InDel molecular marker and primer for identifying 'Hongyan No.2' coffee variety and application of InDel molecular marker and primer for identifying 'Hongyan No.2' coffee variety

Abstract

The invention provides an InDel molecular marker and a primer for identifying a 'Hongyan No.2' coffee variety and application of the InDel molecular marker and the primer, and belongs to the technical field of coffee variety identification. The invention discloses an InDel molecular marker for identifying a'hot research No.2 'coffee variety. The InDel molecular marker is located in a coffee genome chromosome Chr8c 4606043246060977; the primers are as shown in SEQ ID NO. 1 and SEQ ID NO. 2. When the primer provided by the invention is used for amplifying genome DNA (Deoxyribose Nucleic Acid) of 'Hongyan No.2' coffee, three amplified bands appear at 387bp, 460bp and 689bp, and are obviously different from banding patterns of other coffee varieties, so that the primer disclosed by the invention can be used for accurately identifying the 'Hongyan No.2' coffee variety, and is of great significance for protecting and utilizing the coffee resource.

Description

Technical Field

[0001] The present invention relates to the technical field of coffee variety identification, and in particular to InDel molecular markers, primers and applications thereof for identifying 'Reyan 2' coffee variety. Background Art

[0002] Coffee (Coffea spp.) is known as the first of the world's three major beverage plants. It is a perennial evergreen shrub or small tree of the Rubiaceae family (Rubiaceae). Due to its unique flavor and rich biological functions, it is widely favored by consumers. Hainan is the origin of large-scale coffee cultivation in my country. It has unique geographical and climatic conditions for the development of boutique coffee. After years of development, it has formed national geographical indication products with unique local characteristics such as "Xinglong Coffee" and "Fushan Coffee". In 2020, "Xinglong Coffee" was selected as the first batch of China's 100 geographical indication products protected by the European Union. At present, Hainan, my country has planted 20,000 acres of medium-grain coffee, with an annual output of 1,900 tons of coffee beans, 8,000 tons of processed coffee products, and an annual output value of 1.44 billion yuan, forming Chengmai, Wanning, Baisha, Qiongzhong and other coffee-producing areas. Cultivating high-quality coffee varieties that are adapted to Hainan's regional characteristics is a prerequisite for Hainan to develop a boutique coffee industry.

[0003] The coffee variety 'Reyan 2' is a medium-grain coffee variety mainly planted in Hainan Province. It was selected and bred by the Institute of Spice and Beverages of the Chinese Academy of Tropical Agricultural Sciences and passed the tropical crop variety approval in 2013. The coffee plants of this variety are relatively short and the tree shape is sparse. The main flowering period is early, early maturity, and the maturity period is concentrated. The fruit growth and development period is 300-330 days. The fruit is oval, and the weight of 100 dry beans is 16.2g. After the bud seedlings are planted, a small amount of fruit will be produced in the second year, and the third year will be officially put into production. The fourth to fifth years are the peak production period, with an average annual yield of 4.19 kg of fresh fruit per plant, a fresh-to-dry ratio of 4.39:1, equivalent to an annual yield of 0.96 kg of dry beans per plant, or 106 kg per mu. The raw coffee beans contain 19.22% protein, 5.92% fat, 11.68% total sugar, 4.57% reducing sugar, 4.73% total ash, and 2.4% caffeine. Cultivation and production practices in many places have proved that this variety has strong resistance to rust and has extremely high economic value and promotion and application value.

[0004] 'Reyan 2' coffee has good quality, high price and good profit. In the process of market promotion and sales, it is difficult to distinguish the finished product from other varieties due to its appearance, and there is a lack of 'Reyan 2' coffee variety identification technology, so it is difficult to form brand identification protection for it, so there are phenomena of inferior products being passed off as good ones and impersonation. Therefore, it is urgent to establish 'Reyan 2' coffee variety identification technology to realize the identity of coffee varieties, which is of great significance to promoting the healthy development of Hainan's coffee industry. Summary of the invention

[0005] The purpose of the present invention is to provide InDel primers for identifying the 'Reyan 2' coffee variety and applications thereof, so as to realize the identification of the coffee variety.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an InDel molecular marker for identifying a 'Reyan 2' coffee variety, wherein the InDel molecular marker is located at Chr8c 46060432_46060977 of the coffee genome chromosome.

[0008] The present invention also provides InDel primers for identifying the 'Reyan 2' coffee variety, and the InDel primers are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0009] The present invention also provides the use of the InDel primer in identifying the 'Reyan 2' coffee variety.

