Fluorescent MIRA kit and method for detecting monkey varicella virus

Abstract

The invention discloses a fluorescent MIRA kit and method for detecting a monkey varicella virus, and relates to the technical field of biology.The kit comprises a primer probe combination, a buffer solution A, a buffer solution B, freeze-dried enzyme powder and a nucleic acid extraction.The primer probe combination is optimally designed and synthesized on the basis of a monkey varicella virus ORF21 gene conserved sequence; according to the present invention, the monkey varicella virus detection method is established and optimized, and the reaction system is further constructed, such that the optimal reaction condition and the optimal primer pair are determined, the monkey varicella virus detection method is established and optimized, and the constructed detection method has advantages of high sensitivity, good specificity, simple operation, fast detection speed, low cost, and wide application prospect. The kit has an important application value in detecting whether a sample contains the monkey varicella virus or not.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a fluorescence MIRA kit for detecting simian varicella virus and a method thereof. Background Art

[0002] Simian varicella virus (SVV) is an alpha herpesvirus with significant neurotropism, mainly infecting Old World monkeys. SVV has a high genetic homology with human varicella-zoster virus (VZV) (the similarity of ORF amino acid sequences reaches 27%-75%) and a similar pathogenic mechanism, and is mainly transmitted through respiratory droplets and direct contact. After infection, it can cause typical varicella-like symptoms, including fever, lymphoid tissue lesions and systemic herpes. It is worth noting that about 77% of seropositive animals show a latent infection state, the virus establishes a lifelong latency in the sensory ganglia, and can reactivate under immunosuppressive conditions to cause herpes zoster.

[0003] SVV has caused severe epidemics in captive primates many times, which are characterized by high morbidity and high mortality. Historical records show that the mortality rate of many epidemics is as high as 40%-50%. Epidemiological studies have shown that the infection rate of wild monkey populations is relatively low (about 0.8%), but the infection rate can significantly increase to more than 40% after captivity. There are obvious differences in the susceptibility of different species to SVV: African monkeys often show more severe symptoms, while Asian macaques mostly show asymptomatic infection or mild symptoms.

[0004] In view of the important impact of SVV on the health of primates, rapid and accurate diagnosis of SVV is of great significance for the early detection and effective control of diseases. Currently, the commonly used SVV detection methods mainly include:

[0005] 1. Virus isolation: The sensitivity is about 60-70%, the detection period is as long as 4-6 weeks, and professional cell culture facilities are required;

[0006] 2. Conventional PCR: The detection limit is about 10 3 -10 4 copies / mL, it takes 3-4 hours to complete, and it is highly dependent on equipment;

[0007] 3. Serological detection: The sensitivity is 70-80%, there is a window period of 2-3 weeks, and it is difficult to make an early diagnosis.

[0008] These traditional methods have problems such as long detection period, complex operation, high equipment dependence or limited early diagnosis ability, and it is difficult to meet the needs of rapid screening and on-site diagnosis in farms.

[0009] In recent years, the Multienzyme Isothermal Rapid Amplification (MIRA) technology has provided a new nucleic acid detection method. This technology uses recombinase to form a nucleoprotein filament complex with specific primers, which, with the assistance of single-stranded DNA binding protein (SSB), recognizes and invades double-stranded DNA targets. The primer ends are extended under the action of DNA polymerase, and single-stranded DNA is released during the strand displacement process. This isothermal amplification method avoids the denaturation-annealing-extension cycle process of traditional PCR and can complete nucleic acid amplification within 20 minutes under the constant temperature condition of 37-42°C.

[0010] Compared with traditional PCR, MIRA has three major advantages: more flexible primer design, and only a single pair of primers is required to achieve efficient amplification; the reaction time is shortened by more than 60%; no complex instruments are needed, which is suitable for on-site detection. MIRA technology has been successfully used for the rapid detection of various pathogens, including Escherichia coli, Chicken parvovirus, Trichomonas vaginalis, Group B Streptococcus, Largemouth bass rhabdovirus, etc.

