High-throughput sequencing library as well as construction method and application thereof

Abstract

The invention belongs to the technical field of high-throughput detection, and discloses a high-throughput sequencing library as well as a construction method and application thereof. The invention provides a construction method of a phage display library and an obtained T7 phage display library. According to the phage display library, a metagenome sequencing technology and a phage display technology are combined, and the phage display library has the advantages of high throughput, low cost, ultra-large capacity and the like. The invention further provides a construction method of the high-throughput sequencing library and the obtained high-throughput sequencing library. According to the present invention, the phage display library is constructed, the immunoprecipitation and the serum are adopted to co-incubate and capture the antibody, the high-throughput sequencing library is constructed, the sequencing is performed, and the serum antibody information is obtained through the bioinformatics analysis so as to achieve the high-throughput serological test, the specificity is strong, and the sensitivity is high.

Description

Technical Field

[0001] The present invention relates to the technical field of high-throughput detection, and in particular to a high-throughput sequencing library, a construction method thereof and an application thereof. Background Art

[0002] There are three basic methods for laboratory diagnosis of pathogen infection: clinical testing based on routine examinations, pathogen testing for pathogen nucleic acid, and serological testing for monitoring changes in antibody levels. However, the detection utility of the first two methods can only be better demonstrated if the sample is correctly collected and the disease is infected in a short period of time. In contrast, serological testing for antibodies is faster and more economical, and can determine the cause of infection even if the pathogen has been cleared by the immune system. Serological diagnosis of specific antibodies has many advantages: it can not only detect the infection history of pathogens, but also evaluate the body's immune status to viruses while detecting acute infections, and perform adjuvant treatment. Traditional antibody detection techniques in clinical diagnosis and research laboratories include western blot (WB), immunofluorescence assay (IFA) and enzyme-linked immunosorbent assay (ELISA). At present, the most widely used medium-throughput serological tests include Luminex and Microarrays platforms.

[0003] The details are shown in Table 1:

[0004] Table 1 Serological tests

[0005] method Stationary Phase antigen Signal Detection Flux ELISA Plastic Sheet Whole protein or subdomain Enzyme-labeled antibodies Low Western Blot Nitrocellulose membrane Denatured protein Enzyme-labeled antibodies Low IFA cell Cellular expression Fluorescently labeled antibodies Low Luminex Magnetic beads Whole protein or subdomain Fluorescently labeled antibodies middle Microarrays chip Peptides Scanning fluorescence signal middle

[0006] However, the existing serological detection technology generally has low throughput and cannot perform multiple detection of pathogens. In addition, the existing multiple serological detection technology is relatively expensive, which limits its widespread application. Summary of the invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a high-throughput sequencing library, a construction method and application thereof.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides a method for constructing a phage display library, comprising the following steps:

[0010] S1, collect and summarize protein sequences of human pathogens in fasta, TXT, CSV or TSV files, and use pepsyn to design DNA libraries;

[0011] The design method of the DNA library is as follows: the protein sequence is cut into peptide segments with a length of 50aa-60aa and an overlap length of 20aa-30aa, and the peptide segments with a similarity greater than 90% are clustered using CD-HIT; the peptide segments are translated into nucleotide sequences using Escherichia coli codons, and restriction enzyme cleavage sites are removed; the two-end PCR universal adapters containing the restriction enzyme cleavage sites are added to the nucleotide sequence, AGGAATTCCGCTGCGT is written in the 5′ end field, and ACCTGGAGAAGCTTGC is written in the 3′ end field; the designed DNA library is synthesized into an oligonucleotide library;

[0012] S2, displaying the DNA sequence of the DNA library on the surface of bacteriophage to obtain a T7 phage display library.

[0013] The phage display library of the present invention combines metagenomic sequencing technology with phage display technology, and has high throughput (can detect 1485 viruses and 270 bacteria), low cost, and ultra-large capacity (can accommodate more than 10 10 different peptide epitopes) and other advantages.