[0010] The present invention also provides the use of the InDel primer in preparing a kit for identifying the 'Reyan 2' coffee variety.

[0011] The present invention also provides a kit for identifying the 'Reyan 2' coffee variety, comprising the InDel primers.

[0012] The present invention also provides a method for identifying the 'Reyan 2' coffee variety, comprising the following steps:

[0013] S1. Extracting genomic DNA of the coffee sample to be tested;

[0014] S2. Using the genomic DNA of the coffee sample to be tested as a template, PCR amplification is performed using the InDel primers to obtain a PCR product;

[0015] S3. Perform electrophoresis on the PCR product. If the band pattern of the sample to be tested is consistent with the band of the 'Reyan 2' coffee variety, the sample to be tested is determined to be the 'Reyan 2' coffee variety.

[0016] Preferably, when PCR amplification is performed using the InDel primers, if fragments of 387 bp, 460 bp and 689 bp are amplified, it indicates that the coffee sample to be tested is 'Reyan No. 2' coffee.

[0017] Preferably, the reaction system of the PCR amplification is 10 μL, including 1 μL of genomic DNA of the coffee sample to be tested, 0.5 μL of each of the upstream and downstream primers, 5 μL of 2×TaqPCR premix reagent II, and 3 μL of ddH2O.

[0018] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, annealing at 68°C for 20 s, extension at 72°C for 30 s, with the annealing temperature decreasing by 2°C in each cycle, for a total of 6 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 30 s, with the annealing temperature decreasing by 1°C in each cycle, for a total of 8 cycles; denaturation at 94°C for 20 s, annealing at 50°C for 20 s, extension at 72°C for 30 s, for a total of 20 cycles; final extension at 72°C for 5 min.

[0019] Preferably, the initial concentrations of the upstream and downstream primers are 8 to 12 μM, respectively.

[0020] By adopting the above technical scheme, the present invention has the following beneficial effects: the InDel molecular marker used for identifying the coffee variety 'Reyan 2' is located on the coffee genome chromosome Chr8c46060432_46060977; the primers are shown in SEQ ID NO.1 and SEQ ID NO.2. When the primers provided by the present invention amplify the genomic DNA of 'Reyan 2' coffee, three amplification bands appear at 387bp, 460bp, and 689bp, which are significantly different from the band patterns of other coffee varieties, indicating that the primers of the present application can accurately identify the coffee variety 'Reyan 2', which is of great significance for the protection and utilization of this coffee resource. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the electrophoresis diagram of INDEL marker polymorphism detection of Reyan 2 coffee variety.

[0022] Figure 2 This is the agarose gel electrophoresis diagram of 51 samples of 'Reyan No. 2' coffee and other medium-grain coffee varieties. DETAILED DESCRIPTION

[0023] The present invention provides an InDel molecular marker for identifying a 'Reyan 2' coffee variety, wherein the InDel molecular marker is located at Chr8c 46060432_46060977 of the coffee genome chromosome.

[0024] The present invention also provides InDel primers for identifying the 'Reyan 2' coffee variety, wherein the InDel primers are shown in SEQ ID NO.1 and SEQ ID NO.2:

[0025] SEQ ID NO.1: GTCTTCTAAAAATCATTATACA;

[0026] SEQ ID NO. 2: GGTACATACCTAAAACTGTCACTA.

[0027] The present invention also provides the use of the InDel primer in identifying the 'Reyan 2' coffee variety.

[0028] The present invention also provides a kit for identifying the 'Reyan 2' coffee variety, comprising the InDel primers.

[0029] The present invention also provides a method for identifying the 'Reyan 2' coffee variety, comprising the following steps:

[0030] S1. Extracting genomic DNA of the coffee sample to be tested;

[0031] S2. Using the genomic DNA of the coffee sample to be tested as a template, PCR amplification is performed using the InDel primers to obtain a PCR product;

[0032] S3. Perform electrophoresis on the PCR product. If the band pattern of the sample to be tested is consistent with the band of the 'Reyan 2' coffee variety, the sample to be tested is determined to be the 'Reyan 2' coffee variety.