[0011] Although MIRA technology has shown good application prospects in the detection of other pathogens, it has not been studied and applied in the field of SVV detection. Therefore, developing a rapid detection method for SVV based on MIRA technology is of great significance for improving the diagnostic efficiency of SVV infection, reducing economic losses, and ensuring the health of experimental animals. Summary of the Invention

[0012] The purpose of the present invention is to make up for the deficiencies of the existing technology and provide a fluorescent MIRA kit and method for detecting simian varicella virus. It can design a specific primer-probe combination (SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 10) based on the conserved sequence of the SVV ORF21 gene through the kit, and combined with the isothermal amplification technology, it can complete the detection within 20 minutes at 42°C. This method has high sensitivity, strong specificity, and simple operation, and is suitable for rapid screening of clinical samples and on-site diagnosis.

[0013] To solve the above technical problems, the present invention provides the following technical solutions: On the one hand, a fluorescent MIRA kit for detecting simian varicella virus, and the composition components of the kit include: primer-probe combination, Buffer A, Buffer B, freeze-dried enzyme powder, nucleic acid extraction reagent;

[0014] The primer-probe combination is designed for the ORF21 gene of simian varicella virus and includes an upstream primer, a downstream primer, and a probe;

[0015] The Buffer A and Buffer B are A Buffer and B Buffer, which are used to provide the ionic environment of the reaction system;

[0016] The freeze-dried enzyme powder contains recombinant enzyme, single-stranded binding protein SSB and DNA polymerase;

[0017] The nucleic acid extraction reagent is used to extract viral nucleic acid from a sample to be tested.

[0018] Furthermore, the primer-probe combination is selected from:

[0019] Combination 1: upstream primer F1 shown in SEQ ID NO: 2, downstream primer R1 shown in SEQ ID NO: 3, probe Probe1 shown in SEQ ID NO: 4;

[0020] Combination 2: upstream primer F2 shown in SEQ ID NO: 5, downstream primer R2 shown in SEQ ID NO: 6, probe Probe2 shown in SEQ ID NO: 7;

[0021] Combination 3: upstream primer F3 shown in SEQ ID NO: 8, one of the downstream primers shown in SEQ ID NO: 9, SEQ ID NO: 11 - SEQ ID NO: 16, probe Probe3 shown in SEQ ID NO: 10.

[0022] Even further, the primer-probe combination is Combination 3, wherein the upstream primer sequence is as shown in SEQ ID NO: 8, the downstream primer sequence is as shown in SEQ ID NO: 14, and the probe sequence is as shown in SEQ ID NO: 10.

[0023] Even further, the 30th base T from the 5'-end of the probe is labeled with a FAM group, the 31st base is replaced by tetrahydrofuran THF, the 32nd base T is labeled with a BHQ group, and the 3'-end is blocked with a C3 spacer modification.

[0024] Even further, the reaction system of the kit includes: 29.4 μL of A Buffer, 2 μL of upstream primer, 2 μL of downstream primer, 0.6 μL of probe, 5 μL of nucleic acid template, 2.5 μL of B Buffer, and ddH2O is added to make up to 50 μL. Among them, the concentration of the upstream primer is 10 μmol / L, the concentration of the downstream primer is 10 μmol / L, and the concentration of the probe is 10 μmol / L.

[0025] Even further, the reaction system also contains the freeze-dried enzyme powder.

[0026] On the other hand, a fluorescence MIRA kit method for detecting simian varicella virus, and the application steps of this method in the detection of simian varicella virus are:

[0027] S1. Extract the viral nucleic acid from the test sample, where the test sample is selected from at least one of herpes exudate swabs, herpes fluid, whole blood, and plasma;

[0028] S2. Perform amplification detection on the extracted viral nucleic acid using real-time fluorescence MIRA technology.