[0014] As a preferred embodiment of the method for constructing a phage display library of the present invention, in step S1, the collection is selected from UniProt, NCBI and IEDB databases.

[0015] As a preferred embodiment of the method for constructing a phage display library of the present invention, in step S2, the display method is:

[0016] (1) amplifying the DNA sequence of the DNA library by PCR to obtain a PCR product;

[0017] (2) digesting the PCR product and T7 phage DNA with a restriction endonuclease corresponding to the restriction enzyme site to obtain an insert fragment and a T7 vector arm DNA;

[0018] (3) ligating the inserted fragment to the T7 vector arm DNA using T4 ligase to obtain recombinant T7 phage DNA;

[0019] (4) packaging the recombinant T7 phage DNA in vitro to obtain a recombinant T7 phage;

[0020] (5) After the recombinant T7 phage is infected with Escherichia coli, a T7 phage display library is obtained.

[0021] As a preferred embodiment of the method for constructing a phage display library of the present invention, in step (1), the primer sequences for amplification are AATGATACGGAGGGAATTCCGCGCGT and CAACTCGAGGAGCAAGCTTCTCCAGGT.

[0022] In a second aspect, the present invention provides a T7 phage display library obtained by the method for constructing a phage display library.

[0023] In a third aspect, the present invention provides a method for constructing a high-throughput sequencing library, comprising the following steps:

[0024] S1: taking the T7 phage display library, combining the phage surface antigen with the specific antibody IgG, and then capturing the antibody IgG using protein G magnetic beads;

[0025] S2: Heating causes the phage to release DNA;

[0026] S3: Perform PCR amplification on the DNA to obtain a high-throughput sequencing library.

[0027] As a preferred embodiment of the method for constructing a high-throughput sequencing library of the present invention, in step S3, the PCR amplification includes a first round of PCR and a second round of PCR;

[0028] The first round of PCR uses the DNA as a template; uses ACACTCTTTCCCTACACGACG CTCTTCCGATCT-ATCCGAATTCCGCTGCG and GATCGGAAGAGCACACGTC TGAACTCCAGTC-CCGCAAGCTTCTCCAGGT as primers;

[0029] The second round of PCR uses the product of the first round of PCR as a template; AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCC GATCT and CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTC AGACGTGTGCTCTTCCGATC as primers;

[0030] In a fourth aspect, the present invention provides a high-throughput sequencing library obtained by the method for constructing a high-throughput sequencing library.

[0031] In a fifth aspect, the present invention provides a high-throughput serum detection kit, comprising the T7 phage display library or the high-throughput sequencing library.

[0032] As a preferred embodiment of the high-throughput serum detection kit of the present invention, it also includes acceptable auxiliary materials and additives.

[0033] In a sixth aspect, the present invention provides a high-throughput serological detection method, comprising the following steps: mixing sample serum with the high-throughput sequencing library, sequencing on a machine, and analyzing and comparing with a reference database.

[0034] As a preferred embodiment of the high-throughput serological detection method described in the present invention, the analysis and comparison includes comparing the offline data, calculating the Z score, virus score and pathogen serum positivity rate, and analyzing the cross-reactions between various antibodies.

[0035] As a preferred embodiment of the high-throughput serological detection method described in the present invention, the offline data is compared as follows: using bowtie to establish an index of the zoonosis sequence database ZoonScan.fasta file and compare the offline data; using samtools software to count the enriched sequences in each sample and output the result .count.csv file.

[0036] As a preferred embodiment of the high-throughput serological detection method described in the present invention, the calculation of the Z score is: edit the R script "Zscore_analysis.R" to add the path of the count file and then run it; in the samples of two technical replicates, peptides with Zscore≥3.5 are recorded as hits.

[0037] As a preferred embodiment of the high-throughput serological detection method described in the present invention, the virus score and pathogen serum positivity rate are calculated by: determining which pathogen each of the hit peptides comes from, summarizing the number of peptides hit by each pathogen; comparing with viral_thresholds.csv, pathogens above the threshold list are positive.