[0033] The present invention first extracts genomic DNA from a coffee sample to be tested, preferably extracts genomic DNA from leaves of coffee plants to be tested. The present invention has no special limitation on the extraction of genomic DNA from coffee leaves, and a conventional method for extracting genomic DNA in the art can be used. Then, the genomic DNA of the coffee sample to be tested is used as a template, and PCR amplification is performed using the InDel primers to obtain a PCR product; the PCR amplification reaction system is 10 μL, including 1 μL of genomic DNA of the coffee sample to be tested, 0.5 μL of each of 10 μM upstream and downstream primers, 5 μL of 2×TaqPCR premix reagent II, and 3 μL of ddH2O. The reaction procedure of PCR amplification is as follows: 95℃ pre-denaturation for 5min; 94℃ denaturation for 20s, 68℃ annealing for 20s, 72℃ extension for 30s, annealing temperature decreased by 2℃ in each cycle, 6 cycles in total; 94℃ denaturation for 20s, 58℃ annealing for 20s, 72℃ extension for 30s, annealing temperature decreased by 1℃ in each cycle, 8 cycles in total; 94℃ denaturation for 20s, 50℃ annealing for 20s, 72℃ extension for 30s, 20 cycles in total; 72℃ final extension for 5min. The bands of PCR amplification products were detected by 2% agarose gel electrophoresis, and the electrophoresis conditions were set to 120V for 25min. If the band type of the sample to be tested is consistent with the band of the 'Reyan 2' coffee variety, the sample to be tested is determined to be the 'Reyan 2' coffee variety.

[0034] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0035] Example 1. Design and synthesis of primers

[0036] Acquisition of molecular marker primers: First, based on the second-generation sequencing technology, 19 coffee varieties (Reyan 2, RY4, RY3, 4-1, 33-1, 26-1, 29-3, 30-1, 18-2, 20-1, 31-4, 31-2, 28-1, 33-5, 33-4, ZLKF, 24, 24-10, 24-11) were constructed and resequencing was completed. Then, bioinformatics software was used to mine specific InDel sites, and 10 pairs of InDel markers with large fragment deletions or insertions were screened. The primer information is shown in Table 1. Polymorphism detection was performed on these markers ( Figure 1 ), and finally obtained a pair of polymorphic InDel markers (Chr8c_46060432_46060977). The primers were commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis.

[0037] Table 1 InDel marker specific information and primers

[0038]

[0039]

[0040] Example 2. Identification of coffee variety 'Reyan 2'

[0041] A total of 51 samples of the coffee variety 'Reyan 2' and other medium-grain coffee leaf samples were collected from the National Tropical Spice Beverage Crop Germplasm Resource Nursery. The varieties are shown in Table 1:

[0042] Table 1 Varieties of coffee samples to be tested

[0043]

[0044]

[0045] The genomic DNA of the coffee leaf samples was extracted using the CTAB method, and PCR amplification was performed using SEQ ID NO.1 and SEQ ID NO.2 respectively:

[0046] SEQ ID NO.1: GTCTTCTAAAAATCATTATACA;

[0047] SEQ ID NO. 2: GGTACATACCTAAAACTGTCACTA.

[0048] The PCR system was as follows: 1 μL of sample DNA, 0.5 μL of each of the InDel upstream and downstream primers at a concentration of 10 μM, 5 μL of 2×Taq PCR Mix, and 3 μL of ddH2O, for a total of 10 μL.

[0049] The PCR amplification program was as follows: 95°C pre-denaturation for 5 min; 94°C denaturation for 20 s, 68°C annealing for 20 s, 72°C extension for 30 s, annealing temperature decreased by 2°C in each cycle, for a total of 6 cycles; 94°C denaturation for 20 s, 58°C annealing for 20 s, 72°C extension for 30 s, annealing temperature decreased by 1°C in each cycle, for a total of 8 cycles; 94°C denaturation for 20 s, 50°C annealing for 20 s, 72°C extension for 30 s, for a total of 20 cycles; 72°C final extension for 5 min. The amplified products of PCR of the coffee variety 'Reyan 2' are shown in SEQ ID NO.21 to SEQ ID NO.23, respectively.

[0050] SEQ ID NO.21:

[0051] GTCTTCTAAAAATCCATTATACAAAGAAAAATTGTTCTGCTACACAAGACATTGTGCCTATTAACGCAGCTGGAGCAAAACAAATCGGTAATCTACTAATATTTTTCTCATGTTACCATAATTAATATTTCTTGCTATATGTTCTTGGGCATACAATTATTATGTGCTTTATACTTTTCCCATGTTACCATAAT TAATATTTCTTGCTACATGTCCTGGGGCATACAAATGTTATGAGCTTCATACTTTGCTTAATTCTTCTCACATATTATCTCTTGCTATATGTCCTGGTATATGCTCATGTTATGAGCTTTATACCTTTCTTAAAACGACACTTTTAGGGATGTACCTAGGTATGTACCATAGTGACAGTTTTAGGTATGTACC.

