Primer probe composition, kit and detection method for genotyping detection of human papilloma virus

Abstract

The invention discloses a primer probe composition, a kit and a detection method for genotyping detection of human papilloma virus, which are characterized in that a technical principle of combining PCR (Polymerase Chain Reaction) amplification with melting curve analysis is utilized, a conserved sequence is screened as a detection target by analyzing the difference of different types of gene sequences of the human papilloma virus, and a specific primer probe of an HPV L1 region is designed; high-sensitivity and high-specificity amplification is realized by adopting a modified universal primer and a type-specific probe, the complexity of the system is reduced, and the kit can be used for genotyping detection of 20 human papilloma viruses.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a primer-probe combination, a kit and a detection method for human papillomavirus gene typing detection. Background Art

[0002] Human papillomavirus (HPV) belongs to the papillomaviridae family and is a small, non-enveloped, circular double-stranded DNA virus. HPV that infects the genital tract and anus can be divided into two categories: low-risk and high-risk types, according to the pathogenicity or carcinogenicity of each genotype. It has been reported that high-risk HPV DNA was detected in 99.7% of cervical cancer patients, of which HPV16, 18, 45 and 31 accounted for 80%, and low-risk HPV is generally associated with genital warts or low-grade squamous intraepithelial lesions. Cervical cancer has become a public health issue that seriously threatens women's health. Therefore, rapid and accurate detection of high-risk HPV infection is of great significance for early treatment and reducing the incidence and mortality of cervical cancer.

[0003] HPV gene detection has been more widely used as a screening method for cervical cancer. Compared with traditional cytological detection methods, molecular detection methods do not need to wait until cells change to distinguish HPV infection. They can screen out the virus in the earliest stage of viral infection during the latent period when the virus infects cells but has not yet shown symptoms. The current HPV genotyping detection methods are: 1. In situ hybridization technology: nucleic acid probes (DNA or RNA) are used to perform in situ hybridization reactions with samples. The advantage of in situ hybridization is that suspicious cells can be located and it has a semi-quantitative function; the disadvantages are low sensitivity, high sample quality requirements, large labor workload, high cost, and each type of HPV requires a corresponding probe. 2. PCR reverse dot hybridization method: PCR in vitro amplification and DNA reverse dot hybridization are combined. Using the genetic characteristics of HPV to design specific primers, the target fragment containing the HPV genotype can be amplified, and then the amplified product can be hybridized with the typing probe fixed on the membrane strip. The presence of these HPV genotypes can be judged based on the presence or absence of hybridization signals, which can be used for auxiliary diagnosis of clinical HPV infection. The biggest disadvantage of this method is that contamination is prone to occur during the hybridization process, which affects the result judgment. 3. Flow fluorescence hybridization method: This technology hybridizes the PCR amplification product with the cross-linked fluorescent marker probe on the microsphere, and finally detects the fluorescent signal on the multifunctional flow dot array instrument. Disadvantages: The operation is complicated and cumbersome, expensive and requires professional technicians to operate. 4. PCR-Taqman MGB probe typing method is currently a commonly used detection method because of its simple operation, accurate typing, and closed-tube operation throughout the process. However, due to the limitations of the instrument's signal acquisition channel, each reaction can only detect a limited number of HPV types, and the throughput is low. When multi-tube detection is adopted, the economic cost and time cost of the detection will be greatly increased. 5. Melting curve method: Add probes labeled with fluorescent groups and quenching groups to the PCR system, amplify single-stranded oligonucleotide sequences complementary to the probe sequence during the PCR process, and add a melting curve analysis process after amplification to obtain a melting curve and obtain the melting point (Tm value) of each type. However, the disadvantage is that the melting point ranges of the melting peaks between the various targets are close, and adjacent melting peaks are prone to interfere with each other, resulting in fusion peaks. 6. Multiple melting curve method: Based on the melting curve technology and combined with the TaqMan probe detection method, TaqMan probes that bind to the target are designed. The Tm values ​​of the probes are different, and the melting peak Tm produced is also different, so that a single fluorescence can detect multiple target genes.