[0038] As a preferred embodiment of the high-throughput serological detection method of the present invention, the analysis of cross-reactions between various antibodies adopts Antiviral Antibody Response Deconvolution Algorithm analysis.

[0039] In a seventh aspect, the present invention applies the method for constructing a phage display library, the T7 phage display library, the method for constructing a high-throughput sequencing library, the high-throughput sequencing library, the high-throughput serum detection kit, and the high-throughput serological detection method in non-disease diagnosis or treatment detection of human pathogens.

[0040] As a preferred embodiment of the application described in the present invention, the human pathogens include rotavirus A, rotavirus B, human betaherpesvirus, enterovirus B, enterovirus C, human betaherpesvirus, human mastadenovirus C, rhinovirus C, human mastadenovirus B, respiratory syncytial virus, and new coronavirus.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] The phage display library of the present invention combines metagenomic sequencing technology with phage display technology, and has high throughput (can detect 1485 viruses and 270 bacteria), low cost, and ultra-large capacity (can accommodate more than 10 10 The present invention constructs a phage display library, uses immunoprecipitation to co-incubate with serum to capture antibodies, then constructs a high-throughput sequencing library and performs sequencing, and obtains serum antibody information through bioinformatics analysis, thereby achieving high-throughput serological testing with strong specificity and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 It is a schematic diagram of the technical route of the present invention;

[0044] Figure 1 In the figure, A is a text diagram; B is a picture diagram.

[0045] Figure 2 Count plates for plaques;

[0046] Figure 3 is the Pearson consistency test;

[0047] Figure 4 Heat map of high-throughput serological test results. DETAILED DESCRIPTION

[0048] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0049] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial sources. OnePot Pro DNA Library Prep Kit, Hieff Stubby UDI Primer Kit, Hieff Smarter DNA purification magnetic beads and IgG-free bovine serum albumin were purchased from Yisheng; Qubit dsDNA HS detection kit, Qubit TM 1X dsDNA HS Assay Kit, protein G magnetic beads, and 96-well polystyrene plates were purchased from ThermoFisher Scientific; Agilent DNA 1000 was purchased from Agilent; NovaSeq 6000S4 Reagent Kit v1.5 (300 cycles) was purchased from Illumina; KAPA HiFi HotStartReadyMix PCR Kit was purchased from Roche; 10-3 Cloning Kit was purchased from EMD Millipore; oligonucleotide library was purchased from Twist; TBST Buffer was purchased from White Shark; Tris buffer was purchased from Beijing Solebow; various primers were synthesized by Sangon Biotechnology Co., Ltd.

[0050] like Figure 1 As shown, the present invention constructs a phage display library, uses immunoprecipitation to co-incubate with serum to capture antibodies, then constructs a high-throughput sequencing library and performs sequencing, and obtains serum antibody information through bioinformatics analysis, thereby achieving high-throughput serological testing.

[0051] Example 1: Design and synthesis of DNA library

[0052] The human pathogen list published by Iowa State University (updated in November 2022, summarizing all pathogens currently reported to infect humans) was used to search for corresponding pathogen protein sequences in the UniProt, NCBI and IEDB databases. The protein sequences of all known human pathogens (including 1485 viruses and 270 bacteria) were summarized in a file called virus.fasta, and the DNA library was designed using pepsyn (Python software package) to artificially synthesize the oligonucleotide library, including the following process:

[0053] (1) All protein sequences were sheared into peptide segments with a length of 56 aa and an overlap length of 28 aa;

[0054] (2) CD-HIT was used to cluster peptides with similarity greater than 90%;

[0055] (3) The peptide fragments were translated into nucleotide sequences using E. coli codons and restriction enzyme sites (EcoRI: GAATTC and Hind III: AAGCTT) were removed;

[0056] (4) Add a two-terminal PCR universal adapter containing restriction enzyme sites (EcoR I and Hind III) to the nucleotide sequence, write AGGAATTCCGCTGCGT in the 5′ end field, and write ACCTGGAGAAGCTTGC in the 3′ end field;

[0057] (5) The designed DNA library is handed over to Twist Company to synthesize the oligonucleotide library.