[0052] SEQ ID NO.22:

[0053] GTCTTCTAAAAATCCATTATACAACTCCTGAGAATTGTTCTGCTACACAGACATTGTGCCTATTAAGCAGCTGGAGCAAAACAAATCGGTAATCTACTAATATTTTTCTCATGTTACCATAATTAATATTTCTTGCTATATGTTCTTGGGCATACAATTATTATGTGCTTTATACTTTTCTCATGTTATCATAATTAATACCATAATTAATATTTCTTGCTACATGTTTTTGGGCATACAAATATTATGTGCTTTATACTTTTCTCAATTTTTCATAATTAATATTTCTTGCTATATGTTCTTGGGCATACAAATATTATGTGCTTTATACTTTTCTTATATTTACATAATAAATATTTCTTGATATATATTCTTGGGCATACAAATATTATGTGCTTTATACCTTTCATATAGTGACAGTTTTAGGTATGTACCTAGTGACAGTTTTAGGTATGTACC.

[0054] SEQ ID NO.23:

[0055] .

[0056] After PCR amplification, band detection was performed using 2% agarose gel electrophoresis with the electrophoresis condition set at 120V for 25min. Figure 2 shown. Figure 2 The agarose test results of 51 samples of 'Reyan 2' coffee and other medium-grain coffee varieties in this example, sample 5 is the 'Reyan 2' coffee variety, and three bands appear at 387bp, 460bp, and 689bp respectively. The band types of other varieties are different from 'Reyan 2', indicating that the primers of the present application can effectively distinguish the 'Reyan 2' coffee variety.

[0057] As can be seen from the above examples, the present invention provides InDel molecular markers, primers and applications thereof for identifying the 'Reyan 2' coffee variety. The primers of the present invention are used to perform PCR amplification on the sample to be tested, and the identification result can be directly obtained. The method has high accuracy, high throughput and low cost, and can effectively protect the brand of the 'Reyan 2' coffee variety.

[0058] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An InDel molecular marker for identifying the coffee variety 'Reyan 2', characterized in that: The InDel molecular marker is located on the coffee genome chromosome Chr8c 46060432_46060977.

2. InDel primers for identifying the coffee variety 'Reyan 2', characterized in that: The InDel primers are shown as SEQ ID NO.1 and SEQ ID NO.

2.

3. Use of the InDel primers according to claim 2 in identifying the coffee variety 'Reyan 2'.

4. Use of the InDel primers according to claim 2 in preparing a kit for identifying the coffee variety 'Reyan 2'.

5. A kit for identifying the coffee variety 'Reyan 2', characterized in that: Comprising the InDel primer according to claim 2.

6. A method for identifying the coffee variety 'Reyan 2', characterized in that: The following steps are involved: S1. Extracting genomic DNA of the coffee sample to be tested; S2. Using the genomic DNA of the coffee sample to be tested as a template, PCR amplification is performed using the InDel primers described in claim 2 to obtain a PCR product; S3. Perform electrophoresis on the PCR product. If the band pattern of the sample to be tested is consistent with the band of the 'Reyan 2' coffee variety, the sample to be tested is determined to be the 'Reyan 2' coffee variety.

7. The method according to claim 6, characterized in that When PCR amplification is performed using the InDel primers, if fragments of 387 bp, 460 bp and 689 bp are amplified, it indicates that the coffee sample to be tested is 'Reyan No. 2' coffee.

8. The method according to claim 6, characterized in that The PCR amplification reaction system is 10 μL, including 1 μL of genomic DNA of the coffee sample to be tested, 0.5 μL of upstream and downstream primers, 5 μL of 2×Taq PCR premix reagent II, and 3 μL of ddH2O.

9. The method according to claim 6, characterized in that The reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, annealing at 68°C for 20 s, extension at 72°C for 30 s, with the annealing temperature decreasing by 2°C in each cycle, for a total of 6 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 30 s, with the annealing temperature decreasing by 1°C in each cycle, for a total of 8 cycles; denaturation at 94°C for 20 s, annealing at 50°C for 20 s, extension at 72°C for 30 s, for a total of 20 cycles; final extension at 72°C for 5 min.

10. The method according to claim 8, characterized in that The initial concentrations of the upstream and downstream primers are 8-12 μM respectively.

Images