Compositions and methods for reducing base recognition errors by removing deaminated nucleotides from nucleic acid libraries

Abstract

The present disclosure provides compositions comprising reagents for removal of deaminated bases in a nucleic acid library preparation workflow, as well as methods for using the reagents. The compositions and methods described herein reduce base recognition errors in the nucleic acid sequencing workflow, such as C: G to T: A conversion.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 349,016, filed on June 3, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] References to Electronic Sequence Listings

[0004] The contents of the Electronic Sequence Listing (ELEM_011_001WO_SeqList_ST26.xml; size: 58,832 bytes; and creation date: June 1, 2023) are incorporated herein by reference in their entirety. Technical Field

[0005] The present disclosure provides compositions comprising reagents for removing deaminated bases in nucleic acid library preparation workflows, and methods for using the reagents. The compositions and methods described herein reduce base call errors, such as C:G to T:A conversions, in nucleic acid sequencing workflows. Background Art

[0006] Polynucleotide sequencing technology has applications in biomedical research and healthcare settings. Improved polynucleotide methods require enhanced surface chemistry, polynucleotide amplification on supports, and base recognition. Currently, these factors create obstacles in existing sequencing technologies, leading to limitations in throughput and poor signal-to-noise ratios, and ultimately to increased costs associated with polynucleotide sequencing.

[0007] There is a need for new polynucleotide sequencing methods with improved surface chemistry, on-support amplification, and base recognition.The present disclosure provides methods and compositions for improving polynucleotide sequencing by improving base recognition and subsequently improving sequencing quality. Summary of the invention

[0008] In one aspect, the present disclosure provides a method for reducing deaminated nucleotide bases in a nucleic acid library, the method comprising: providing a plurality of linear nucleic acid library molecules, wherein each of the plurality of linear nucleic acid library molecules comprises a target sequence joined to at least one universal adapter sequence having a binding sequence for a surface capture primer and a universal adapter sequence having a binding sequence for a sequencing primer, and wherein at least one of the library molecules carries one or more deaminated nucleotide bases; contacting the plurality of nucleic acid library molecules with a reagent that removes deaminated nucleotide bases, thereby producing at least one library molecule carrying an abasic site; circularizing the plurality of nucleic acid library molecules to produce a plurality of covalently closed circular library molecules; distributing the plurality of covalently closed circular library molecules onto a support having a plurality of fixed surface capture primers under conditions suitable for hybridizing each covalently closed circular library molecule to a surface capture primer; performing a rolling circle amplification reaction to produce a plurality of nucleic acid concatemer template molecules fixed to the support; and sequencing the plurality of nucleic acid concatemer template molecules to determine the sequence of at least a portion of the concatemer template molecules.

[0009] In some embodiments, the method further comprises (g) contacting the plurality of covalently closed circular library molecules with an agent that removes deaminated nucleotide bases, thereby generating at least one circular library molecule carrying an abasic site.

[0010] In some embodiments, the agent for removing deaminated nucleotide bases of step (b) comprises DNA glycosylase (UDG) and (i) AP lyase, (ii) Endo IV endonuclease, (iii) FPG glycosylase / AP lyase, and / or (iv) Endo VIII glycosylase / AP lyase, or a combination thereof.

[0011] In some embodiments, the reagent for removing deaminated nucleotide bases of step (g) comprises DNA glycosylase (UDG) and (i) AP lyase, (ii) Endo IV endonuclease, (iii) FPG glycosylase / AP lyase, and / or (iv) Endo VIII glycosylase / AP lyase, or a combination thereof.

[0012] In some embodiments, the plurality of immobilized surface capture primers are tethered to a polymer coating on a support.

[0013] In some embodiments, the rolling circle amplification reaction of step (e) comprises a strand displacement polymerase and a plurality of nucleotides comprising dATP, dGTP, dCTP, dTTP and / or dUTP.

[0014] In some embodiments, the plurality of immobilized surface capture primers are located at predetermined locations on the support.

[0015] In some embodiments, the plurality of immobilized surface capture primers are located at random locations on the support.

[0016] In some embodiments, the plurality of immobilized concatemeric template molecules on the support are in fluid communication with each other to allow a solution of reagents to flow onto the support. In some embodiments, the solution of reagents comprises an enzyme, nucleotides, and divalent cations.

[0017] In some embodiments, the plurality of immobilized concatemeric template molecules are reacted with reagents substantially simultaneously in a massively parallel manner.

[0018] In some embodiments, the density of the plurality of immobilized concatemer template molecules on the polymer coated support is 10 2 -10 12 / mm 2 .

[0019] In some embodiments, sequencing a plurality of immobilized concatemers comprises: contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of composite polymerases, each composite polymerase comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises a concatemer molecule hybridized to a soluble sequencing primer; contacting the plurality of composite sequencing polymerases with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to the composite sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating portion at the 3' position of the sugar; incorporating at least one nucleotide into the 3' end of the hybridized sequencing primer, thereby generating a plurality of nascent extended sequencing primers; and detecting the incorporated nucleotide and identifying the nucleobase of the incorporated nucleotide.

[0020] In some embodiments, the plurality of nucleotides comprises a removable chain-terminating moiety at the 3' sugar group, wherein the removable chain-terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group.

[0021] In some embodiments, the removable chain-terminating moiety can be cleaved with a chemical compound to generate an extendable 3' OH moiety on the sugar group.

[0022] In some embodiments, the plurality of nucleotides comprises a type of nucleotide selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0023] In some embodiments, the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0024] In some embodiments, sequencing a plurality of immobilized concatemers comprises: contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of first composite polymerases, each of which comprises a sequencing polymerase that binds to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; and contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of first composite polymerases, each of which comprises a sequencing polymerase that binds to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; and contacting the plurality of immobilized concatemer molecules with at least two of the plurality of first composite polymerases to form a plurality of multivalent polymerases. contacting a plurality of composite sequencing polymerases with a plurality of detectably labeled multivalent molecules under conditions that inhibit incorporation of the complementary nucleotide unit into sequencing primers of the plurality of multivalent-complex polymerases, wherein each multivalent molecule of the plurality of multivalent molecules comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit; detecting the plurality of multivalent-complex polymerases; and identifying the nucleobase of the complementary nucleotide unit bound to the plurality of first composite polymerases of the plurality of multivalent-complex polymerases, thereby determining the sequence of the nucleic acid template.

[0025] In some embodiments, the method further comprises: dissociating the plurality of multivalent-complex polymerases, removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining a plurality of nucleic acid duplexes; contacting the plurality of retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contacting is performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second complex polymerases, each second complex polymerase comprising a second sequencing polymerase bound to the retained nucleic acid duplexes; contacting the plurality of second complex polymerases with a plurality of nucleotides, the plurality of nucleotides comprising at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating portion at the 3' position of the sugar, wherein the contacting is performed under conditions suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the second complex polymerases of step (f), thereby forming a plurality of nucleotide-complex polymerases, and the conditions are suitable for promoting the incorporation of the bound complementary nucleotides into the sequencing primers of the nucleotide-complex polymerases.

[0026] In some embodiments, the method further comprises detecting a complementary nucleotide incorporated into a sequencing primer of a nucleotide-complex polymerase.