[0058] Example 2: Phage library construction

[0059] use The materials and reagents provided by the Cloning Kit are used to display the DNA sequence on the surface of the bacteriophage. The specific steps are as follows:

[0060] (1) Design primers and use Q5 high-fidelity DNA polymerase to perform PCR amplification on the Twist synthetic oligonucleotide library in Example 1.

[0061] a) Primer design

[0062] Forward primer: 5′AATGATACGGAGGGAATTCCGCGCGT 3′;

[0063] Reverse primer: 5′CAACTCGAGGAGCAAGCTTCTCCAGGT 3′;

[0064] b) PCR amplification

[0065] Place all reaction components on an ice box, add samples according to Table 2, slowly pipette to mix the reaction solution, centrifuge instantaneously and quickly transfer the reaction solution to a PCR instrument with the temperature set in advance according to Table 3, and perform 30 cycles from denaturation to extension steps.

[0066] Table 2 PCR amplification reaction system

[0067] Reaction system Volume (μl) 5×Q5 reaction buffer 10 10mM dNTP 1 10 μM forward primer 2.5 10 μM reverse primer 2.5 DNA template 2 5×Q5 High GC Enhancer 10 Q5 High-Fidelity DNA Polymerase 0.5 Deionized water Replenish to 50

[0068] Table 3 PCR amplification reaction program

[0069]

[0070] c) PCR product recovery and purification

[0071] After amplification, the PCR product was The DNA was recovered using Smarter DNA Purification Magnetic Beads, dissolved in 25 μL deionized water, and stored at 4°C.

[0072] (2) The DNA library and T7 phage DNA were treated with double enzyme digestion (restriction endonucleases EcoR I and Hind III) to construct insert fragments and vector DNA (the restriction digestion reaction steps of vector DNA and synthetic DNA were the same).

[0073] a) DNA double digestion

[0074] Place all reaction components on an ice box, add the reaction system in Table 4 in sequence, slowly pipette and mix the reaction solution, centrifuge instantaneously, and then place in a water bath for enzyme digestion at 37°C for 4 hours. After the enzyme digestion is completed, transfer the EP tube to a 65°C metal bath and heat for 10 minutes to inactivate the enzyme.

[0075] Table 4 Enzyme digestion reaction system

[0076] Reaction system Volume (μl) Restriction endonuclease EcoRI 1 Restriction endonuclease HindIII 1 10×H Buffer 5 Vector DNA / Synthetic DNA 1 μg Deionized water Up to 25

[0077] b) DNA recovery

[0078] After enzyme digestion, the fragments were purified using magnetic beads, and the concentration of the library was measured using the Qubit 4.0 fluorescence quantifier; the length of the library fragments was measured using the Agilent Bioanalyzer 4200 device. The remaining DNA was stored in a refrigerator at 4°C for later use.

[0079] (3) The inserted fragment is ligated to the T7 vector arm DNA at a ratio of 1:10 using T4 ligase to form recombinant T7 phage DNA.

[0080] Place all reaction components on an ice box and add the ligation reaction system in Table 5. Mix by gently pipetting up and down, then place in a constant temperature water bath at 25°C for 5 hours, and store the recombinant phage DNA in a 4°C refrigerator for later use.

[0081] Table 5 Ligation reaction system

[0082] name Volume (μl) Inserting genes 1 T7 phage vector 10 T4 Ligase 10 10×Ligase Buffer 5 Deionized water Replenish to 30

[0083] (4) The recombinant phage DNA is then packaged in vitro to obtain a new T7 phage:

[0084] Take the T7 phage packaging protein out of the -80℃ ultra-low temperature freezer and thaw it on an ice box. Add 5μL of the above recombinant phage DNA to the 25μL packaging protein EP tube, gently pipette and mix well, do not vortex, and place the reaction mixture in a constant temperature water bath after mixing, incubate at 22℃ for 2h. After the packaging incubation is completed, add 270μL of sterilized LB liquid culture medium to terminate the reaction.

