Molecular marker of rice disease resistance gene Xa50 and application

By developing molecular markers and PCR amplification technology for the rice bacterial blight resistance gene Xa50, the problems of high control costs and environmental pollution associated with rice bacterial blight have been solved. This has enabled efficient screening and breeding of disease-resistant varieties, and improved the yield and quality stability of rice.

CN119685524BActive Publication Date: 2025-11-07INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510220401.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2025-11-07
Estimated Expiration
2045-02-27

AI Technical Summary

Technical Problem

Existing technologies cannot effectively utilize genes resistant to bacterial blight, resulting in high costs and severe environmental pollution in the control of bacterial blight in rice. Furthermore, as the virulence of the pathogen changes, traditional resistant varieties are lost, and the breeding of new varieties cannot keep up with the pace of disease development.

Method used

Molecular markers for the rice bacterial blight resistance gene Xa50 were developed. Rice bacterial blight resistance was identified by primer pair PCR amplification technology. Molecular markers closely linked to the Xa50 gene were used for marker-assisted breeding, and materials with missing fragments were selected for breeding to obtain disease-resistant varieties.

Benefits of technology

This has enabled the efficient and economical screening and breeding of broad-spectrum and long-lasting rice varieties resistant to bacterial blight, reducing reliance on chemical control, minimizing environmental pollution, and improving the yield and quality stability of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685524B_ABST
    Figure CN119685524B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker of rice bacterial blight resistance gene Xa50 The molecular marker is not only closely linked with the rice bacterial blight resistance gene Xa50 but also co-segregates with the resistance gene in plant offspring, thereby providing a good way for screening of resistant rice varieties and molecular marker assisted breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and relates to a molecular marker of rice disease-resistant gene Xa50 and application thereof. BACKGROUND

[0002] Rice (Oryza sativa. L) is one of the important food crops in China, and is the staple food of more than half of the population in China, playing a vital role in food production. Ensuring food supply is related to national security and development, and is the main task of promoting agricultural modernization. Rice is threatened by various pathogenic bacteria in production, and rice blast, bacterial blight and sheath blight are the traditional three diseases of rice. Rice bacterial blight (BB) is a bacterial disease caused by gram-negative bacteria Xanthomonas oryzae pv. oryzae (Xoo), which seriously affects the yield and quality of rice. Chemical control and breeding of disease-resistant varieties are generally used to prevent and control bacterial blight, but chemical control not only has high cost and poor effect, but also brings great harm to the environment. It has been proved that the excavation and utilization of new genes resistant to bacterial blight is the most economical and effective way to prevent and control bacterial blight of rice. At present, 48 rice bacterial blight resistance genes (loci) have been excavated, including 31 recessive genes and 17 dominant genes. The isolation and cloning of rice bacterial blight resistance genes lay the foundation for analyzing the mechanism of disease resistance, and are also the prerequisite for breeding bacterial blight resistance genes. At present, 16 rice bacterial blight resistance genes have been successfully isolated and cloned, including 4 recessive genes: xa5, xa13, xa25 and xa41 (t), and 12 dominant genes: Xa1 and alleles Xa2 / Xa31 (t), Xa14, Xa45 (t), Xa3 / Xa26, Xa4, Xa7, Xa10, Xa21, Xa23, Xa27 and Xa47.

[0003] In recent years, with the rapid variation of pathogenic bacteria virulence, the loss of resistance of main cultivars, and the frequent occurrence of disastrous weather, bacterial blight has re-emerged in production, showing the trend of "old disease new outbreak", which seriously threatens the sustainable development of rice production in China. Therefore, it is of great significance for the high and stable yield of rice in China to excavate new bacterial blight resistance resources, perfect the basic theory of disease resistance, and breed new varieties with excellent comprehensive traits and broad-spectrum and durable disease resistance.

[0004] The present inventors locate Xa50 between markers M11-588 and M11-602 at the end of the 11th chromosome of rice, within a range of 147.7 kb, by molecular markers. In order to find molecular markers more closely linked to the Xa50 gene, we plan to develop molecular markers in the Xa50 gene locking interval by using the sequenced genome sequence of Shuhui498, and to provide a basis for breeding assisted by Xa50 molecular markers. SUMMARY

[0005] The present application is based on the stable resistance of rice X315 to bacterial blight, which is identified by inoculation phenotype and continuous self-reproduction of multiple generations. The resistant material is crossed with susceptible material, and the results show that the resistance of the material is controlled by a dominant single gene. Then, according to the sequence of the rice genome reference sequence Shuhui498 (R498) database (https: / / www.mbkbase.org / rice) and the sequence of IR24 of the susceptible material, a molecular marker closely linked to Xa50 is found, and finally the molecular marker of the present application is located.