[0027] In some embodiments, the method further comprises detecting a complementary nucleotide incorporated into a sequencing primer of the nucleotide-complex polymerase; and identifying a nucleobase of the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

[0028] On the other hand, the present invention provides a method for sequencing by forming at least one affinity complex, the method comprising: generating a nucleic acid concatemer by rolling circle amplification of a closed circular nucleic acid molecule comprising at least one abasic site, wherein the abasic site is generated by contacting the closed circular nucleic acid molecule or the corresponding linear nucleic acid molecule with a reagent that removes deaminated nucleotide bases; binding a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule to a first portion of the concatemer molecule, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first sequencing polymerase; binding a second universal sequencing primer, a second sequencing polymerase, and a first detectably labeled multivalent molecule to a second portion of the same concatemer molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, wherein the same multivalent molecule comprises a plurality of nucleic acids. A first binding complex and a second binding complex of a multivalent molecule form an affinity complex, wherein the first detectably labeled multivalent molecule comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit, wherein the concatemer molecule comprises two or more tandem repeats of a target sequence (110) and universal primer binding sites that bind a first universal sequencing primer and a second universal sequencing primer, and wherein the contact is performed under conditions suitable for inhibiting polymerase-catalyzed incorporation of the first nucleotide unit and the second nucleotide unit bound in the first binding complex and the second binding complex; detecting the first binding complex and the second binding complex on the same concatemer molecule, and identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule.

[0029] In some embodiments, the plurality of nucleotide arms attached to the core of each multivalent molecule have the same type of nucleotide unit, and wherein the type of nucleotide unit is selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0030] In some embodiments, the plurality of multivalent molecules comprises a mixture of two or more types of multivalent molecules, each type having a nucleotide unit selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0031] In some embodiments, the plurality of nucleotides comprises a removable chain-terminating moiety at the 3' sugar group, wherein the removable chain-terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group.

[0032] In some embodiments, the removable chain-terminating moiety can be cleaved with a chemical compound to generate an extendable 3' OH moiety on the sugar group.

[0033] In some embodiments, the plurality of nucleotides comprises a type of nucleotide selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0034] In some embodiments, the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0035] In some embodiments, the support comprises a glass substrate.

[0036] In some embodiments, the support comprises a plastic substrate.

[0037] In some embodiments, the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no greater than 45 degrees. In some embodiments, the at least one hydrophilic polymer coating comprises a molecule selected from the group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxyethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), polylysine, polyglucoside, streptavidin, and dextran.

[0038] In some embodiments, the method further comprises determining a base calling error percentage based on the sequencing of step (f).

[0039] In some embodiments, the method further comprises determining a quality score for the sequencing data based on the base call error percentage. In some embodiments, the quality score is a Phred quality score. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The features of the present invention are particularly set forth in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description setting forth exemplary embodiments, in which the principles of the present disclosure are utilized, and in the accompanying drawings:

[0041] Figure 1 is a schematic diagram showing exemplary circularization of a linear single-stranded library molecule (100) by hybridization with a double-stranded splint molecule adaptor (200).

[0042] Figure 2 is a schematic diagram showing an exemplary library-splint complex (500) undergoing a ligation reaction to close the gap to form a covalently closed circular library molecule (600), which is hybridized to the first splint strand (300), wherein the first splint strand (300) can be used as an amplification primer to perform a rolling circle amplification reaction. The dotted line represents the nascent extension product.

[0043] Figure 3 The nucleotide sequence of an exemplary double-stranded splint molecule (200) having a first splint chain (300) and a second splint chain (400) is shown. The exemplary first splint chain comprises a first region (320; SEQ ID NO:4), a second region (330; SEQ ID NO:5), and an inner region (310) having a fourth subregion (SEQ ID NO:6) and a fifth subregion (SEQ ID NO:7). The first splint chain (300) comprises a first region (320) and a second region (330) and an inner region (310) (SEQ ID NO:8). The exemplary second splint chain (400) comprises a first subregion (SEQ ID NO:1) and a second subregion (SEQ ID NO:2). The second splint chain (400) comprises a first subregion and a second subregion (SEQ ID NO:3).

[0044] Figure 4 Schematic diagram showing hybridization of an exemplary linear single-stranded library molecule (700) with a single-stranded splint molecule / strand (800), thereby looping the library molecule to form a gapped library-splint complex (900). The exemplary library molecule (700) comprises: a first left universal adapter sequence (720); an optional first left unique identification sequence (780); a first left index sequence (760); a second left universal adapter sequence (740); a target sequence (710); a second right universal adapter sequence (750); a first right index sequence (770); and a first right universal adapter sequence (730). The single-stranded splint strand (800) comprises a first region (810) that hybridizes to a sequence on one end of the linear single-stranded library molecule and a second region (820) that hybridizes to a sequence on the other end of the linear single-stranded library molecule.

[0045] Figure 5 is a schematic diagram showing an exemplary library-splint complex (900) undergoing a ligation reaction to close the gap to form a covalently closed circular library molecule (1000), which is hybridized to a single-stranded splint strand (800), wherein the single-stranded splint strand (800) is used as an amplification primer for a rolling circle amplification reaction. The dotted line represents the nascent extension product.

[0046] Figure 6 The nucleotide sequence of an exemplary single-stranded splint molecule / chain (800; SEQ ID NO: 203) is shown. The exemplary single-stranded splint chain comprises a first region (810; SEQ ID NO: 9), a second region (820; SEQ ID NO: 10).

[0047] Figure 7 is Table 1 (a total of 3 sheets), which lists the sequence of an exemplary first left index sequence (160) or (760), and Table 2 (a total of 3 sheets), which lists the sequence of an exemplary first right index sequence (170) or (770) having a short random sequence (e.g., NNN).

[0048] Figure 8 is a schematic diagram of an exemplary low binding support comprising a glass substrate and alternating hydrophilic coatings covalently or non-covalently attached to the glass, and which further comprises chemically reactive functional groups that serve as attachment sites for oligonucleotide primers (e.g., capture oligonucleotides). In alternative embodiments, the support may be made of any material, such as glass, plastic, or polymeric material.

[0049] Fig. 9 are schematic diagrams of various exemplary configurations of multivalent molecules. Left (Class I): Schematic diagrams of multivalent molecules having a "starburst" or "helter-skelter" configuration. Center (Class II): Schematic diagrams of multivalent molecules having a dendritic configuration. Right (Class III): Schematic diagrams of multiple multivalent molecules formed by reacting streptavidin with 4-arm or 8-arm PEG-NHS with biotin and dNTPs. The nucleotide unit is designated as 'N', biotin is designated as 'B', and streptavidin is designated as 'SA'.

[0050] Fig.10 is a schematic diagram of an exemplary multivalent molecule comprising a universal core attached to multiple nucleotide arms.

[0051] Fig.11 is a schematic diagram of an exemplary multivalent molecule comprising a dendritic core attached to multiple nucleotide arms.

[0052] Fig.12 A schematic diagram of an exemplary multivalent molecule comprising a core attached to a plurality of nucleotide arms, wherein the nucleotide arms comprise biotin, spacers, linkers, and nucleotide units is shown.

[0053] Fig.13 is a schematic diagram of an exemplary nucleotide arm comprising a core attachment portion, a spacer, a linker and a nucleotide unit.

[0054] Fig.14 Shown are the chemical structures of exemplary spacers (top) and various exemplary linkers, including an 11-atom linker, a 16-atom linker, a 23-atom linker, and an N3 linker (bottom).

[0055] Fig.15 The chemical structures of various exemplary linkers are shown, including Linkers 1-9.

[0056] Fig.16 The chemical structures of various exemplary linkers joined / attached to the nucleotide units are shown.

[0057] Fig.17 The chemical structures of various exemplary linkers joined / attached to the nucleotide units are shown.

[0058] Fig.18 The chemical structures of various exemplary linkers joined / attached to the nucleotide units are shown.

[0059] Fig.19 The chemical structures of exemplary linkers joined / attached to the nucleotide units are shown.

[0060] Fig. 20 The chemical structure of an exemplary biotinylated nucleotide arm is shown. In this example, the nucleotide unit is linked to the linker via a propargylamine attachment at position 5 of the pyrimidine base or position 7 of the purine base.

[0061] Fig.21 The chemical structures of various nucleotide bases and their corresponding deaminated bases are shown, including: cytosine deaminated to uracil; adenine deaminated to hypoxanthine; guanine deaminated to xanthine; and 5-methylcytosine deaminated to thymine.