[0085] (5) After the T7 phage display library infects BLT5403 E. coli, the T7 phage DNA is replicated, transcribed and translated, and the inserted fragment can be expressed to construct a T7 phage display library:

[0086] Take 50 μL of the packaged product and inoculate it into 5 mL of BLT5403 bacterial solution that has been cultured to the mid-logarithmic phase, and culture it in a constant temperature shaking incubator at 37°C, 175 rpm for 4 hours to verify whether the packaged product is infectious. Add 80% glycerol to the amplified library and freeze it in a -80°C refrigerator to obtain the T7 phage display library.

[0087] Example 3: Phage library quality control

[0088] The titer of the library constructed in Example 2 was identified by plaque culture to determine whether it could display enough sequences for subsequent experimental detection, as follows:

[0089] Use sterilized LB liquid medium to perform a series of dilutions on the T7 phage display library: Take 2 μL of the library and add it to an EP tube containing 198 μL of sterilized LB liquid medium, mix and dilute to 10 -2 , take 100 μL of the above packaged product dilution and add it to the EP tube containing 900 μL of sterilized LB liquid medium, mix and dilute to 10 -3 , and so on, dilute the library to 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 There are 6 gradients in total.

[0090] Take the above 6 gradient dilutions, add 100 μL of each gradient into 6 5 mL sterile EP tubes, add 250 μL of BLT5403 bacterial solution to each EP tube and mix, then add 2.5 mL of warm top agar medium (maintained at 50°C-55°C) to the tube, gently invert to mix, and spread on LB-Carb solid plate (containing Carb 50 μg / mL) after thorough mixing.

[0091] After the top agar medium on the plate is completely solidified, seal it with a sealing film, invert it and place it in a 10-stage programmable electric constant temperature incubator at 37°C for 3-4 hours until clear plaques appear. Count the number of plaques on different gradient plates, and then calculate the original library capacity (library titer = number of plaques on the dilution plate × dilution factor × 10 (0.1ml dilution plate) pfu / ml).

[0092] The concentration of library amplified phage was calculated based on the count of monoclonal colonies as follows:

[0093] Amplified phage concentration = monoclonal colony count × unit volume dilution factor = 461 × (10 8 ×100)=4.61×10 12 / mL.

[0094] Example 4: Phage immunoprecipitation

[0095] 1. Sample information

[0096] The samples are shown in Table 6:

[0097] Table 6 Basic information of samples

[0098]

[0099] 2. After the phage surface antigen binds to the specific antibody IgG, the antibody IgG is captured using protein G magnetic beads, as follows:

[0100] (1) Before the reaction, a 96-well polystyrene plate was blocked with 3% IgG-free bovine serum albumin and placed in a magnetic rotator in a cold storage (4°C) for overnight blocking;

[0101] (2) Take out the frozen sample serum from the -80°C freezer and thaw it on ice;

[0102] (3) Pour off the blocking solution in the 96-well polystyrene plate and wash once with 200 μL TBST Buffer. After pouring off, add 90 μL TBST Buffer to each well.

[0103] (4) Add 1 μL of melted serum sample to each well, and add only TBST buffer as a negative control, the added volume is also 1 μL;

[0104] (5) Take out the frozen phage library from -20℃ and add 10μL of 1×10 diversity to each well. 9 The phage library was constructed so that each antigen peptide had an average of 46.1 phage particles in each well;

[0105] (6) After the system is mixed, place it in a magnetic rotator in a cold storage (4°C) to mix overnight;

[0106] (7) Add 10 μL of protein G magnetic beads to each sample and place in a magnetic rotator in a cold storage (4°C) for mixing for 4-6 h;

[0107] (8) Elution: Place a 96-well polystyrene plate on a 96-well magnetic rack, elute six times with 200 μL TBST Buffer, wash once with deionized water, and finally resuspend with 20 μL deionized water. Heat the phage obtained above at 95°C for 20 min to release the phage DNA, and freeze at 20°C until use.