[0006] The present application provides a molecular marker linked to the rice bacterial blight resistance gene Xa50, which is located on the 11th chromosome of rice, and the physical position is 30735670-30740239, wherein the amplification fragment of the susceptible rice variety is deleted relative to the resistant variety.

[0007] The nucleotide sequence of the susceptible rice is 137bp:

[0008] GACGAAGAGACCCAGGAGCTGTCCCACATGTCAGTCACTTTAGCCTTGCTTGAGAAATAGAAGGATAGCCCGCTCCAGGCCAGGCCAAGCACGCTTAACCTTGGAGTTCTTTGGAGACTGGCTTCCGGAAAAGAAGT (SEQ ID No. 1), and the nucleotide sequence of the resistant rice is 265bp:

[0009] GACGAAGAGACCCAGGAGCTGTCCCACATGTCAGTCACTTTAGCCTTGCTTGAGAAATAGAAGGATAGCCCACTTATATCTGATAGCTTTTATAGGTCATAGACTGCCCTCACAGACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCATGTGCACCCGGAAAGAATTTTCCGGTTGGTCACCCATCCCAAATTGCTCCAGGCCAGGCCAAGCACGCTTAACCTTGGAGTTCTTTGGAGACTGGCTTCCGGAAAAGAAGT (SEQ ID No. 2).

[0010] The present application further provides a primer pair for identifying or assisting in identifying the resistance of rice bacterial blight, which is designed based on the molecular marker linked to the rice bacterial blight resistance gene Xa50.

[0011] Specifically, it is composed of primer A and primer B;

[0012] The primer A is a single-stranded DNA molecule as shown in GACGAAGAGACCCAGGAGCTG (SEQ ID No. 3);

[0013] The primer B is a single-stranded DNA molecule as shown in ACTTCTTTTCCGGAAGCCAGTC (SEQ ID No. 4).

[0014] The application also provides a method for identifying Xa50 gene conferred bacterial blight resistant rice plants or varieties, which comprises the following steps: using the genomic DNA of the rice to be tested as a template, and using the primer pair to perform PCR amplification to obtain a PCR product; and identifying the bacterial blight resistance characteristics of the rice to be tested according to the PCR product:

[0015] Specifically, when the above specific primer pair is used for PCR amplification, the judgment criteria are as follows:

[0016] If the size of the PCR product is 137 bp, the rice to be tested is a candidate susceptible rice variety;

[0017] If the size of the PCR product is 265 bp, the rice to be tested is a candidate resistant rice variety.

[0018] The application also provides the molecular marker linked to the rice bacterial blight resistance gene Xa50, the primer pair, and the application of the method in identifying or assisting in identifying the bacterial blight resistance of rice, or the screening and breeding of rice varieties related thereto.

[0019] Further provided is the application of the method in the assisted breeding of cultivating rice bacterial blight resistant varieties.

[0020] Specifically, the rice material to be tested which does not have a deletion fragment at the molecular marker is further selected for subsequent breeding to obtain a rice bacterial blight resistant variety.

[0021] More specifically, when the above specific primer pair is used for PCR amplification, the rice material to be tested with a PCR product size of 265 bp is selected for subsequent breeding to obtain a rice bacterial blight resistant variety.

[0022] The molecular marker of the application is not only closely linked to the rice bacterial blight resistance gene Xa50 but also co-segregates with the resistance gene in the plant offspring, thus providing a good way for screening resistant rice varieties and molecular marker assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Map of rice bacterial blight resistance gene Xa50.

[0024] Figure 2 M11-533 amplified F2 generation resistant single plant electropherogram.

[0025] Figure 3 M11-533 amplified F2 generation resistant single plant electropherogram.

[0026] Figure 4 M11-533 amplified F2 generation resistant single plant electropherogram. DETAILED DESCRIPTION

[0027] The present application is described in detail below by specific embodiments, so as to better understand the present application, but not constitute a limitation of the present application.

[0028] Example 1

[0029] 1. Plant material

[0030] Rice X315 resistant to bacterial blight was identified by inoculation phenotype and continuously selfed to obtain stable genetic resistance. The susceptible material IR24 was used as the female parent and X315 as the male parent for hybridization. F1 was single plant seed collection and F1 was propagated to F2 segregation population, and 2342 single plants were obtained.