[0029] Furthermore, the real-time fluorescence MIRA amplification detection step in S2 includes:

[0030] Add the reaction system to the reaction tube containing lyophilized enzyme powder;

[0031] Perform transient centrifugation on the reaction tube, mix evenly, and then perform transient centrifugation again;

[0032] Place the reaction tube into a real-time fluorescence quantitative PCR instrument, perform amplification under the condition of a constant temperature of 37 - 42°C, collect fluorescence signals every 30 s, and the reaction time is 20 min.

[0033] Furthermore, the optimal reaction conditions for the amplification are: a constant temperature of 42°C, the final concentrations of the upstream primer and the downstream primer are both 0.3 μM, and the final concentration of the probe is 120 nM.

[0034] The lowest detection concentration of the kit method is 2 copies / μL.

[0035] Compared with the prior art, this fluorescence MIRA kit and method for detecting simian varicella virus have the following beneficial effects:

[0036] Based on the conserved sequence of the ORF21 gene of simian varicella virus, the present invention optimally designs and synthesizes a primer-probe combination, and further constructs a reaction system. It not only determines the optimal reaction conditions and the optimal primer pair, but also establishes and optimizes the method for detecting simian varicella virus. Moreover, the detection method constructed by the present invention is not only highly sensitive, highly specific, and simple to operate, but also has a fast detection speed and low cost, and has important application value in detecting whether the test sample contains simian varicella virus.

[0037] Other advantages, objectives, and features of the present invention will be described to some extent in the subsequent specification, and to some extent, will be obvious to those skilled in the art based on the study of the following text, or can be taught from the practice of the present invention. Brief Description of the Drawings

[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention, and those of ordinary skill in the art can obtain other drawings without creative efforts based on these drawings.

[0039] Figure 1 This is a diagram showing the results of the SVV real-time fluorescence MIRA method primer probe group screening in one embodiment of the present invention;

[0040] Figure 2 This is a graph showing the results of primer pair re-optimization for the SVV real-time fluorescence MIRA method according to one embodiment of the present invention;

[0041] Figure 3 This is a graph showing the results of optimizing the reaction temperature using the SVV real-time fluorescence MIRA method according to one embodiment of the present invention;

[0042] Figure 4 This is a graph showing the results of optimizing the final primer concentration using the SVV real-time fluorescence MIRA method in one embodiment of the present invention;

[0043] Figure 5 This is a graph showing the results of optimizing the final probe concentration using the SVV real-time fluorescence MIRA method according to one embodiment of the present invention;

[0044] Figure 6 This is a result diagram of the sensitivity experiment of the SVV real-time fluorescence MIRA method in one embodiment of the present invention;

[0045] Figure 7 This is a graph showing the results of a specificity experiment using the SVV real-time fluorescence MIRA method in one embodiment of the present invention. DETAILED DESCRIPTION

[0046] In order to further illustrate the technical means and effects adopted by the present invention to achieve the predetermined purpose of the invention, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.

[0047] The main sources of viruses, reagents, and kits used in the examples of the present invention are as follows:

[0048] Measles virus (MeV), Simian type-D retrovirus (SRV), rhesus cytomegalovirus (RhCMV), Simian foamy virus (SFV), and Simian varicella virus (SVV) were identified and stored in our laboratory. Fluorescence MIRA kit (Anpu Future, catalog number: WLE8202KIT), crude lysate preparation reagent MightyPrep reagent for DNA (Bao Riyi, catalog number: 9182), and probe-based qPCR reagent Premix Ex Taq TM(HORIBA, Product number: RR390).

[0049] For those manufacturers not specifically marked in the examples, they can be routinely obtained through commercial purchase.

[0050] In the embodiments of the present invention, the main instruments used are as follows:

[0051] NanoVue (GE); Real-time fluorescence quantitative PCR instrument (Bio-Rad); High-speed centrifuge (Eppendorf); Laminar flow hood (Suzhou Jing'an Antai).

[0052] The present invention will be exemplarily described below.