[0108] Example 5: High-throughput sequencing library construction and sequencing

[0109] Construction of a high-throughput sequencing library requires two rounds of PCR reactions, followed by sequencing. CDIPrimer for Set 1, No. 12412ES02, specification 96×2T; CDIPrimer for Set2, number 12413ES02, specification 96×2T.

[0110] (1) First round of PCR (PCR1) Step a) Design primers

[0111] Design primers and use Q5 high-fidelity DNA polymerase to perform PCR amplification on the phage-released DNA in Example 4:

[0112] Forward Primer:

[0113] 5′ACACTCTTTCCCTACACGACCGCTTCCGATCT—ATCCGAATTCCGCTGCGT 3′;

[0114] Reverse Primer:

[0115] 5′GATCGGAAGAGCACACGTCTGAACTCCAGTC—CCGCAAGCTTCTCCAGGT 3′;

[0116] In the primer, the linker sequence before “—” is a high-throughput sequencing adapter sequence used to connect the sequencing library; the linker sequence after “—” is a specific sequence for the specific region of the target DNA and is used to amplify the target region.

[0117] b) PCR1 amplification

[0118] Place all reaction components on an ice box, add samples according to Table 7, slowly pipette to mix the reaction solution, centrifuge instantaneously and quickly transfer the reaction solution to a PCR instrument with the temperature set in advance according to Table 8, and perform 28 cycles from denaturation to extension steps.

[0119] Table 7 PCR1 amplification reaction system

[0120]

[0121]

[0122] Table 8 PCR1 amplification reaction program

[0123]

[0124] c) PCR1 product recovery and purification

[0125] After amplification, the PCR products were Smarter DNA purification magnetic beads were used to sort and recover DNA, dissolved in 25 μL deionized water, and stored at 4°C.

[0126] (2) Second round of PCR (PCR2) reaction steps

[0127] a) Primer design

[0128] Design primers and use Q5 high-fidelity DNA polymerase to amplify the obtained DNA library by PCR: I5: 5′ AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3′; I7: 5′ CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 3′

[0129] b) PCR2 amplification

[0130] Place all reaction components on an ice box, add samples according to Table 9, slowly pipette to mix the reaction solution, centrifuge instantaneously and quickly transfer the reaction solution to a PCR instrument with the temperature set in advance according to Table 10, and perform 10 cycles from denaturation to extension steps.

[0131] Table 9 PCR2 amplification reaction system

[0132] PCR 2 system composition Volume (μL) 5×Q5 reaction buffer 5 10mM dNTP 0.5 I5 1.25 I7 1.25 5×Q5 High GC Enhancer 5 Q5 High-Fidelity DNA Polymerase 0.25 PCR1 product 200ng Deionized water Up to 25

[0133] Table 10PCR2 amplification reaction program

[0134]

[0135] c) PCR2 product recovery and purification

[0136] After amplification, the PCR product was The DNA was recovered using Smarter DNA Purification Magnetic Beads, dissolved in 25 μL deionized water, and stored at 4°C.

[0137] (3) Sequencing library quality control

[0138] The concentration of the library was measured using a Qubit 4.0 fluorescence quantifier, and the fragment length of the library was measured using an Agilent Bioanalyzer 4200 instrument.

[0139] (4) Sequencing

[0140] The library was sequenced using the paired-end 150 bp sequencing mode of the Illumina Novaseq 6000 sequencing platform S4 chip:

[0141] a) Library homogenization: Based on the lane and the molar concentration of the library, take 2 μl and calculate the volume required to dilute the library to 2 nM.

[0142] b) Mixed samples: According to the ratio of different data volumes, all homogenized samples in the same lane are mixed in the specified ratio and diluted to the specified concentration on the machine.

[0143] c) Library and Phix denaturation

[0144] d) Loading: Add ExAmp premix to each denatured pooled library, load the library into the flow cell, and within 30 min, load the flow cell onto the instrument and install the SBS cartridge, cluster generation cartridge, and buffer cartridge.