[0062] Fig. 22 are two figures showing the use of double-stranded splint adapters (see, for example, Figures 1 to 3 ) Sequencing quality scores of concatemer template molecules generated by the workflow for circularizing linear library molecules, with and without USER TM The control plot on the left shows the library preparation workflow without USER TM The sequencing quality scores of base calls T, C, A, and G of the concatemer template molecules generated by processing.

[0063] Fig.23 are two figures showing the use of double-stranded splint adapters (see, for example, Figures 1 to 3 ) Sequencing quality scores of concatemer template molecules generated by the workflow for circularizing linear library molecules, with and without USER TM The control plot on the left shows the library preparation workflow without USER TM The sequencing quality scores of base calls T, C, A, and G of the concatemer template molecules generated by processing. DETAILED DESCRIPTION

[0064] definition:

[0065] The headings provided herein are not limitations of the various aspects of the disclosure, which can be understood by reference to the specification as a whole.

[0066] Unless otherwise defined, the technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art, unless otherwise defined. In general, the terms related to the technology of molecular biology, nucleic acid chemistry, protein chemistry, genetics, microbiology, transgenic cell production and hybridization as described herein are those well-known and commonly used in the art. The techniques and procedures described herein are generally performed according to conventional methods well known in the art and as described in the various general and more specific references cited and discussed throughout this specification. For example, referring to Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 2000). See also Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992). The nomenclature used in conjunction with laboratory procedures and techniques as described herein is well known and commonly used in the art.

[0067] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The singular forms "a," "an," and "the," as well as any word used in the singular, include plural referents unless expressly and unequivocally limited to one referent.

[0068] It should be understood that the use of alternative terms (eg, "or") is taken to mean one or both of the alternatives or any combination thereof.

[0069] As used herein, the term "and / or" should be taken to mean a specific disclosure of each of the specified features or components with or without another. For example, the term "and / or" as used in phrases such as "A and / or B" herein is intended to include: "A and B"; "A or B"; "A" (only A); and "B" (only B). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" herein is intended to cover each of the following aspects: "A, B, and C"; "A, B, or C"; "A or C"; "A or B"; "B or C"; "A and B"; "B and C"; "A and C"; "A" (only A); "B" (only B); and "C" (only C).

[0070] As used herein and in the appended claims, the terms "comprises," "including," "having," and "containing," and grammatical variations thereof, as used herein, are intended to be non-limiting, such that one or more items in a list are not exclusive of other items that can be substituted or added to the listed items. It should be understood that whenever aspects are described herein with the language "comprising," similar aspects described with "consisting of" and / or "consisting essentially of" are also otherwise provided.

[0071] As used herein, the terms "about" and "approximately" refer to values ​​or compositions within an acceptable error range for a particular value or composition as determined by a person of ordinary skill in the art, which will depend in part on how to measure or determine the value or composition, i.e., the limitations of the measurement system. For example, according to practice in the art, "about" or "approximately" may mean within one or more than one standard deviation. Alternatively, "about" or "approximately" may mean a range of up to 10% (i.e., ± 10%) or more, depending on the limitations of the measurement system. For example, about 5 mg may include any number between 4.5 mg and 5.5 mg. In addition, particularly for biological systems or processes, these terms may mean a value of up to an order of magnitude or up to 5 times. When a particular value or composition is provided in the present disclosure, unless otherwise stated, the meaning of "about" or "approximately" should be assumed to be within an acceptable error range for the particular value or composition. In addition, in the case of providing a range and / or sub-range of a value, the range and / or sub-range may include the endpoints of the range and / or sub-range.

[0072] The terms "peptide", "polypeptide" and "protein" and other related terms used herein are used interchangeably and refer to polymers of amino acids and are not limited to any particular length. Polypeptides may include natural and non-natural amino acids. Polypeptides include recombinant or chemically synthesized forms. Polypeptides also include precursor molecules that have not yet undergone post-translational modifications, such as proteolytic cleavage, cleavage due to ribosome skipping, hydroxylation, methylation, lipidation, acetylation, SUMOylation, ubiquitination, glycosylation, phosphorylation and / or disulfide bond formation. These terms encompass natural and artificial proteins, protein fragments and polypeptide analogs (such as mutant proteins, variants, chimeric proteins and fusion proteins) of protein sequences, as well as proteins that are covalently or non-covalently modified after translation or otherwise.

[0073] The term "cell biological sample" refers to a single cell, a plurality of cells, a tissue, an organ, an organism or a section of any of these cell biological samples. Cell biological samples can be extracted from an organism (e.g., a biopsy), or obtained from a cell culture grown in a liquid or a culture dish. Cell biological samples include fresh, frozen, freshly frozen or archived samples (e.g., formalin-fixed paraffin-embedded; FFPE). Cell biological samples can be embedded in wax, resin, epoxy resin or agar. Cell biological samples can be fixed in any one of, for example, acetone, ethanol, methanol, formaldehyde, paraformaldehyde-Triton or glutaraldehyde or any combination of two or more. Cell biological samples can be sectioned or unsectioned. Cell biological samples can be stained, decolorized or unstained.

[0074] The target nucleic acid can be extracted from cells or cell biological samples using any of a variety of techniques known to those skilled in the art. For example, a typical DNA extraction procedure includes: (i) collecting a cell sample or tissue sample from which DNA is to be extracted, (ii) disrupting the cell membrane (i.e., cell lysis) to release DNA and other cytoplasmic components, (iii) treating the dissolved sample with a concentrated salt solution to precipitate proteins, lipids, and RNA, followed by centrifugation to separate the precipitated proteins, lipids, and RNA, and (iv) purifying the DNA from the supernatant to remove detergents, proteins, salts, or other reagents used during cell membrane lysis. A variety of suitable commercial nucleic acid extraction and purification kits are consistent with the disclosure herein. Examples include, but are not limited to: TM QIAamp (Germantown, MD) TM Kit (for isolating genomic DNA from human samples) and DNAeasy TM Kit (for isolating genomic DNA from animal or plant samples), or from Promega TM (Madison, WI) and ReliaPrepTM Series of test kits.

[0075] As used herein, the term "polymerase" and variants thereof include enzymes comprising a domain that binds nucleotides (or nucleosides), wherein the polymerase can form a complex with a template nucleic acid and a complementary nucleotide. The polymerase can have one or more activities, including but not limited to: base analog detection activity, DNA polymerization activity, reverse transcriptase activity, DNA binding, strand displacement activity, and nucleotide binding and recognition. The polymerase can be any enzyme that can catalyze the polymerization of nucleotides (including analogs thereof) into a nucleic acid chain. Typically, but not necessarily, such nucleotide polymerization can occur in a template-dependent manner. Typically, the polymerase includes one or more active sites at which nucleotide binding and / or nucleotide polymerization catalysis can occur. In some embodiments, the polymerase includes other enzymatic activities, such as, for example, 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, the polymerase has a strand displacement activity. Polymerases may include, but are not limited to, naturally occurring polymerases and any of their subunits and truncations, mutant polymerases, variant polymerases, recombinant, fused or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof (e.g., catalytically active fragments) that retain the ability to catalyze nucleotide polymerization. Polymerases include catalytically inactive polymerases, catalytically active polymerases, reverse transcriptases and other enzymes comprising nucleotide binding domains. In some embodiments, polymerases may be isolated from cells or produced using recombinant DNA technology or chemical synthesis methods. In some embodiments, polymerases may be expressed in prokaryotes, eukaryotes, viruses or bacteriophage organisms. In some embodiments, polymerases may be post-translationally modified proteins or fragments thereof. Polymerases may be derived from prokaryotes, eukaryotes, viruses or bacteriophages. Polymerases include DNA-guided DNA polymerases and RNA-guided DNA polymerases.