[0053] Example 1

[0054] In this example, primers and probes for detecting simian varicella virus were designed, specifically including the design and synthesis of primers and probes, and the steps are as follows:

[0055] According to gene sequence comparison, the ORF21 full gene sequence of the highly conserved simian varicella virus reference strain (NC_002686.2) in GenBank was selected for the design of SVV real-time fluorescence MIRA primers and probes.

[0056] The SVV ORF21 gene sequence is shown in SEQ ID NO: 1, specifically as follows:

[0057]

[0058] Through software design, 3 sets of primers and probes were obtained, as shown in the following table:

[0059]

[0060]

[0061] Example 2

[0062] Based on the primers and probes designed in Example 1, the best combination of primers and probes was screened. The specific steps are as follows:

[0063] (1) Viral nucleic acid extraction

[0064] Take 20 μL of the monkey varicella virus culture and extract the viral nucleic acid according to the instructions of the MightyPrep reagent for DNA for crude extraction and lysis. The specific steps are as follows:

[0065] 1. Place 20 μL of the monkey varicella virus culture in a 1.5 mL centrifuge tube;

[0066] 2. Add 100 μL of MightyPrep reagent for DNA and mix with an oscillator;

[0067] 3. Heat at 95 °C for 10 minutes;

[0068] 4. Centrifuge at 12,000 - 15,000 rpm for 2 minutes;

[0069] 5. The supernatant is used as the template for PCR.

[0070] (2) Screening of primer-probe combinations

[0071] Three different primer-probe combinations were subjected to SVV real-time fluorescence MIRA reaction according to the instructions of the fluorescence MIRA kit. Add the reaction system to the dry powder reaction tube containing the enzyme. The operation steps are as follows:

[0072] 1. Add 29.4 μL of A Buffer, 2 μL of the upstream primer, 2 μL of the downstream primer, and 0.6 μL of the probe to each reaction system;

[0073] 2. Add 5 μL of the nucleic acid template to the reaction system respectively;

[0074] 3. Add 2.5 μL of B Buffer to the reaction system cover, cover the lid, and invert 3 - 5 times up and down to mix evenly;

[0075] 4. After mixing, centrifuge briefly.

[0076] 5. Place it in a real-time fluorescence quantitative PCR instrument for amplification. The amplification program is as follows: keep the temperature constant at 40°C, collect fluorescence signals once every 30 s, and the reaction time is 20 min.

[0077] The reaction system is shown in the following table:

[0078] Component Volume (μL) A Buffer 29.4 Forward Primer (10 μM) 2 Reverse Primer (10 μM) 2 Probe (10 μM) 0.6 ddH2O 8.5 Nucleic Acid 5 B Buffer 2.5 Total Volume 50

[0079] As Figure 1 shown, F3 / R3 / Probe3 (SEQ ID NO: 8-10) is the best primer-probe combination, and this set of primer-probe combinations shows better amplification effects than other sets of primer-probe combinations.

[0080] Example 3

[0081] Based on the primers designed and screened in Example 1 and Example 2, this example uses a 3'-end progressive truncation or extension strategy to systematically modify the downstream primer (R3) SEQ ID NO: 9. Specifically, sequence length variants are constructed by adding or deleting bases one by one at the 3'-end of this primer, and the optimized primer sequences are shown in the following table.

[0082] Serial Number Name Sequence (5’→3’) SEQ ID NO: 11 R3-2 TTAGTACATCCCAGTACATTCCAGTTTATTT SEQ ID NO: 12 R3-3 TTAGTACATCCCAGTACATTCCAGTTTATT SEQ ID NO: 13 R3-4 TTAGTACATCCCAGTACATTCCAGTTTAT SEQ ID NO: 14 R3-5 TTAGTACATCCCAGTACATTCCAGTTTATTTTG SEQ ID NO: 15 R3-6 TTAGTACATCCCAGTACATTCCAGTTTATTTTGT SEQ ID NO: 16 R3-7 TTAGTACATCCCAGTACATTCCAGTTTATTTTGTT

[0083] Using the reaction system and amplification conditions in Example 1, seven different primer pairs are re-screened. The seven different primer pairs are F3 / R3, F3 / R3-2, F3 / R3-3, F3 / R3-4, F3 / R3-5, F3 / R3-6, and F3 / R3-7.