[0145] e) Set parameters: Select NovaSeq Xp process, enter the experiment name, number of cycles, read length, select the storage path, select Review, and the software will automatically check the machine parameters. After confirming the running parameters, start sequencing.

[0146] Example 6: Bioinformatics analysis

[0147] (1) Aligning the sequencing data of Example 5 to the reference database

[0148] Bowtie was used to build the index of the ZoonScan.fasta file of the zoonosis sequence database and compare the offline data; the enriched sequences in each sample were counted using samtools software and the results were output (.count.csv file)

[0149] (2) Calculate the Z score

[0150] Run the R script “Zscore_analysis.R” after editing it to add the path to the counts file; peptides with a Z score ≥ 3.5 in samples from two technical replicates were called “hits.”

[0151] (3) Calculate the viral fraction and calculate the pathogen seropositivity rate

[0152] Determine which pathogen each hit peptide comes from, and summarize the number of peptides hit by each pathogen; compare with viral_thresholds.csv, and pathogens above the threshold list are positive.

[0153] (4) The Antiviral Antibody Response Deconvolution Algorithm (AVARDA) method was used to analyze the cross-reactions between different antibodies.

[0154] The results are as follows:

[0155] In order to test the consistency of the experiment, the serum samples of the subjects (HC1, HC2) were tested twice, and the Pearson correlation coefficients were calculated for the test results. The results showed that the Pearson correlation coefficients were 0.95 and 0.98, respectively (e.g. Figure 3 This indicates that the experiments based on phage display and high-throughput sequencing technology have good repeatability.

[0156] After testing the reproducibility of this experiment, the peptides enriched in 36 serum samples were counted and the antibody positivity rate of each pathogen was calculated. Figure 4 As shown, in the sera of healthy controls and COVID-19 patients, antibodies to rotavirus A, rotavirus B, human betaherpesvirus, enterovirus B, enterovirus C, human betaherpesvirus, human mastadenovirus C, rhinovirus C, human mastadenovirus B, and respiratory syncytialvirus are present in large quantities, indicating that the population may have been or is being infected with these pathogens.

[0157] The sensitivity and specificity of the serum of COVID-19 patients were calculated and verified. The serum of 18 COVID-19 patients and 18 healthy people were incubated with the phage peptide library, and the results of COVID-19 antibody detection were selected to calculate the sensitivity and specificity. The results are shown in Table 11. The sensitivity for COVID-19 antibodies is 88.8% and the specificity is 83.3%.

[0158] Table 11 Sensitivity and specificity verification

[0159]

[0160]

[0161] The phage display library of the present invention combines metagenomic sequencing technology with phage display technology, and has high throughput (can detect 1485 viruses and 270 bacteria), low cost, and ultra-large capacity (can accommodate more than 10 10 The present invention constructs a phage display library, uses immunoprecipitation to co-incubate with serum to capture antibodies, then constructs a high-throughput sequencing library and performs sequencing, and obtains serum antibody information through bioinformatics analysis, thereby achieving high-throughput serological testing with strong specificity and high sensitivity.

[0162] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A method for constructing a phage display library, characterized in that: The following steps are involved: S1, collect and summarize protein sequences of human pathogens in fasta, TXT, CSV or TSV files, and use pepsyn to design DNA libraries; The collection is selected from UniProt, NCBI and IEDB databases; The design method of the DNA library is as follows: the protein sequence is cut into peptide segments with a length of 50aa-60aa and an overlap length of 20aa-30aa, and the peptide segments with a similarity greater than 90% are clustered using CD-HIT; the peptide segments are translated into nucleotide sequences using Escherichia coli codons, and restriction enzyme cleavage sites are removed; the two-end PCR universal adapters containing the restriction enzyme cleavage sites are added to the nucleotide sequence, AGGAATTCCGCTGCGT is written in the 5′ end field, and ACCTGGAGAAGCTTGC is written in the 3′ end field; the designed DNA library is synthesized into an oligonucleotide library; S2, displaying the DNA sequence of the DNA library on the surface of bacteriophage to obtain a T7 phage display library.