[0031] Rice materials were cultivated in summer in Crop Science Institute of Chinese Academy of Agricultural Sciences and Shunyi Experimental Station, and in winter in Hainan Experimental Station of Crop Science Institute of Chinese Academy of Agricultural Sciences. Routine water and fertilizer management was carried out during the whole growth period.

[0032] 2. Culture and inoculation of Xanthomonas

[0033] Xanthomonas T174 used in the present study was derived from Japan and stored at -80℃ by glycerol method. Xanthomonas stored at -80℃ was thawed on ice, uniformly coated on NA solid medium, and incubated at 28℃ for about 3d. Fresh colonies were picked and coated on new NA medium, and incubated at 28℃ for about 2d to make the strain reach a higher activity. Xanthomonas was eluted with sterilized ddH2O, shaken and adjusted to OD 600 value of 1.0 by spectrophotometer. Rice materials were inoculated by leaf cutting method. After the scissors were dipped in the bacterial solution, fully expanded rice leaf tips about 2cm were cut off. Five leaves were cut per single plant, and at least 3 single plants were inoculated per strain. After two weeks, the length of the lesion was measured, and the phenotype was judged. The resistance and susceptibility standard was as follows: 20% as the resistance and susceptibility limit, >20% as susceptible, 16%-20% as moderately susceptible, 10%-15% as moderately resistant, and <10% as resistant.

[0034] 3. Genetic analysis of resistance

[0035] X315 was crossed with wild type IR24 to obtain F1 generation, and T7174 was inoculated at tillering stage, and all F1 plants showed resistance. F1 was selfed to obtain F2 segregation population, and a total of 2342 single plants were inoculated with T7174 at tillering stage, and 1767 single plants showed resistance, and 575 single plants showed susceptibility. The resistant and susceptible segregation ratio was calculated and chi-square test was performed, and the resistant and susceptible segregation ratio was proved to be in accordance with the Mendelian classical genetic ratio 3:1, indicating that the resistance of the material was controlled by a dominant single gene, and the F2 segregation population could be used for developing Xa50 positioning molecular markers.

[0036] 4. Design of molecular marker primers

[0037] According to the sequence of the rice genome reference sequence Shuhui498 (R498) database (https: / / www.mbkbase.org / rice) and the sequence of IR24 in the experiment, a molecular marker closely linked to Xa50 was found. According to the previous positioning results, the candidate gene was located at the end of rice chromosome 11, and the sequences with differences were found by comparing the sequences of R498 and IR24 in the interval. The primers were designed by using the Primer designing tool of NCBI database (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome), and the product fragment was about 100-500bp, and a total of 80 pairs of primers were designed.

[0038]

[0039] 21 single plants were selected from the F2 population, and the molecular markers with polymorphism were used for linkage analysis of the target gene. According to the preliminary positioning results, new InDel molecular markers were designed in the interval, and the number of F2 resistant single plants was expanded, and the gene was fine-mapped, and finally the candidate interval was determined.

[0040] 5. Extraction of genomic DNA

[0041] CTAB method was used to extract rice genomic DNA, and the specific steps were as follows:

[0042] (1) About 0.1 g of fresh leaves was weighed and placed at the bottom of a 2 mL centrifuge tube, 2 steel balls with a diameter of 3 mm were added, and the tube was cooled in a-80℃ refrigerator for 30 min, and then placed in a plant cell crusher at 1000 rpm for 30 s to crush the rice leaves into powder;

[0043] (2) 600 μL of CTAB extraction solution was added to the centrifuge tube, and the sample powder was mixed with the extraction solution, and then placed in a 65℃ water bath for 30 min, and the centrifuge tube was shaken every 10 min to mix evenly;

[0044] ​(3) Add 600 μL chloroform solution to the centrifuge tube, shake the centrifuge tube vigorously to mix the sample and liquid, place it on the shaker for 10 min, and after standing for 2 min, centrifuge it at 12000 rpm for 10 min;

[0045] (4) Take 400 μL supernatant in a 1.5 mL centrifuge tube, add 400 μL pre-cooled isopropanol solution, gently shake the centrifuge tube until a flocculent precipitate appears, and after standing in a -20°C refrigerator for 30 min, centrifuge it at 12000 rpm for 10 min;

[0046] (5) Discard the supernatant, add 700 μL 75% ethanol solution to the centrifuge tube, and centrifuge it at 12000 rpm for 8 min;

[0047] (6) Discard the supernatant, place the centrifuge tube in the centrifuge at 12000 rpm for 30 s, use a pipette to suck up the remaining small amount of supernatant, and after the centrifuge tube is dry, add 200-400 μL ddH2O. After the DNA is completely dissolved, it can be used for subsequent experiments or stored at -20°C.