[0076] The term "strand displacement" refers to the ability of a polymerase to locally separate a double-stranded nucleic acid chain and synthesize a new chain in a template-based manner. The strand displacement polymerase displaces the complementary chain from the template chain and catalyzes the synthesis of the new chain. Strand displacement polymerases include mesophilic and thermophilic polymerases. Strand displacement polymerases include wild-type enzymes and variants (including exonucleases minus mutants, mutant versions, chimeric enzymes, and truncated enzymes). Examples of strand displacement polymerases include phi29 DNA polymerase, Bst DNA polymerase large fragment, Bsu DNA polymerase large fragment (exo-), Bca DNA polymerase (exo-), Klenow fragment of Escherichia coli DNA polymerase, T5 polymerase, M-MuLV reverse transcriptase, HIV virus reverse transcriptase, Deep Vent DNA polymerase, and KOD DNA polymerase. The phi29 DNA polymerase can be a wild-type phi29 DNA polymerase (e.g., from Expedeon TM MagniPhi TM ), or variant EquiPhi29 TM DNA polymerase (e.g., from Thermo Fisher Scientific TM ), or chimeric QualiPhi TM DNA polymerase (e.g., from 4basebio TM ).

[0077] The terms "nucleic acid", "polynucleotide" and "oligonucleotide" and other related terms used herein are used interchangeably and refer to polymers of nucleotides and are not limited to any specific length. Nucleic acids include recombinant and chemically synthesized forms. Nucleic acids can be isolated. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of DNA or RNA produced using nucleotide analogs (e.g., peptide nucleic acids and non-natural nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acids can be single-stranded or double-stranded. Nucleic acids include polymers of nucleotides, wherein the nucleotides include natural or non-natural bases and / or sugars. Nucleic acids include naturally occurring internucleoside bonds, such as phosphodiester bonds. Nucleic acids include non-natural internucleoside bonds, including phosphorothioate, thiol phosphorothioate or peptide nucleic acid (PNA) bonds. In some embodiments, nucleic acids include a mixture of one type of polynucleotide or two or more different types of polynucleotides.

[0078] As used herein, the terms "operably linked" and "operably connected" or related terms refer to the juxtaposition of components. The juxtaposed components can be covalently linked together. For example, two nucleic acid components can be enzymatically linked together, wherein the bond linking the two components together comprises a phosphodiester bond. The first and second nucleic acid components can be linked together, wherein the first nucleic acid component can confer a function to the second nucleic acid component. For example, the link between the primer binding sequence and the target sequence forms a nucleic acid library molecule having a portion that can bind to the primer. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or a target nucleic acid sequence) can be linked to a support, wherein the link allows the transgenic sequence contained in the support to be expressed or function. In some embodiments, the transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects transgenic expression. In some embodiments, the vector comprises at least one host cell regulatory sequence, including a promoter sequence, an enhancer, a transcription and / or translation initiation sequence, a transcription and / or translation termination sequence, a polypeptide secretion signal sequence, and the like. In some embodiments, the host cell regulatory sequence controls the expression of the level, timing, and / or position of the transgene.

[0079] The terms "linked," "connected," "attached," "appended," and variations thereof include any type of fusion, binding, attachment, or association between any combination of compounds or molecules that is sufficiently stable to withstand use in a particular procedure. The procedure may include, but is not limited to: nucleotide binding; nucleotide incorporation; deblocking (e.g., removal of chain terminating moieties); washing; removal; flow; detection; imaging and / or identification. For example, such bonds may include, for example, covalent bonds, ionic bonds, hydrogen bonds, dipole-dipole bonds, hydrophilic bonds, hydrophobic bonds or affinity bonds, bonds or associations involving van der Waals forces, mechanical bonds, and the like. In some embodiments, such bonds occur within a molecule, such as linking the ends of a single-stranded or double-stranded linear nucleic acid molecule together to form a circular molecule. In some embodiments, such bonds may occur between combinations of different molecules, or between molecules and non-molecules, including but not limited to: bonds between nucleic acid molecules and solid surfaces; bonds between proteins and detectable reporter moieties; bonds between nucleotides and detectable reporter moieties; and the like. Some examples of bonds can be found, for example, in Hermanson, G., “Bioconjugate Techniques”, 2nd edition (2008); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998).

[0080] The term "primer" and related terms used herein refer to oligonucleotides that can hybridize with DNA and / or RNA polynucleotide templates to form duplex molecules. Primers can be single-stranded or have single-stranded and double-stranded portions along their entire length. Primers include natural nucleotides and / or nucleotide analogs. Primers can be recombinant nucleic acid molecules. Primers can have any length, but generally range from 4 to 50 nucleotides. Typical primers include 5' ends and 3' ends. The 3' end of the primer may include a 3'OH portion that serves as a nucleotide polymerization start site in a primer extension reaction catalyzed by a polymerase. Alternatively, the 3' end of the primer may lack a 3'OH portion or may include a terminal 3' blocking group that inhibits nucleotide polymerization in a polymerase-catalyzed reaction. Any nucleotide along the length of the primer or more than one nucleotide may be labeled with a detectable reporter gene portion. Primers may be in solution (e.g., soluble primers) or may be fixed to a support (e.g., capture primers).

[0081] The terms "template nucleic acid," "template polynucleotide," "target nucleic acid," "target polynucleotide," "template strand," and other variants refer to a nucleic acid strand used as a base nucleic acid molecule in any amplification and / or sequencing method described herein. The template nucleic acid can be single-stranded or double-stranded, or the template nucleic acid can have single-stranded or double-stranded portions. The template nucleic acid can be obtained from a naturally occurring source, a recombinant form, or chemically synthesized to include any type of nucleic acid analog. The template nucleic acid can be linear, concatemeric, circular, or in other forms.

[0082] The term "adapter" and related terms refer to an oligonucleotide that can be operably linked (appended) to a target polynucleotide, wherein the adaptor confers a function to a co-linked adaptor-target molecule. Adaptors include DNA, RNA, chimeric DNA / RNA or their analogs. An adaptor may include at least one ribonucleoside residue. An adaptor may be single-stranded, double-stranded or have a single-stranded and / or double-stranded portion. An adaptor may be configured as a linear, stem-loop, hairpin or Y-shaped form. An adaptor may be of any length, including 4 to 100 nucleotides or longer. An adaptor may have a blunt end, an overhang end or a combination of the two. Overhang ends include 5' overhang ends and 3' overhang ends. The 5' end of a single-stranded adaptor or one chain of a double-stranded adaptor may have a 5' phosphate group or lack a 5' phosphate group. An adaptor may include a 5' tail (e.g., a tailed adaptor) that is not hybridized with a target polynucleotide, or an adaptor may be tailless. At least a portion of an adaptor may include a known and predetermined sequence. The adapter may comprise a sequence complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., a soluble or immobilized capture primer). The adapter may comprise a random sequence or a degenerate sequence. The adapter may comprise at least one inosine residue. The adapter may comprise at least one phosphorothioate, phosphorothiol and / or phosphoramide bond. The adapter may comprise at least one barcode sequence that can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. The adapter may comprise at least one unique identification sequence (e.g., a molecular identifier) ​​that can be used to uniquely identify the nucleic acid molecule to which the adapter is appended. In some embodiments, the unique identification sequence comprises 2 to 12 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) or more nucleotides with a known sequence. For example, the unique identification sequence comprises a known random sequence in which the nucleotides at each position are randomly selected from nucleotides having bases A, G, C, T, or U. The adaptor may include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from the group consisting of Type I, Type II, Type III, Type IV, Type Hs, or Type IIB.

[0083] The term "universal sequence" and related terms refer to a sequence common to two or more polynucleotide molecules in a nucleic acid molecule. For example, an adaptor with a universal sequence can be operably joined to a plurality of polynucleotides such that the co-joined population of molecules carries the same universal adaptor sequence. Examples of universal adaptor sequences include amplification primer sequences, sequencing primer sequences, or capture primer sequences (e.g., soluble or fixed capture primers).

