. Detection of the wheat low nitrogen tolerance molecular marker

[0036] The CTAB method was used to extract the genomic DNA of each wheat material;

[0037] KASP primers were designed for the wheat low nitrogen tolerance molecular marker, including 2 SNP-specific primers (F1 / F2) and a universal primer (R). The primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd. The sequences of the primers are as follows:

[0038] SNP-F1: 5'-GCCCCTCTCTGTTTATTTTGAGT AAGGTGACCAAAGTTCATGCT -3' (SEQ ID No. 2, the non-underlined part is the wheat-specific primer, and the underlined part is used for binding FAM);

[0039] SNP-F2: 5'-GCCCCTCTCTGTTTATTTTGAGC AAGGTCGGAGTCAACGGATT-3'(SEQ ID No. 3, the underlined part is a wheat-specific primer, and the underlined part is used to combine HEX);

[0040] SNP-R: 5'-GTGACTCTGTTAGTGTGGTCTG-3'(SEQ ID No. 4).

[0041] The genomic DNA of each wheat material was used as a template, and the primers of each site were used for PCR amplification, and the reaction system was as follows:

[0042] The KASP reaction system included: 2xMastermix (LGC Genomics, Hoddesdon, UK) 2.5 μL, KASP primer (SNP-F1, SNP-F2, SNP-R) 0.056 μL, DNA template was 80 ng, and the total reaction volume was 5 μL.

[0043] The KASP reaction program was as follows: denaturation for 15 min (95°C); denaturation for 20 s (95°C), annealing for 60 s (65°C), each cycle decreased by 0.8°C, a total of 10 cycles; denaturation for 20 s (94°C), annealing for 60 s (55°C), a total of 32 cycles.

[0044] The reaction system was subjected to PCR amplification on an ABI Veriti 384 PCR instrument (Thermo Fisher), and after the reaction was completed, the PCR amplification product was scanned and read for fluorescence value using an Omega FSNP typing detector (LGC Genomics Ltd, KBS-0024-002). KlusterCallerTM (KBioscience) was used for genotyping, and the nucleotides of each wheat molecular marker site were determined according to the analysis results.

[0045] The detection results of 223 wheat materials are shown in Table 1, and the total number of wheat low-nitrogen-tolerant molecular marker A homozygous wheat is 165, and the total number of wheat low-nitrogen-tolerant molecular marker G homozygous wheat is 58.

[0046] 3. Analysis of different wheat phenotypes

[0047] The GWAS analysis population was planted in the wheat growing season in 2017-2018, 2018-2019 and 2019-2020 in Shengfeng Experimental Base of Shanxi Agricultural University in Taigu County of Jinzhong City in Shanxi Province (37.25°N, 112.25°E), and in 2018-2019 and 2019-2020 in Shijiazhuang North Agricultural Science Garden (37.84°N, 114.85°E) in Zhaoxian County, Hebei Province. Field tests were conducted on 223 wheat materials, and related agronomic traits and yield traits were investigated and counted.

[0048] The soil of the test field is sandy soil, and the 0-20 cm soil layer before sowing in 2017-2018 contains organic matter 13.51 g / kg, total nitrogen 1.21 g / kg, alkali-hydrolyzable nitrogen 60.22 mg / kg, available phosphorus 10.51 mg / kg, and available potassium 98.1 mg / kg. The 0-20 cm soil layer before sowing in 2018-2019 contains organic matter 20.60 g / kg, total nitrogen 1.97 g / kg, alkali-hydrolyzable nitrogen 90.34 mg / kg, available phosphorus 18.72 mg / kg, and available potassium 115.24 mg / kg in Zhaoxian, Hebei.

[0049] The test adopts a randomized block design and is repeated three times at two nitrogen levels. The first is a low nitrogen treatment (LN), which has only a small amount of nitrogen in the soil (no nitrogen fertilizer is applied); the second is a high nitrogen treatment (HN), which applies nitrogen fertilizer on the basis of the original soil, with the nitrogen fertilizer being applied in the form of urea (Beijing Coolai Bos Technology Co., Ltd.) for a total of 18 kg of pure nitrogen per 667 m 2 , 5.4 kg per 667 m 2 is applied before sowing, 7.2 kg per 667 m 2 is applied during the stem elongation period, and 5.4 kg per 667 m 2 is applied during the heading period. The entire test includes two environments, 2019 Hebei low nitrogen (2019HB(LN)) and 2019 Hebei high nitrogen (2019HB(HN)). Single-row planting is adopted, with a row length of 2 m, a row width of 25 cm, and a plant spacing of 5 cm. Field management is the same as that in the field production.

[0050] Field tests were conducted on 223 wheat materials at two wheat test bases, and related agronomic and yield traits were investigated and counted in combination with two nitrogen fertilizer level factors. The thousand-grain weight TKW of 7 representative plants was investigated for each sample group.