[0048] 6. PCR amplification and electrophoresis

[0049] The PCR reaction system uses a 20 μL system: 5 μL of 2x PCR reaction solution, 0.5 μL of each of the forward and reverse primers (10 μmol / L), and ddH2O to 20 μL. The PCR amplification program is: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 55°C-60°C annealing for 15 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 5 min. The PCR product is electrophoresed on a 5% agarose gel (120 V constant voltage, about 15 min), and after electrophoresis, the gel is imaged and read.

[0050] 7. Fine mapping of Xa50

[0051] Eighty pairs of primers were used to amplify the DNA of X315 and IR24, and 18 pairs of markers were detected to be polymorphic between the parents by agarose gel electrophoresis. Eighty pairs of primers were used as polymorphic markers to fine map 575 F2 generation susceptible single plants. M11-588 detected two susceptible single plants with parental banding patterns, i.e. heterozygous banding patterns, indicating that two single plants had undergone exchange; M11-602 primer detected one single plant with parental banding patterns, indicating that one single plant had undergone exchange. See Table 1 for partial polymorphic marker sequences. Since the exchange single plants detected by M11-588 and M11-602 are different, it is judged that Xa50 is between markers M11-588 and M11-602, with a physical distance of 147.7 kb. Figure 1 ).

[0052] Table 1

[0053]

[0054] Example 2

[0055] Molecular detection of F2 population single plants

[0056] Molecular detection of F2 population single plants with polymorphic marker M11-533: the resistant single plants were amplified with M11-533, two band types were amplified, the same band type as X315 and hybrid band type Figure 2 ); the susceptible single plants were amplified with M11-533, the amplified DNA band type of all single plants was the same as the susceptible parent IR24, without the band type of X315, indicating that no chromosomal crossover event occurred in the F2 susceptible single plants Figure 3 ), the above results show that marker M11-533 is co-segregated with Xa50 gene.

[0057] Example 3

[0058] Molecular detection of different varieties with marker M11-533, since marker M11-533 is co-segregated with Xa50, the varieties containing Xa50 gene can amplify the DNA fragment with the same band type as X315, the PCR product is 265 bp, the varieties without Xa50 cannot amplify the DNA fragment with the same band type as X315, the PCR product size is 137 bp, as shown in Figure 4 . The amplified band types of materials NH001, NH036, NH042, NH057, NH079 and X315 are the same, the PCR product size is 265 bp; materials NH018, NH153N, H197, NH196 cannot amplify the band, the PCR product size of NH212 and NH235 is 137 bp. The resistance of the test materials was identified according to the artificial inoculation method in Example 1, NH001, NH036, NH042, NH057, NH079 are resistant varieties to bacterial blight; materials NH018, NH153N, H197, NH196, NH212 and NH235 are susceptible materials to bacterial blight (Table 2).

[0059] Table 2 Genotype and bacterial blight resistance identification results of tested rice varieties

[0060] Rice variety PCR product size (bp) Lesion length (cm) X315 265 0.13±0.05 NH001 265 0.13±0.05 NH036 265 0.67±0.24 NH042 265 0.67±0.24 NH056 265 0.23±0.19 NH057 265 0.93±0.09 NH079 265 0.47±0.05 NH017 137 12.67±0.94 NH018 137 16.67±0.47 NH073 137 15.67±1.70 NH074 137 15.33±0.94 NH173 137 23.17±0.81 NH187 137 17.67±1.11

Claims

1. An identification method Xa50 The method for genetically conferring resistance to bacterial blight in rice plants or varieties is characterized by: Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 2. A rice bacterial blight resistance gene Xa50 Molecular markers linked to the gene, primer pairs for amplifying the molecular markers, and the method of claim 1 for use in identifying or assisting in identifying rice varieties resistant to bacterial blight. The rice blast resistance gene Xa50 The linked molecular marker is located on the 11th chromosome of rice, with a physical position of 30735670-30740239, wherein the susceptible rice variety has a deletion of the amplified fragment at this position relative to the disease-resistant variety; wherein, Xa50 Xa50 4. The method of claim 3, wherein, Xa50 5. The method of claim 4, wherein, Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa50 Xa