[0084] When used to refer to nucleic acid molecules, the term "hybridize" or "hybridizing" or "hybridization" or other related terms refer to hydrogen bonding between two different nucleic acids to form a duplex nucleic acid. Hybridization also includes hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridizing molecule with a duplex region. Hybridization may include Watson-Crick or Hoogstein bonding to form a duplex double-stranded nucleic acid or a double-stranded region within a nucleic acid molecule. The two different regions of a double-stranded nucleic acid or a single nucleic acid may be completely complementary or partially complementary. Complementary nucleic acid chains do not need to hybridize to each other across their entire length. Complementary base pairing may be standard AT or CG base pairing or may be other forms of base pairing interactions. A duplex nucleic acid may include mismatched base-paired nucleotides.

[0085] When used to refer to nucleic acids, the terms "extend, extending, extension" and other variants refer to the incorporation of one or more nucleotides into a nucleic acid molecule. Nucleotide incorporation includes the polymerization of one or more nucleotides into the terminal 3'OH end of a nucleic acid chain, resulting in an extension of the nucleic acid chain. Nucleotide incorporation can be performed with natural nucleotides and / or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in a template-dependent manner. Any suitable method for extending nucleic acid molecules can be used, including primer extension catalyzed by a DNA polymerase or an RNA polymerase.

[0086] The term "nucleotide" and related terms refer to molecules comprising an aromatic base, a five-carbon sugar (e.g., ribose or deoxyribose) and at least one phosphate group. Regular or non-regular nucleotides are consistent with the use of the term. In certain embodiments, nucleotides comprise monophosphate, diphosphate or triphosphate, or corresponding phosphate analogs. The term "nucleoside" refers to a molecule comprising an aromatic base and a sugar. Nucleotides and nucleosides can be unlabeled or labeled with a detectable reporter moiety.

[0087] Nucleotides (and nucleosides) typically contain heterocyclic bases, including substituted or unsubstituted nitrogen-containing parent heteroaromatic rings, which are commonly found in nucleic acids, including naturally occurring, substituted, modified or engineered variants or their analogs. The base of a nucleotide (or nucleoside) is capable of forming Watson-Crick and / or Hoogstein hydrogen bonds with an appropriate complementary base. Exemplary bases include, but are not limited to, purines and pyrimidines, such as 2-aminopurine, 2,6-diaminopurine, adenine (A), ethyleneadenine, N 6 -Δ 2 -Isopentenyl adenine (6iA), N 6 -Δ 2 -Isopentenyl-2-methylthioadenine (2ms6iA), N 6 -methyladenine, guanine (G), isoguanine, N 2 -dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and O 6 -methylguanine; 7-deazapurines, such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G); pyrimidines, such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4-thiothymine (4sT), 5,6-dihydrothymine, O 4 -methylthymine, uracil (U), 4-thiouracil (4sU) and 5,6-dihydrouracil (dihydrouracil; D); indoles such as nitroindole and 4-methylindole; pyrroles such as nitropyrrole; agarosin; inosines; hydroxymethylcytosines; 5-methylcytosines; bases (Y); and methylated, glycosylated and acylated base moieties; etc. Additional exemplary bases can be found in Fasman, 1989, in "Practical Handbook of Biochemistry and Molecular Biology", pages 385 to 394, CRC Press, Boca Raton, Fla.

[0088] Nucleotides (and nucleosides) typically contain a sugar moiety, such as a carbocyclic moiety (Ferraro and Gotor 2000 Chem. Rev. 100:4319-48), an acyclic moiety (Martinez et al., 1999 Nucleic Acids Research 27:1271-1274; Martinez et al., 1997 Bioorganic & Medicinal Chemistry Letters Vol. 7:3013-3016) and other sugar moieties (Joeng et al., 1993 J. Med. Chem. 36:2627-2638; Kim et al., 1993 J. Med. Chem. 36:30-7; Eschenmosser 1999 Science 284:2118-2124; and U.S. Pat. No. 5,558,991). The sugar moiety comprises: ribosyl; 2'-deoxyribosyl; 3'-deoxyribosyl; 2',3'-dideoxyribosyl; 2',3'-didehydrodideoxyribosyl; 2'-alkoxyribosyl; 2'-azidoribosyl; 2'-aminoribosyl; 2'-fluororibosyl; 2'-thiolcarboxyl; 2'-alkylthioribosyl; 3'-alkoxyribosyl; 3'-azidoribosyl; 3'-aminoribosyl; 3'-fluororibosyl; 3'-thiolcarboxyl; 3'-alkylthioribosyl carbocyclic; acyclic or other modified sugars.

[0089] In some embodiments, the nucleotide comprises a chain of one, two or three phosphorus atoms, wherein the chain is usually attached to the 5' carbon of the sugar moiety via an ester or phosphoramide bond. In some embodiments, the nucleotide is an analog with a phosphorus chain, wherein the phosphorus atom is linked together with an intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atom in the chain comprises a substituted side group, including O, S or BH3. In some embodiments, the chain comprises a phosphate group substituted with an analog, including phosphoramide, phosphorothioate, phosphorodithioate and O-methylphosphoramidite groups.

[0090] As used herein, a "nucleotide unit" or "nucleotide portion" refers to a nucleotide (e.g., dATP, dTTP, dGTP, dCTP or dUTP) or an analog thereof, which comprises a base, a sugar and at least one phosphate group. A nucleotide unit can be attached to a multivalent molecule used in a sequencing reaction as described herein. Generally, all nucleotide units attached to the same multivalent molecule will have the same identity (e.g., all A, all T, all C or all G), although those skilled in the art will appreciate that there may be multivalent molecules in which nucleotide units of different identities will be advantageous.

[0091] The term "rolling circle amplification" generally refers to an amplification method using a circular nucleic acid template molecule, which contains a target sequence of interest, an amplification primer binding sequence, and optionally one or more adapter sequences, such as a sequencing primer binding sequence and / or a sample index sequence. The rolling circle amplification reaction can be performed under isothermal amplification conditions and includes a circular nucleic acid template molecule, an amplification primer, a strand displacement polymerase, and a plurality of nucleotides to produce a concatemer containing a tandem repeat sequence of a circular template molecule and any adapter sequence present in the original circular nucleic acid template molecule. The concatemer can self-collapse to form a nucleic acid nanoball. The shape and size of the nanoball can be further compressed by including a pair of inverted repeat sequences in the circular template molecule, or by performing a rolling circle amplification reaction with one or more compacting oligonucleotides. One of the advantages of using rolling circle amplification to produce clonal amplicons for sequencing workflows is that repeated copies of the target sequence in the nanoball can be sequenced simultaneously to increase signal intensity. In some embodiments, the rolling circle amplification reaction can be performed in the presence of multiple compactions with at least four consecutive guanines. The rolling circle amplification reaction produces a concatemer comprising repeated copies of a universal binding sequence for a compacted oligonucleotide. At least one compacted oligonucleotide can form a guanine quadruplex and hybridize with a universal binding sequence for a compacted oligonucleotide, and the resulting concatemer can fold to form an intramolecular G-quadruplex structure. The concatemer can self-collapse to form a compact nanoball. The formation of guanine quadruplexes and G-quadruplexes in the nanoball can increase the stability of the nanoball to maintain its compact size and shape, so that it can withstand the repeated flow of reagents for performing any sequencing workflow described herein.

[0092] When used to refer to nucleic acids, the terms "amplify, amplifying, amplification" and other related terms include generating multiple copies of the original polynucleotide template molecule, wherein the copies comprise a sequence complementary to the template sequence, and / or the copies comprise a sequence identical to the template sequence. In some embodiments, the copies comprise a sequence substantially identical to the template sequence, and / or a sequence substantially identical to a sequence complementary to the template sequence.