[0004] Among the existing HPV detection products on the market, some products do not have typing functions, and in HPV fluorescent typing products, each channel can only detect one target, and the single test sample throughput is small, which greatly increases the reagent cost and labor cost. There are few approved melting curve typing detection products, and the sensitivity is not high. The detection limit is 500-1000 copies / reaction, which is significantly lower than other methodological detection products. Therefore, the existing technology generally has the disadvantages of long detection time, insufficient typing quantity, unclear typing, and low sensitivity. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a primer-probe combination, a kit and a detection method for human papillomavirus genotyping detection, which solve the problems in the above-mentioned background technology.

[0006] The technical solution adopted by the present invention to solve the technical problem is: providing a primer-probe combination for human papillomavirus genotyping detection, comprising a universal primer set and a probe set; the sequence of the universal primer set is as shown in SEQ ID No. 1 to No. 10:

[0007] Table 1 Sequences of universal primer sets

[0008]

[0009]

[0010] The sequences of the probe groups are shown in SEQ ID No. 11 to No. 30:

[0011] Table 2 Sequences of probe sets

[0012] Number HPV Type Probe Name Probe Sequence SEQ ID No.11 HPV-6 HPV-6-P1 AACTACATCTTCCACA SEQ ID No.12 HPV-39 HPV-39-P1 CTATAGAGTCTTCCATACCTTCTACA SEQ ID No.13 HPV-53 HPV-53-P7 CTTTCTGCAACCACACAGTCTATGTCC SEQ ID No.14 HPV-11 HPV-11-P1 CTGTGTCTAAATCTGC SEQ ID No.15 HPV-45 HPV-45-P1 AAATCCTGTGCCAAGTACATAT SEQ ID No.16 HPV-56 HPV-56-P3 CTGCTACAGAACAGTTAAGTAAATATGATG SEQ ID No.17 HPV-16 HPV-16-P1 CCATATCTACTTCAGAAA SEQ ID No.18 HPV-51 HPV-51-P2 CGGTTTCCCCAACATTTAC SEQ ID No.19 HPV-73 HPV-73-P2 TACACAGGCTAGTAGCTCTA SEQ ID No.20 HPV-35 HPV-35-P2 TGTCTWCTAGTGAC SEQ ID No.21 HPV-18 HPV-18-P2 CCTGGGCAATATGAT SEQ ID No.22 HPV-59 HPV-59-P3 CCAATCTTTCTGTGTGTGCTTCTACTAC SEQ ID No.23 HPV-26 HPV-26-P1 TAGTACATTATCTGCAGCA SEQ ID No.24 HPV-66 HPV-66-P3 TGCAGCTAAAAGCACATTAACTAAATATGATGCAC SEQ ID No.25 HPV-31 HPV-31-P1 AATTGCAAACAGTGATACT SEQ ID No.26 HPV-68 HPV-68-P2 CTACTGAATCAGCTGTACCAAA SEQ ID No.27 HPV-33 HPV-33-P2 TGCACACAAGTAACTAGT SEQ ID No.28 HPV-58 HPV-58-P2 TGCACTGAAGTAACTAAGGAAGGTAC SEQ ID No.29 HPV-82 HPV-82-P3 AATTTAACCATTAGCACTGCTG SEQ ID No.30 HPV-52 HPV-52-P2 CACTAACATGACTTTATGTGCTGAGGT

[0013] In a preferred embodiment of the present invention,

[0014] The probe sequence for detecting HPV6 is as shown in SEQ ID No. 11;

[0015] The probe sequence for detecting HPV39 is as SEQ ID No. 12;

[0016] The probe sequence for detecting HPV53 is as SEQ ID No. 13;

[0017] The probe sequence for detecting HPV11 is as SEQ ID No. 14;

[0018] The probe sequence for detecting HPV45 is as SEQ ID No. 15;

[0019] The probe sequence for detecting HPV56 is as SEQ ID No. 16;

[0020] The probe sequence for detecting HPV16 is as SEQ ID No. 17;

[0021] The probe sequence for detecting HPV51 is as SEQ ID No. 18;