[0051] The results (Table 1) show that the low-nitrogen-tolerant molecular marker A of the homozygous wheat has an average TKWR (relative thousand-grain weight = thousand-grain weight under low nitrogen / thousand-grain weight under high nitrogen) of 0.936, which is significantly lower than that of the low-nitrogen-tolerant molecular marker G of the homozygous wheat (an average of 0.949), and the low-nitrogen-tolerant molecular marker G of the homozygous wheat has stronger low-nitrogen-tolerance ability, which is an excellent nucleotide type of the low-nitrogen-tolerant molecular marker. It is shown that the low-nitrogen-tolerant molecular marker of the present application is related to the low-nitrogen-tolerance ability of wheat.

[0052] Table 1, nucleotide and phenotype of the low-nitrogen-tolerant molecular marker of wheat

[0053]

[0054]

[0055]

[0056] The application has been described in detail. Those skilled in the art who are not specialists in the field will be able to implement the application in a wide range of equivalents, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives specific examples, it should be understood that further improvements can be made to the application. In general, the application is intended to include any variations, uses or improvements of the application, including changes made outside the scope of the application disclosed herein, using conventional techniques known in the art.

Claims

1. Application of substances containing molecular markers in wheat in detecting wheat's tolerance to low nitrogen; The wheat molecular marker is the nucleotide in the wheat genome corresponding to position 4097 of SEQ ID No. 1 in the sequence listing, and the nucleotide in the wheat genome corresponding to position 4097 of SEQ ID No. 1 in the sequence listing is A or G.

2. The application according to claim 1, characterized in that: The substance for detecting wheat molecular markers contains a primer set consisting of positions 1-23 of SEQ ID No. 2, positions 1-23 of SEQ ID No. 3, and the three single-stranded DNAs shown in SEQ ID No.

4.

3. The application according to claim 1, characterized in that: The substance for detecting wheat molecular markers contains a primer set consisting of three single-stranded DNA molecules as shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4 in the sequence listing.

4. The application according to any one of claims 1-3, characterized in that: Homozygous wheat with nucleotide G at position 4097 of SEQ ID No. 1 in the genome exhibits higher low nitrogen tolerance than homozygous wheat with nucleotide A at position 4097 of SEQ ID No. 1 in the genome.

5. A method for detecting wheat's tolerance to low nitrogen, characterized in that: The method includes detecting the wheat molecular markers of claim 1 and determining the low nitrogen tolerance of wheat according to the following method: the low nitrogen tolerance of homozygous wheat whose genome corresponds to nucleotide G at position 4097 of SEQ ID No. 1 in the sequence listing is higher than that of homozygous wheat whose genome corresponds to nucleotide A at position 4097 of SEQ ID No. 1 in the sequence listing.

6. The method according to claim 5, characterized in that: The detection of the wheat molecular markers described in claim 1 is performed using any of the substances described in claims 1-3 for detecting wheat molecular markers.

7. The substance for detecting wheat molecular markers as described in claim 2 or 3.

8. Any of the following applications: X1) The application of the wheat molecular markers described in claim 1 in the breeding of wheat with low nitrogen tolerance; X2) The application of the wheat molecular markers described in claim 1 in detecting wheat's tolerance to low nitrogen; X3) The application of any of the substances for detecting wheat molecular markers as described in claims 1-3 in the breeding of wheat with low nitrogen tolerance; X4) The use of any of the substances for detecting wheat molecular markers as described in claims 1-3 in the preparation of wheat low-nitrogen tolerance breeding products; X5) The use of any of the substances for detecting wheat molecular markers as described in claims 1-3 in the preparation of products for detecting wheat's low nitrogen tolerance; X6) The application of the method according to claim 5 or 6 in wheat breeding; X7) The application of detecting the substance in the wheat genome corresponding to nucleotide 4097 of SEQ ID No. 1 in the sequence listing in the selection of wheat with low nitrogen tolerance, wherein the nucleotide in the wheat genome corresponding to nucleotide 4097 of SEQ ID No. 1 in the sequence listing is A or G; X8) The application of detecting the substance in the wheat genome corresponding to nucleotide 4097 of SEQ ID No. 1 in the sequence listing in the preparation and breeding of wheat with excellent low nitrogen tolerance, wherein the nucleotide in the wheat genome corresponding to nucleotide 4097 of SEQ ID No. 1 in the sequence listing is A or G.

9. Wheat breeding methods, including: Nucleotide 4097 of SEQ ID No. 1 in the wheat genome was detected, and wheat with nucleotide G at SEQ ID No. 1 in the wheat genome was selected as the parent for breeding. Homozygous wheat with nucleotide G at position 4097 of SEQ ID No. 1 in the genome exhibits higher low nitrogen tolerance than homozygous wheat with nucleotide A at position 4097 of SEQ ID No. 1 in the genome.

Images