[0093] The term "reporter moiety", "reporter moieties" or related terms refers to a compound that produces or causes a detectable signal. The reporter moiety is sometimes referred to as a "label". Any suitable reporter moiety can be used, including luminescence, photoluminescence, electroluminescence, bioluminescence, chemiluminescence, fluorescence, phosphorescence, chromophore, radioisotope, electrochemistry, mass spectrometry, Raman, hapten, affinity tag, atom or enzyme. The reporter moiety produces a detectable signal caused by a chemical or physical change (e.g., heat, light, electricity, pH, salt concentration, enzyme activity or adjacent event). The adjacent event includes two reporter moieties that are close to each other, or associate with each other, or bind to each other. It is well known to those skilled in the art that the reporter moiety is selected so that each absorbs excitation radiation and / or emits fluorescence at a wavelength that can be distinguished from other reporter moieties to allow monitoring of the presence of different reporter moieties in the same reaction or in different reactions. Two or more different reporter moieties with spectrally distinct emission curves or with minimal overlapping spectral emission curves can be selected. The reporter moiety can be linked (eg, operably linked) to a nucleotide, nucleoside, nucleic acid, enzyme (eg, a polymerase or reverse transcriptase), or support (eg, a surface).

[0094] Reporter moieties (or labels) include fluorescent labels or fluorophores. Exemplary fluorescent moieties that can be used as fluorescent labels or fluorophores include, but are not limited to, fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynaphthol fluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamidofluorescein, maleimidofluorescein, SAMSA-fluorescein, thiosemicarbazide fluorescein, hydrazine carbonate methylthioacetamidofluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lissamine rhodamine, Texas Red, Rhodamine B, Rhodamine 6G, Rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lissamine rhodamine B sulfonyl chloride, lissamine rhodamine B sulfonyl hydrazide, Texas Red sulfonyl chloride, Texas Red hydrazide, coumarins and coumarin derivatives such as AMCA, AMCA-NHS, AMCA-sulfo-NHS, AMCA-HPDP, DCIA, AMCE-hydrazide, BODIPY and derivatives such as BODIPY FL C3-SE, BODIPY 530 / 550C3, BODIPY 530 / 550C3-SE, BODIPY 530 / 550C3 hydrazide, BODIPY 493 / 503C3 hydrazide, BODIPY FL C3 hydrazide, BODIPY FLIA, BODIPY 530 / 551IA, Br-BODIPY 493 / 503, Cascade Blue and derivatives such as Cascade Blue acetyl triazoide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide, Lucifer Yellow and derivatives such as Lucifer Yellow iodoacetamide, Lucifer Yellow CH, cyanines and derivatives such as indolium cyanine dyes, benzindolium cyanine dyes, pyridinium cyanine dyes, thiazolium cyanine dyes, quinolinium cyanine dyes, imidazolium cyanine dyes, Cy 3. Cy5, lanthanide chelates and derivatives, such as BCPDA, TBP, TMT, BHHCT, BCOT, europium chelates, terbium chelates, Alexa Fluor dyes, DyLight dyes, Atto dyes, LightCycler Red dyes, CAL Flour dyes, JOE and its derivatives, Oregon Green dyes, WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, malachite green, diphenylethylene, DEG dyes, NR dyes, near-infrared dyes, and other dyes known in the art, such as Haugland, Molecular Probes Handbook, (Eugene, Oreg.) 6th edition;Those described in Lakowicz, Principles of Fluorescence Spectroscopy, 2nd Edition, Plenum Press New York (1999) or Hermanson, Bioconjugate Techniques, 2nd Edition, or derivatives thereof;or any combination thereof. Cyanine dyes may exist in sulfonated or non-sulfonated form and consist of two indolenine, benzindolium, pyridinium, thiazolium and / or quinolinium groups separated by a polymethine bridge between the two nitrogen atoms. Commercially available cyanine fluorophores include, for example, Cy3 (which may include 1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium or 1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium oxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium-5-sulfonate), Cy5 (which may include 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium-5-sulfonate), Cy5 (which may include 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indol-2-ylidene )penta-1,3-dien-1-yl)-3,3-dimethyl-3H-indol-1-ium or 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfoindol-2-ylidene)penta-1,3-dien-1-yl)-3,3-dimethyl-3H-indol-1-ium-5-sulfonate) and Cy7 (which may contain 1-(5-carboxypentyl) )-2-[(1E,3E,5E,7Z)-7-(1-ethyl-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-trien-1-yl]-3H-indolium or 1-(5-carboxypentyl)-2-[(1E,3E,5E,7Z)-7-(1-ethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-trien-1-yl]-3H-indolium-5-sulfonate), where "Cy" stands for 'cyanine' and the first digit identifies the number of carbon atoms between the two indolenine groups. Cy2 is an oxazole derivative rather than an indolenine, and the benzo-derivatized Cy3.5, Cy5.5 and Cy7.5 are exceptions to this rule. ;

[0095] In some embodiments, the reporter moiety may be a FRET pair, so that multiple classifications may be performed in a single excitation and imaging step. As used herein, FRET may include excitation exchange (Forster) transfer or electron exchange (Dexter) transfer.

[0096] As used herein, the term "support" refers to a substrate designed for the deposition of biological molecules or biological samples for measurement and / or analysis. Examples of biological molecules to be deposited on the support include nucleic acids (e.g., DNA, RNA, and combinations thereof), polypeptides, carbohydrates, lipids, single cells or multiple cells. Examples of biological samples include, but are not limited to, saliva, sputum, mucus, blood, plasma, serum, urine, feces, sweat, tears, and fluids from tissues or organs.

[0097] In some embodiments, the support is solid, semi-solid or a combination of the two. In some embodiments, the support is porous, semi-porous, non-porous or any combination of porosity. In some embodiments, the support can be substantially planar, concave, convex or any combination thereof. In some embodiments, the support can be cylindrical, for example, including a capillary or the inner surface of a capillary.

[0098] In some embodiments, the surface of the support can be substantially smooth. In some embodiments, the support can have a regular or irregular texture, including bumps, etchings, holes, three-dimensional scaffolds, or any combination thereof.

[0099] In some embodiments, the support comprises beads having any shape, including spheres, hemispheres, cylinders, barrels, rings, disks, rods, cones, triangles, cubes, polygons, tubes, or wires.

[0100] The support can be made of any material, including but not limited to: glass, fused silica, silicon, polymers (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethyl methacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymer (COP), cyclic olefin copolymer (COC), polyethylene terephthalate (PET)), or any combination thereof. In some embodiments, the support comprises a polymer, such as a synthetic polymer. In some embodiments, the support comprises glass. In some embodiments, the support comprises plastic. Various compositions of both glass and plastic substrates are contemplated.

[0101] In some embodiments, the present disclosure provides multiple (e.g., two or more) nucleic acid template molecules fixed to a support. In some embodiments, the multiple nucleic acid template molecules fixed have the same sequence. In some embodiments, the multiple nucleic acid template molecules fixed have different sequences. In some embodiments, each nucleic acid template molecule in a plurality of nucleic acid template molecules is fixed to different sites on a support. In some embodiments, two or more independent nucleic acid template molecules in the plurality of nucleic acid templates are fixed to sites on a support.