2. The method for constructing a phage display library according to claim 1, characterized in that: In step S2, the display method is: (1) amplifying the DNA sequence of the DNA library by PCR to obtain a PCR product; The primer sequences for the amplification are AATGATACGGAGGGAATTCCGCGCGT and CAACTCGAGGAGCAAGCTTCTCCAGGT (2) digesting the PCR product and T7 phage DNA with a restriction endonuclease corresponding to the restriction enzyme site to obtain an insert fragment and a T7 vector arm DNA; (3) ligating the inserted fragment to the T7 vector arm DNA using T4 ligase to obtain recombinant T7 phage DNA; (4) packaging the recombinant T7 phage DNA in vitro to obtain a recombinant T7 phage; (5) After the recombinant T7 phage is infected with Escherichia coli, a T7 phage display library is obtained.

3. A T7 phage display library obtained by the method for constructing a phage display library according to claim 1 or 2.

4. A method for constructing a high-throughput sequencing library, characterized in that: The following steps are involved: S1: Take the T7 phage display library described in claim 3, combine the phage surface antigen with specific antibody IgG, and then capture the antibody IgG using protein G magnetic beads; S2: Heating causes the phage to release DNA; S3: Perform PCR amplification on the DNA to obtain a high-throughput sequencing library.

5. The method for constructing a high-throughput sequencing library according to claim 4, characterized in that: In step S3, the PCR amplification includes a first round of PCR and a second round of PCR; The first round of PCR uses the DNA as a template; uses ACACTCTTTCCCTACACGACG CTCTTCCGATCT-ATCCGAATTCCGCTGCG and GATCGGAAGAGCACACGTC TGAACTCCAGTC-CCGCAAGCTTCTCCAGGT as primers; The second round of PCR uses the product of the first round of PCR as a template; AATGATACGGCG ACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCC GATCT and CAAGCAGAAGACGGCATACGAGAT[i7Index]GTGACTGGAGTTC AGACGTGTGCTCTTCCGATC as primers.

6. A high-throughput sequencing library obtained by the method for constructing a high-throughput sequencing library according to claim 4 or 5.

7. A high-throughput serum detection kit, characterized in that: The method comprises the T7 phage display library according to claim 3 or the high-throughput sequencing library according to claim 6, and acceptable auxiliary materials and additives.

8. A high-throughput serological detection method, characterized in that: The following steps are involved: Mixing the sample serum with the high-throughput sequencing library of claim 6, sequencing on a machine, and analyzing and comparing with a reference database; The analysis and comparison includes comparing offline data, calculating Z scores, virus scores and pathogen seropositivity rates, and analyzing cross-reactions between various antibodies; The comparison of offline data is as follows: using bowtie to establish an index of the zoonosis sequence database ZoonScan.fasta file and compare the offline data; using samtools software to count the enriched sequences in each sample and output the result .count.csv file; The Z score was calculated as follows: edit the R script "Zscore_analysis.R" to add the path to the count file and run it; peptides with a Z score ≥ 3.5 in the samples of two technical replicates were recorded as hits; The virus score and pathogen seropositivity rate were calculated by: determining which pathogen each hit peptide originated from, summing up the number of peptides hit by each pathogen; comparing with viral_thresholds.csv, pathogens above the threshold list were positive; The cross-reactivity between the antibodies was analyzed using Antiviral Antibody Response Deconvolution Algorithm.

9. Use of the method for constructing the phage display library of claim 1 or 2, the T7 phage display library of claim 3, the method for constructing the high-throughput sequencing library of claim 4 or 5, the high-throughput sequencing library of claim 6, the high-throughput serum detection kit of claim 7, and the high-throughput serological detection method of claim 8 in non-disease diagnosis or treatment detection of human pathogens.

10. The use according to claim 9, characterized in that: The human pathogens include rotavirus type A, rotavirus type B, human beta herpes virus, enterovirus type B, enterovirus type C, human beta herpes virus, human adenovirus type C, rhinovirus type C, human adenovirus type B, respiratory syncytial virus, and new coronavirus.

Images