[0022] The probe sequence for detecting HPV73 is as SEQ ID No. 19;

[0023] The probe sequence for detecting HPV35 is as SEQ ID No. 20;

[0024] The probe sequence for detecting HPV18 is as SEQ ID No. 21;

[0025] The probe sequence for detecting HPV59 is as SEQ ID No. 22;

[0026] The probe sequence for detecting HPV26 is as SEQ ID No. 23;

[0027] The probe sequence for detecting HPV66 is as SEQ ID No. 24;

[0028] The probe sequence for detecting HPV31 is as SEQ ID No. 25;

[0029] The probe sequence for detecting HPV68 is as SEQ ID No. 26;

[0030] The probe sequence for detecting HPV33 is as SEQ ID No. 27;

[0031] The probe sequence for detecting HPV58 is as SEQ ID No. 28;

[0032] The probe sequence for detecting HPV82 is as SEQ ID No. 29;

[0033] The probe sequence for detecting HPV52 is shown as SEQ ID No.30.

[0034] In a preferred embodiment of the present invention, it also includes human β-globin gene internal reference primer probe sequences such as SEQ ID No.31 to No.33:

[0035] Table 3 Internal reference primer probe sequences

[0036] Number Primer and Probe Name Primer probe sequence SEQ ID No.31 β-globin-F5-2 TTCACTAGCAACCTCAAACAGA SEQ ID No.32 β-globin-P6 TGAAGTTGGTGGTGAGGCCCTGGGCAG SEQ ID No.33 β-globin-R6 CTATTGGTCTCCTTAAACCTGTC

[0037] The present invention also provides a kit for detecting human papillomavirus genotyping, comprising the primer-probe combination for detecting human papillomavirus genotyping as described above.

[0038] In a preferred embodiment of the present invention, the kit includes an HPV-A group reaction solution and an HPV-B group reaction solution, wherein: the HPV-A group reaction solution includes probes with sequences such as SEQ ID No.11 to No.20; the HPV-B group reaction solution includes probes with sequences such as SEQ ID No.21 to No.30; and the reaction solution also includes an internal reference primer probe and materials required for PCR.

[0039] The present invention also provides a method for detecting human papillomavirus genotyping for the purpose of non-disease diagnosis and / or treatment, comprising the following steps:

[0040] S1. Design specific primers and probes according to the HPV type L1 region DNA, the sequences of the universal primer set are as SEQ ID No.1 to No.10; the sequences of the probe set are as SEQ ID No.11 to No.30;

[0041] S2. Design a pair of internal reference primer probes based on human βglobin gene, the sequences are as SEQ ID No.31-No.33;

[0042] S3. The probes of sequences such as SEQ ID No.11 to No.20 and the internal reference primer probes are combined with materials required for PCR to form an HPV-A group reaction solution; the probes of sequences such as SEQ ID No.21 to No.30 and the internal reference primer probes are combined with materials required for PCR to form an HPV-B group reaction solution;

[0043] S4. After adding sample nucleic acid to the two reaction solutions, amplification is performed on a fluorescent PCR instrument using asymmetric PCR amplification technology combined with melting curve analysis;

[0044] S5. Determine whether the sample is positive based on the fluorescence amplification signals of different channels, and type the positive nucleic acid using the melting curve analysis results in the corresponding fluorescence channel.

[0045] In a preferred embodiment of the present invention, in step S4, the PCR reaction system is prepared including 10-20 μL of nucleic acid amplification reaction solution, 10-20 μL of primer probe reaction solution and 1-5 μL of sample nucleic acid to be tested.

[0046] In a preferred embodiment of the present invention, the amplification program is: pre-denaturation at 94°C for 4 min; pre-amplification stage denaturation, annealing, extension and fluorescence detection conditions are: 94°C for 20 s, 58°C for 30, 71°C for 30 s, 15 cycles; PCR cycle stage denaturation, annealing, extension and fluorescence detection conditions are: 94°C for 20 s, 55°C for 30, 71°C for 30 s, 30 cycles, fluorescence detection at 71°C; melting stage at 72°C for 4 min, 95°C for 2 min, 40°C for 20 s, fluorescence collection at 40°C to 80°C, 1 cycle.