[0084] As Figure 2 shown, F3 / R3-5 (SEQ ID NO: 8, SEQ ID NO: 14) is the best primer pair, and this set of primer pairs shows better amplification effects than other sets of primer pairs.

[0085] Example 4

[0086] Based on the primers and probes designed and optimized in Examples 1 to 3, this example optimizes the reaction conditions of the SVV real-time fluorescence MIRA method, specifically including the steps:

[0087] Construction of recombinant plasmid standard: Submit the target sequence of the SVV real-time fluorescence MIRA method to a gene synthesis company to customize a recombinant plasmid. Measure the plasmid concentration by NanoVue, and convert the concentration into copy number according to the following formula. DNA copy number / μL = [6.02×10 23 ×DNA concentration (ng / μL)×10 -9 / (DNA base number × 660), and then dilute the copy number to 2×109 copies / μL.

[0088] Optimization of the SVV real-time fluorescence MIRA method: Optimize the optimal reaction temperature, final primer concentration, and final probe concentration of the SVV real-time fluorescence MIRA method. Among them, the reaction temperature: Using a plasmid with a concentration of 2×10 2 copies / μL as a template, detect different reaction temperatures from 37°C to 42°C on a real-time fluorescence quantitative PCR to determine its optimal reaction temperature. Specifically, set the reaction temperatures of the SVV real-time fluorescence MIRA method to 37°C, 38°C, 39°C, 40°C, 41°C, and 42°C respectively to judge its optimal reaction temperature. The results are as Figure 3 shown. When the temperature is 42°C, the amplification efficiency is the highest; final primer concentration: Using a plasmid with a concentration of 2×10 2 copies / μL as a template, detect different final primer concentrations from 0.15 μM to 0.6 μM on a real-time fluorescence quantitative PCR to determine its optimal final primer concentration. Specifically, set the final primer concentrations of the SVV real-time fluorescence MIRA method to 0.15 μM, 0.3 μM, 0.45 μM, and 0.6 μM respectively to judge its optimal final primer concentration. The results are as Figure 4 shown. When the final primer concentration is 0.3 μM, the amplification efficiency is the highest; final probe concentration: Using a plasmid with a concentration of 2×10 2 copies / μL as a template, detect different final probe concentrations from 120 nM to 480 nM on a real-time fluorescence quantitative PCR to determine its optimal final probe concentration. Specifically, set the final probe concentrations of the SVV real-time fluorescence MIRA method to 120 nM, 240 nM, and 480 nM respectively to judge its optimal final probe concentration. The results are as Figure 5 shown. When the final probe concentration is 120 nM, the amplification efficiency is the highest.

[0089] Determine the preferred detection steps according to the above optimization results as follows:

[0090] Add the reaction system to a dry powder reaction tube containing enzymes. Add 29.4 μL of A Buffer, 2 μL of upstream primer (final primer concentration 0.3 μM), 2 μL (final primer concentration 0.3 μM) of downstream primer, and 0.6 μL of probe (final probe concentration 120 nM) to each reaction system; add 5 μL of nucleic acid template to the reaction system respectively; then add 2.5 μL of B Buffer to the reaction system cover, cover the lid, and invert it 3 - 5 times to mix evenly; after mixing, centrifuge briefly; then put it into a fluorescence quantitative PCR instrument for amplification. The amplification program is: keep the temperature at 42°C, collect fluorescence signals once every 30 s, and the reaction time is 20 min.

[0091] Example 5

[0092] In this example, experiments were conducted according to the optimized SVV real-time fluorescence MIRA method in Example 4.

[0093] Sensitivity of the SVV real-time fluorescence MIRA method: The plasmid standard was serially diluted 10-fold to 2×10 4 ~2×10 -2 copies / μL. Then, 5 μL of each dilution was taken as the reaction template for real-time fluorescence MIRA detection to determine its sensitivity.