[0102] The term "array" refers to a support comprising a plurality of sites located at predetermined positions on the support to form an array of sites. The sites may be discrete and separated by gap regions. In some embodiments, the predetermined sites on the support may be arranged in a one-dimensional manner, such as in rows or columns. In some embodiments, the predetermined sites on the support are arranged in a two-dimensional manner, such as in rows and columns. In some embodiments, the plurality of predetermined sites are arranged in an organized manner on the support. In some embodiments, the plurality of predetermined sites are arranged in any organized pattern, including straight lines, hexagonal patterns, grid patterns, patterns with reflection symmetry, patterns with rotational symmetry, and the like. The spacing between different pairs of sites may be the same or may be different. In some embodiments, the support comprises at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 10 9 sites, at least 10 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, at least 10 15 In some embodiments, the plurality of predetermined sites (e.g., 10 2 Up to 10 15 In some embodiments, the nucleic acid template molecules are fixed at a plurality of predetermined sites by hybridizing with the fixed surface capture primers. In some embodiments, the nucleic acid template molecules are covalently attached to the surface capture primers. In some embodiments, the nucleic acid template molecules are fixed at a plurality of predetermined sites, for example, fixed at 10 2 Up to 10 15 sites (e.g., 10 2sites, 10 3 sites, 10 4 sites, 10 5 sites, 10 6 sites, 10 7 sites, 10 8 sites, 10 9 sites, 10 10 sites, 10 11 sites, 10 12 sites, 10 13 sites, 10 14 sites or 10 15 In some embodiments, the fixed nucleic acid template molecules are cloned and amplified to produce fixed nucleic acid clusters at multiple predetermined sites. In some embodiments, each fixed nucleic acid cluster comprises a linear cluster. In some embodiments, each fixed nucleic acid cluster comprises a single-stranded or double-stranded concatemer.

[0103] In some embodiments, a support comprising a plurality of sites located at random positions on the support is referred to herein as a support having randomly positioned sites thereon. The positions of the randomly positioned sites on the support are not predetermined. The plurality of randomly positioned sites are arranged on the support in a disordered and / or unpredictable manner. In some embodiments, the support comprises at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 10 9 sites, at least 10 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, at least 10 15 In some embodiments, a plurality of randomly positioned sites (e.g., 10 2 -10 15 sites or more (e.g., 10 2 sites, 10 3 sites, 10 4 sites, 10 5 sites, 10 6 sites, 10 7sites, 10 8 sites, 10 9 sites, 10 10 sites, 10 11 sites, 10 12 sites, 10 13 sites, 10 14 sites, 10 15 In some embodiments, the nucleic acid template molecules are immobilized at a plurality of randomly located sites by hybridization with an immobilized surface capture primer. In some embodiments, the nucleic acid template molecules are covalently attached to the surface capture primer. In some embodiments, the nucleic acid template is immobilized at a plurality of randomly located sites, for example, at 10 2 Up to 10 15 sites or more (e.g., 10 2 sites, 10 3 sites, 10 4 sites, 10 5 sites, 10 6 sites, 10 7 sites, 10 8 sites, 10 9 sites, 10 10 sites, 10 11 sites, 10 12 sites, 10 13 sites, 10 14 sites or 10 15 In some embodiments, the fixed nucleic acid template is cloned and amplified to produce fixed nucleic acid clusters at multiple randomly positioned sites. In some embodiments, each fixed nucleic acid cluster includes a linear cluster. In some embodiments, each fixed nucleic acid cluster includes a single-stranded or double-stranded concatemer.

[0104] In some embodiments, a plurality of fixed surface capture primers on a support (e.g., located at predetermined or random positions on the support) are fluidically connected to each other to allow a solution of a reagent (e.g., a nucleic acid template molecule, a soluble primer, an enzyme, a nucleotide, a divalent cation, a buffer, etc.) to flow onto the support so that the plurality of fixed surface capture primers on the support can react with the reagent in a massively parallel manner substantially simultaneously. In some embodiments, the fluidic connection of the plurality of fixed surface capture primers can be used to perform a nucleic acid amplification reaction (e.g., RCA, MDA, PCR, and / or bridge amplification) substantially simultaneously on the plurality of fixed surface capture primers.

[0105] In some embodiments, multiple fixed nucleic acid clusters on the support are fluidically connected to each other to allow a solution of a reagent (e.g., an enzyme, a nucleotide, a divalent cation, etc.) to flow onto the support so that multiple fixed nucleic acid clusters on the support can react with the reagent in a large-scale parallel manner substantially at the same time. In some embodiments, the fluidic connection of multiple fixed nucleic acid clusters can be used to perform nucleotide binding assays and / or nucleotide polymerization reactions (e.g., primer extension or sequencing) on ​​multiple fixed nucleic acid clusters substantially at the same time, and optionally perform detection and imaging of large-scale parallel sequencing.

[0106] In certain embodiments, the term "fixed" and related terms refer to nucleic acid molecules attached to a support or a coating on a support or embedded in a matrix formed by a coating on a support by covalent bonds or non-covalent interactions, wherein the nucleic acid molecules include surface capture primers, nucleic acid template molecules and extension products of capture primers. The extension products of capture primers include but are not limited to nucleic acid concatemers (e.g., nucleic acid clusters). Nucleic acid molecules can be fixed at predetermined or random positions on a support. Nucleic acid molecules can be fixed at predetermined or random positions on or within a coating passivated on a support.

[0107] In some embodiments, the term "immobilized" and related terms refer to an enzyme (e.g., a polymerase) that is attached to a support, or to a coating on a support, or embedded in a substrate formed by a coating on a support, by covalent bonds or non-covalent interactions. The enzyme can be immobilized at a predetermined or random position on the support. The enzyme can be immobilized at a predetermined or random position on or within a passivated coating on a support.

[0108] In some embodiments, one or more nucleic acid template molecules are fixed on a support, for example, fixed at a site on a support. In some embodiments, one or more nucleic acid template molecules are cloned and amplified. In some embodiments, one or more nucleic acid template molecules are cloned and amplified on a support (for example, in a solution). In some embodiments, after cloned amplification, one or more nucleic acid template molecules are deposited on a support and fixed on a support. In some embodiments, the cloned amplification reaction of one or more nucleic acid template molecules is carried out on a support, resulting in fixation on a support. In some embodiments, one or more nucleic acid template molecules are cloned and amplified using nucleic acid amplification reaction (for example, in a solution or on a support). In some embodiments, the nucleic acid amplification reaction includes any one or any combination of the following: polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification (RCA), loop to loop amplification, helicase-dependent amplification, recombinase-dependent amplification and / or single-stranded binding (SSB) protein-dependent amplification. Other suitable nucleic acid amplification methods are known in the art.

[0109] The term "surface primer" and related terms refer to a single-stranded oligonucleotide that is fixed to a support and comprises a sequence that can hybridize with at least a portion of a nucleic acid template molecule. Surface capture primers can be used to fix template molecules to a support via hybridization. Surface capture primers can be fixed to a support in a manner that resists primer removal during flow, washing, suction, and changes in temperature, pH, salt, chemicals, and / or enzyme conditions. Typically, but not necessarily, the 5' end of the surface capture primer can be fixed to a support or a coating on a support (or embedded in a coating on a support). Alternatively, the interior or 3' end of the surface capture primer can be fixed to a support.

[0110] The sequence of the surface capture primer can be fully or partially complementary to at least a portion of the nucleic acid template molecule along its length. In certain embodiments, the support may include a plurality of fixed surface capture primers with the same sequence. In certain embodiments, the support may include a plurality of fixed surface capture primers with two or more different sequences. The surface capture primer can be any length, for example 4 to 50 nucleotides, 50 to 100 nucleotides, 100 to 150 nucleotides or longer length. The technician will understand that suitable surface capture primer length depends on the properties of, for example, template molecules, surface capture primers, etc.

[0111] The surface capture primer can have a terminal 3' nucleotide having a sugar 3' OH portion that can be extended for nucleotide polymerization (e.g., polymerase-catalyzed polymerization). The surface capture primer can have a terminal 3' nucleotide having a 3' sugar position connected to a chain termination portion that inhibits nucleotide polymerization. The 3' chain termination portion can be removed (e.g., deblocked) using a deblocking agent to convert the 3' end into an extendable 3' OH end. The example of the chain termination portion includes, but is not limited to, an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group. The azide type chain termination portion includes, for example, but is not limited to, azide, azido and azidomethyl groups. Examples of deblocking agents include, but are not limited to, phosphine compounds such as tris(2-carboxyethyl)phosphine (TCEP) and bissulfotriphenylphosphine (BS-TPP) for azide, azido and azidomethyl group chain terminating groups. Examples of deblocking agents include, but are not limited to, tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) with piperidine, or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) for alkyl, alkenyl, alkynyl and allyl chain terminating groups. Examples of deblocking agents include, but are not limited to, Pd / C for chain terminating groups aryl and benzyl. Examples of deblocking agents include, but are not limited to, phosphines, β-mercaptoethanol or dithiothreitol (DTT) for chain terminating groups amine, amide, ketone, isocyanate, phosphate, thio and disulfide. Examples of deblocking agents include, but are not limited to, potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine and Zn in acetic acid (AcOH) for carbonate chain terminating groups. Examples of deblocking agents include, but are not limited to, tetrabutylammonium fluoride, pyridine-HF, ammonium fluoride and triethylamine trihydrofluoride for chain terminating groups urea and silyl.