[0047] In a preferred embodiment of the present invention, the typing method in step S5 is specifically as follows:

[0048] HPV-A group reaction solution:

[0049] The HPV types corresponding to the melting curve analysis of the FAM channel were HPV6 and HPV39;

[0050] The HPV types corresponding to the melting curve analysis of the VIC channel are HPV11, HPV45, and HPV56;

[0051] The HPV types corresponding to the melting curve analysis of the ROX channel were HPV16, HPV51, and HPV73;

[0052] The HPV types corresponding to the melting curve analysis of the CY5 channel are HPV35, HPV52, and the internal reference gene β-globin;

[0053] HPV-B group reaction solution:

[0054] The HPV types corresponding to the melting curve analysis of the FAM channel were HPV18, HPV53, and HPV66;

[0055] The HPV types corresponding to the melting curve analysis of the VIC channel are HPV31 and HPV68;

[0056] The HPV types corresponding to the melting curve analysis of the ROX channel were HPV33, HPV26, and HPV58;

[0057] Melting curve analysis of CY5 channel corresponds to HPV82, HPV59, and internal reference gene β-globin.

[0058] In a preferred embodiment of the present invention, the judgment standard in step S5 is:

[0059] Table 4

[0060]

[0061]

[0062] Compared with the background technology, this technical solution has the following advantages:

[0063] 1. The rapid detection method of the present invention is based on real-time fluorescence PCR, which combines the melting curve analysis technology (Multicolor Melting Curve Analysis, MMCA) based on the probe method and the melting curve analysis method, and designs TaqMan probes that bind to the target. The Tm values ​​of the probes are different, and the melting peak Tm values ​​generated are also different, so that a single fluorescence can detect multiple target genes, breaking through the limitation of the number of single-tube closed detection of traditional real-time fluorescence PCR technology is limited by the number of fluorescence channels of the PCR instrument.

[0064] 2. The present invention designs specific end-blocked multiple asymmetric PCR primers and corresponding specific fluorescent probes for different segments of 20 high-risk, potential high-risk and low-risk HPV virus genomes and the internal reference gene β-globin, and uses asymmetric PCR amplification combined with multiple melting curve technology to simultaneously detect 20 typings on four fluorescent channels in two reaction wells, which is easy to operate and inexpensive;

[0065] 3. The primers of the present invention are designed in the conserved region, and different subtypes can share the same primers, which reduces the number of primers, reduces the inhibition between the primers and probes in the reaction system, and improves the sensitivity;

[0066] 4. The present invention solves the problems of long detection time, insufficient typing quantity, unclear typing and low sensitivity of traditional technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 a and b are the melting peak curves and amplification efficiency comparisons of the universal primer and the specific primer in Example 1;

[0068] Figure 2 a and b are the melting curve peaks of each type in tube A and tube B in Example 2;

[0069] Figure 3 a and b are the original melting curve and amplification curve in Example 3. DETAILED DESCRIPTION

[0070] The present invention is described in detail below with reference to the accompanying drawings and embodiments.

[0071] Example 1

[0072] This embodiment designs universal primers for HPV types with high homology, and in probe design, selects highly specific segments as probe sequences, and provides a primer-probe combination for genotyping detection of 20 types of human papillomavirus, including a universal primer set and a probe set; the sequence of the universal primer set is such as SEQ ID No.1 to No.10; the sequence of the probe set is such as SEQ ID No.11 to No.30.

[0073] Three sample reaction systems were prepared according to SEQ ID No. 11 to No. 30 to evaluate the amplification efficiency of the primer probe.

[0074] Table 5 Sample reaction system

[0075] ct value Universal primers Specific primers Sample 1 21.02 21.87 Sample 2 19.71 20.09 Sample 3 20.66 22.13

[0076] Combining Table 5 and Figure 1 The detection results of a and b show that when universal primers are selected, the number of primers can be significantly reduced, the mutual inhibition between primer probes can be reduced, and the reaction can be made more efficient.