[0094] Results of the sensitivity test: Plasmids with concentrations of SVV from 2×10 4 ~2×10 -2 copies / μL were used for real-time fluorescence MIRA method detection. As Figure 6 shown, the test results indicated that the lowest detection rate of the SVV real-time fluorescence MIRA method established in this study for SVV was 2 copies / μL.

[0095] Specificity of the SVV real-time fluorescence MIRA method: The real-time fluorescence MIRA method established in Example 3 was used to detect MeV, SFV, RhCMV, SVV, and SRV, and nuclease-free water was used as a negative control to evaluate the specificity of the method.

[0096] Results of the specificity test: Nucleic acids of common primate pathogens MeV, SFV, RhCMV, and SRV were amplified with SVV nucleic acid to judge their specificity. As Figure 7 shown, the results indicated that only SVV showed a fluorescence amplification curve, while no fluorescence amplification curves were observed for other pathogens, and no cross-reaction occurred, proving that the method had good specificity.

[0097] Repeatability of the SVV real-time fluorescence MIRA method: Concentrations of 2×10 3 copies / μL, 2×10 2 copies / μL, and 2×10 1 copies / μL selected in terms of sensitivity were used for repeatability detection; at the same time, nuclease-free water was set as the negative control. The repeatability detection was divided into within-batch repeat and between-batch repeat. Within-batch repeat: Under the same reaction conditions, the three concentrations and the negative control were detected simultaneously and repeated three times, and the coefficient of variation of the within-batch repeat was calculated through analysis; Between-batch repeat: The nucleic acid template was stored at -20 °C, and repeatability detection was performed every two days for three times, with three replicates each time, and the coefficient of variation of the between-batch repeat was calculated through analysis. The results are shown in the following table:

[0098]

[0099] Results of reproducibility test: Three concentrations were selected for reproducibility detection, including intra-batch and inter-batch repetitions. The intra-batch coefficient of variation (CV) was 3.14% - 8.89%, and the inter-batch coefficient of variation (CV) was 6.20% - 9.30%, both less than 10%. The results showed that the coefficients of variation of the Tt values detected for the three concentration samples within the same batch and at different batch times were all less than 10%, indicating good reproducibility.

[0100] Example 6

[0101] In this example, the optimized SVV real-time fluorescence MIRA method in Example 4 was used to detect and verify clinical samples.

[0102] The nucleic acids of 29 clinical samples were stored in the sample library of this laboratory.

[0103] At the same time, the optimized SVV real-time fluorescence MIRA method in Example 3 and the SVV real-time fluorescence PCR detection method were used for detection. Taking the results of real-time fluorescence PCR as the gold standard for virus detection, the specificity, sensitivity, negative predictive value, and positive predictive value of real-time fluorescence MIRA were evaluated. Kappa analysis was used to analyze the consistency. When Kappa > 0.8, it indicated that the detection results had excellent consistency.

[0104] Taking the detection results of clinical samples by real-time fluorescence PCR method as the standard, and at the same time using the established real-time fluorescence MIRA method to detect 29 clinical samples, the coincidence rate of the detection results of the two methods was 96.6%, and the Kappa value was 0.93, indicating that the two methods had good consistency. The results are shown in the following table:

[0105]

[0106] In summary, using the real-time fluorescence MIRA method to detect whether a sample contains simian varicella virus is not only fast in detection, but also has high sensitivity, good specificity, simple operation, and low cost, and has important research significance and application value in the detection of simian varicella virus.

[0107] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to the above-disclosed technical content within the scope of the technical solution of the present invention to make equivalent embodiments of equivalent changes. However, as long as it does not depart from the content of the technical solution of the present invention, any brief modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A fluorescent MIRA kit for detecting simian varicella virus, characterized in that, The components of the kit include: primer-probe combination, Buffer A, Buffer B, freeze-dried enzyme powder, and nucleic acid extraction reagent; The primer-probe combination is designed for the ORF21 gene of simian varicella virus and includes an upstream primer, a downstream primer, and a probe; The Buffer A and Buffer B are A Buffer and B Buffer, which are used to provide the ionic environment for the reaction system; The freeze-dried enzyme powder contains recombinase, single-stranded binding protein SSB, and DNA polymerase; The nucleic acid extraction reagent is used to extract viral nucleic acid from the sample to be tested.