[0077] Example 2

[0078] This embodiment provides a kit for human papillomavirus genotyping detection, comprising the primer-probe combination of embodiment 1.

[0079] In this example, 20 high-risk human papillomavirus DNAs in the second-generation human papillomavirus L1 genotyping national reference materials were used as templates, and a kit was used for real-time fluorescence PCR detection. The specific steps are as follows:

[0080] (1) Establishing PCR reaction system

[0081] Using the probes and specific primers designed above, take 5 μL of reference DNA as a reaction template and amplify using the following PCR reaction system:

[0082] Table 6 PCR amplification reaction system

[0083]

[0084]

[0085] Place the PCR reaction tube with template added into the real-time fluorescence PCR detector and proceed according to the following amplification program: pre-denaturation at 94℃ for 4min; pre-amplification stage denaturation, annealing, extension and fluorescence detection conditions are as follows: 94℃ for 20s, 58℃ for 30, 71℃ for 30s, 15cycles; PCR cycling stage denaturation, annealing, extension and fluorescence detection conditions are as follows: 94℃ for 20s, 55℃ for 30, 71℃ for 30s, 30cycles, fluorescence detection at 71℃; melting section at 72℃ for 4min, 95℃ for 2min, 40℃ for 20s, fluorescence collection at 40℃-80℃, 1cycle.

[0086] (2) The test results were determined according to the Ct value displayed by the fluorescent PCR amplification instrument, as shown in Table 7:

[0087] Table 7

[0088]

[0089] Combining the above table with Figure 2 The experimental results of a and b prove that, through the detection of various types of HPV samples of national reference materials, the human papillomavirus detection and typing method of the present invention can accurately detect and type 20 types of human papillomavirus, and the melting curve peaks of each type are far apart and will not interfere with each other.

[0090] Example 3

[0091] This example adopts the kit for human papillomavirus genotyping detection in Example 2, using 20 high-risk human papillomavirus DNAs in the second-generation human papillomavirus L1 genotyping national reference materials as templates, at a rate of 2 copies / reaction, 2×10 1 copies / reaction, 2×10 2 copies / reaction, 2×10 3 10 copies / reaction were added to the reaction wells, and the primers and probes designed in Tables 1 to 3 and the reaction system established in Table 5 were used for detection. 1 When there are 100 copies / reaction, there is an obvious amplification curve, see Figure 3 The detection limit is 2×10 1 copies / reaction.

[0092] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some or all of the technical features thereof may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer-probe combination for human papillomavirus genotyping detection, characterized in that: It comprises a universal primer set and a probe set; the sequence of the universal primer set is such as SEQ ID No.1 to No.10; the sequence of the probe set is such as SEQ ID No.11 to No.

30.

2. A primer-probe combination for human papillomavirus genotyping detection according to claim 1, characterized in that: in, The probe sequence for detecting HPV6 is as shown in SEQ ID No. 11; The probe sequence for detecting HPV39 is as SEQ ID No. 12; The probe sequence for detecting HPV53 is as SEQ ID No. 13; The probe sequence for detecting HPV11 is as SEQ ID No. 14; The probe sequence for detecting HPV45 is as SEQ ID No. 15; The probe sequence for detecting HPV56 is as SEQ ID No. 16; The probe sequence for detecting HPV16 is as SEQ ID No. 17; The probe sequence for detecting HPV51 is as SEQ ID No. 18; The probe sequence for detecting HPV73 is as SEQ ID No. 19; The probe sequence for detecting HPV35 is as SEQ ID No. 20; The probe sequence for detecting HPV18 is as SEQ ID No. 21; The probe sequence for detecting HPV59 is as SEQ ID No. 22; The probe sequence for detecting HPV26 is as SEQ ID No. 23; The probe sequence for detecting HPV66 is as SEQ ID No. 24; The probe sequence for detecting HPV31 is as SEQ ID No. 25; The probe sequence for detecting HPV68 is as SEQ ID No. 26; The probe sequence for detecting HPV33 is as SEQ ID No. 27; The probe sequence for detecting HPV58 is as SEQ ID No. 28; The probe sequence for detecting HPV82 is as SEQ ID No. 29; The probe sequence for detecting HPV52 is shown as SEQ ID No.

30.

3. The primer-probe combination for human papillomavirus genotyping detection according to claim 1, characterized in that: It also includes human β-globin gene internal reference primer probe sequences such as SEQ ID No.31 to No.

33.

4. A kit for human papillomavirus genotyping detection, characterized in that: The invention comprises a primer-probe combination for detecting human papillomavirus genotyping as described in any one of claims 1 to 3.

5. A kit for human papillomavirus genotyping detection according to claim 4, characterized in that: It comprises an HPV-A group reaction solution and an HPV-B group reaction solution, wherein: the HPV-A group reaction solution comprises probes with sequences such as SEQ ID No.11 to No.20; the HPV-B group reaction solution comprises probes with sequences such as SEQ ID No.21 to No.

30.

6. A method for detecting human papillomavirus genotyping, characterized in that: The following steps are involved: S1. Design specific primers and probes according to the HPV type L1 region DNA, the sequences of the universal primer set are as SEQ ID No.1 to No.10; the sequences of the probe set are as SEQ ID No.11 to No.30; S2. Design a pair of internal reference primer probes based on human βglobin gene, the sequences are as SEQ ID No.31-No.33; S3. The probes of sequences such as SEQ ID No.11 to No.20 and the internal reference primer probes are combined with materials required for PCR to form an HPV-A group reaction solution; the probes of sequences such as SEQ ID No.21 to No.30 and the internal reference primer probes are combined with materials required for PCR to form an HPV-B group reaction solution; S4. After adding sample nucleic acid to the two reaction solutions, amplification is performed on a fluorescent PCR instrument using asymmetric PCR amplification technology combined with melting curve analysis; S5. Determine whether the sample is positive based on the fluorescence amplification signals of different channels, and type the positive nucleic acid using the melting curve analysis results in the corresponding fluorescence channel.

7. A method for detecting human papillomavirus genotyping according to claim 6, characterized in that: In step S4, the PCR reaction system is prepared including 10 to 20 μL of nucleic acid amplification reaction solution, 10 to 20 μL of primer probe reaction solution and 1 to 5 μL of sample nucleic acid to be tested.

8. A method for detecting human papillomavirus genotyping according to claim 6, characterized in that: The amplification program was as follows: pre-denaturation at 94°C for 4 min; pre-amplification stage denaturation, annealing, extension and fluorescence detection conditions were as follows: 94°C for 20 s, 58°C for 30, 71°C for 30 s, 15 cycles; PCR cycle stage denaturation, annealing, extension and fluorescence detection conditions were as follows: 94°C for 20 s, 55°C for 30, 71°C for 30 s, 30 cycles, fluorescence detection at 71°C; melting section at 72°C for 4 min, 95°C for 2 min, 40°C for 20 s, fluorescence collection at 40°C-80°C, 1 cycle.

9. A method for detecting human papillomavirus genotyping according to claim 6, characterized in that: The typing method in step S5 is specifically: HPV-A group reaction solution: The HPV types corresponding to the melting curve analysis of the FAM channel were HPV6 and HPV39; The HPV types corresponding to the melting curve analysis of the VIC channel are HPV11, HPV45, and HPV56; The HPV types corresponding to the melting curve analysis of the ROX channel were HPV16, HPV51, and HPV73; The HPV types corresponding to the melting curve analysis of the CY5 channel are HPV35, HPV52, and the internal reference gene β-globin; HPV-B group reaction solution: The HPV types corresponding to the melting curve analysis of the FAM channel were HPV18, HPV53, and HPV66; The HPV types corresponding to the melting curve analysis of the VIC channel are HPV31 and HPV68; The HPV types corresponding to the melting curve analysis of the ROX channel were HPV33, HPV26, and HPV58; Melting curve analysis of CY5 channel corresponds to HPV82, HPV59, and internal reference gene β-globin.

10. A method for detecting human papillomavirus genotyping according to claim 6, characterized in that: The judgment criteria in step S5 are:

Images