2. The fluorescent MIRA kit for detecting simian varicella virus according to claim 1, wherein The primer-probe combination is selected from: Combination 1: upstream primer F1 shown in SEQ ID NO: 2, downstream primer R1 shown in SEQ ID NO: 3, probe Probe1 shown in SEQ ID NO: 4; Combination 2: upstream primer F2 shown in SEQ ID NO: 5, downstream primer R2 shown in SEQ ID NO: 6, probe Probe2 shown in SEQ ID NO: 7; Combination 3: upstream primer F3 shown in SEQ ID NO: 8, one of the downstream primers shown in SEQ ID NO: 9, SEQ ID NO: 11 - SEQ ID NO: 16, probe Probe3 shown in SEQ ID NO:

10.

3. The fluorescence MIRA kit for detecting simian varicella virus according to claim 2, wherein, The primer-probe combination is Combination 3, where the upstream primer sequence is shown in SEQ ID NO: 8, the downstream primer sequence is shown in SEQ ID NO: 14, and the probe sequence is shown in SEQ ID NO:

10.

4. A fluorescence MIRA kit for detecting simian varicella virus according to claim 1, characterized in that, At the 30th base T from the 5'-end of the probe, the FAM group is labeled, the 31st base is replaced by tetrahydrofuran THF, the 32nd base T is labeled with the BHQ group, and the 3'-end is blocked with C3spacer modification.

5. A fluorescence MIRA kit for detecting simian varicella virus according to any one of claims 1-4, characterized in that The reaction system of the kit includes: 29.4 μL A Buffer, 2 μL upstream primer, 2 μL downstream primer, 0.6 μL probe, 5 μL nucleic acid template, 2.5 μL B Buffer, supplemented with ddH2O to 50 μL. Among them, the concentration of the upstream primer is 10 μmol / L, the concentration of the downstream primer is 10 μmol / L, and the concentration of the probe is 10 μmol / L.

6. The fluorescence MIRA kit for detecting simian varicella virus according to claim 5, characterized in that, The reaction system also contains freeze-dried enzyme powder.

7. A fluorescence MIRA kit method for detecting simian varicella virus, applicable to a fluorescence MIRA kit for detecting simian varicella virus as described in any one of claims 1-6, characterized in that, The application steps of this method in the detection of simian varicella virus are as follows: S1. Extract viral nucleic acid from the sample to be tested, and the sample to be tested is selected from at least one of herpes exudate swab, herpes fluid, whole blood, and plasma; S2. Amplify and detect the extracted viral nucleic acid by real-time fluorescence MIRA technology.

8. A fluorescence MIRA kit method for detecting simian varicella virus according to claim 7, characterized in that, The real-time fluorescence MIRA amplification detection step in S2 includes: Add the reaction system to the reaction tube containing freeze-dried enzyme powder; Perform transient centrifugation on the reaction tube and mix evenly, then perform transient centrifugation again; Put the reaction tube into a real-time fluorescence quantitative PCR instrument, and perform amplification at a constant temperature of 37 - 42 °C. Collect fluorescence signals every 30 s, and the reaction time is 20 min.

9. The fluorescence MIRA kit method for detecting simian varicella virus according to claim 8, wherein, The optimal reaction conditions for the amplification are as follows: a constant temperature of 42°C, the final concentrations of both the upstream primer and the downstream primer are 0.3 μM, and the final concentration of the probe is 120 nM.

10. A method for detecting simian varicella virus by a fluorescence MIRA kit according to claim 8, characterized in that, The lowest detection concentration of the kit method is 2 copies / μL.

Images