[0112] The term "sequencing" and related terms refer to methods for obtaining nucleotide sequence information from nucleic acid molecules, typically by determining the identity of at least some nucleotides (including their nucleobase components) within the nucleic acid molecule. In some embodiments, the sequence information of a given region of a nucleic acid molecule includes identifying each nucleotide in the region being sequenced. In some embodiments, the sequencing information only determines some nucleotides within the region, while the identities of some nucleotides remain unknown, such as undetermined or incorrectly determined. Any suitable method for sequencing known in the art can be used. In an exemplary embodiment, sequencing may include a label-free method. In another embodiment, sequencing may include an ion-based sequencing method. In some embodiments, sequencing may include labeled, such as dye-containing nucleotides or fluorescence-based nucleotide sequencing methods. In some embodiments, sequencing may include sequencing or bridge sequencing methods based on polymerase cloning. In some embodiments, sequencing uses a polymerase and a multivalent molecule to generate at least one affinity complex, wherein each multivalent molecule contains a plurality of nucleotide units tethered to a core. In some embodiments, sequencing uses a polymerase and free nucleotides to perform sequencing while synthesis. In some embodiments, sequencing uses a ligase and a plurality of sequence-specific oligonucleotides to perform sequencing while ligating.

[0113] In some embodiments, the accuracy and quality of base calls from sequencing data can be evaluated. The Q score is a measure of data quality. In some embodiments, the Q score can be defined as a Phred quality score. In some embodiments, the Q score is based on a logarithmic scale. In certain embodiments, it is defined as Q=-10log(P), where P is the probability of error. For example, Q10 represents an error of 10%, Q20 represents an error of 1%, Q30 represents an error of 0.1%, and Q40 represents an error of 0.01%. In another example, Q10 is an error of 1 in 10, Q20 is an error of 1 in 100, Q30 is an error of 1 in 1,000, Q40 is an error of 1 in 10,000, and Q50 is an error of 1 in 100,000.

[0114] Introduction

[0115] In paired sequencing workflows, low-quality base calls for T bases when sequencing the first strand (e.g., R1 reads) and low-quality base calls for A bases when sequencing the corresponding positions on the complementary second strand (e.g., R2 reads) have been observed. Many low-quality T base calls on the first strand sequence align with C bases in the known reference sequence. Without wishing to be bound by theory, it is hypothesized that some bases in the library molecules are deaminated, which results in base substitutions, including C:G to T:A conversions.

[0116] Deamination is generally the removal of an amino group from a molecule. With respect to nucleotide bases, cytosine (C) can be deaminated to produce uracil (U), which can base pair with adenine (A), guanine (G) can be deaminated to produce xanthine, which can base pair with cytosine (C), and adenine (A) can be deaminated to produce hypoxanthine, which can base pair with cytosine (C).

[0117] The workflow for preparing nucleic acid library molecules involves many steps, including conditions that can cause nucleotide base deamination. For example, deamination may be caused by the presence of a deaminase at any stage in the library preparation workflow. As another example, any library preparation buffer with a low pH value may cause base deamination. In another example, the high temperature used by PCR can cause base deamination. In another example, the mechanical shear force fragmentation used to make the input nucleic acid can produce destructive free radicals that cause deamination. Exemplary mechanical forces include, but are not limited to, ultrasonic processing forces, acoustic forces, atomization forces, shear forces, and cavitation forces. In another example, certain chemicals (such as bisulfite) can cause deamination. The technician will recognize that nucleotide base deamination can be produced by many other conditions.

[0118] The present disclosure provides compositions and methods for removing deaminated bases in nucleic acid library molecules.The compositions and methods described herein can be applied to any type of nucleic acid library molecules, including, for example, linear or circular library molecules, and library molecules for sequencing in a massively parallel manner.

[0119] Preparation of linear library molecules with reduced deaminated nucleotide bases

[0120] In one aspect, the present disclosure provides methods for preparing nucleic acid library molecules with reduced deaminated nucleotide bases. In some embodiments, linear and / or circular nucleic acid libraries can be prepared, and the library molecules can be treated with reagents that remove deaminated bases.

[0121] In some embodiments, the method for preparing a nucleic acid library molecule with reduced deaminated nucleotide bases generally comprises the following steps: preparing a plurality of linear nucleic acid library molecules, wherein at least one of the linear library molecules comprises at least one deaminated base; contacting the plurality of linear library molecules with a reagent for removing deaminated bases, thereby producing at least one linear library molecule with a base-free site. In some embodiments, the method further comprises circularizing each linear library molecule (including at least one linear library molecule carrying a base-free site) to produce a plurality of circularized nucleic acid library molecules. In some embodiments, a plurality of circularized nucleic acid library molecules may include circularized molecules carrying at least one base-free site. In some embodiments, a plurality of circularized nucleic acid library molecules may not include circularized molecules carrying at least one base-free site. In some embodiments, the method further comprises contacting a plurality of circularized library molecules with a reagent for removing deaminated bases to produce at least one circularized library molecule carrying at least one base-free site.

[0122] In some embodiments, a nucleic acid library can be prepared by fragmenting the input nucleic acid. In some embodiments, the input nucleic acid includes DNA, RNA or cDNA. In some embodiments, the input nucleic acid includes nucleic acids with the same sequence or different sequences. In some embodiments, the input nucleic acid includes single-stranded or double-stranded nucleic acids. In some embodiments, mechanical force, enzymatic (e.g., restriction endonuclease) or chemical fragmentation methods can be used to fragment the input nucleic acid. In some embodiments, the mechanical force includes ultrasonic treatment force, acoustic force, atomization force, shear force or cavitation force. In some embodiments, mechanical force can produce free radicals, which can deaminize nucleotide bases. In some embodiments, reverse transcriptase can be used to produce nucleic acid fragments from RNA to produce RNA hybridized with cDNA. In some embodiments, double-stranded DNA can be prepared by reacting DNA polymerase with RNA hybridized with cDNA. In some embodiments, DNA fragments can be produced by PCR using a template polynucleotide and a pair of PCR primers. In some embodiments, an enzyme that produces a single-stranded gap and another enzyme that catalyzes double-stranded cutting can be used to fragment the input nucleic acid. Exemplary enzyme mixtures include FRAGMENTASE TM (e.g., from New England Biolabs TM). In yet another embodiment, the nucleic acid fragments include circulating cell free DNA (e.g., double-stranded cfDNA) that has not yet undergone a fragmentation procedure. The length of the cell free DNA may be 50-200bp, such as about 50bp, 60bp, 70bp, 80bp, 90bp, 100bp, 110bp, 120bp, 130bp, 140bp, 150bp, 160bp, 170bp, 180bp, 190bp, or 200bp. In some embodiments, the size of the nucleic acid fragments may be selected. In some embodiments, the nucleic acid fragments lack size selection. The technician will recognize that any of these methods may be used to produce nucleic acid fragments. In some embodiments, the length of the fragment may be 50-1000bp or greater than 1000bp, such as about 50bp, 75bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp or more than 1000bp. The nucleic acid fragments may include a heterogeneous mixture of fragments having 5' overhangs, 3' overhangs and / or blunt ends.

[0123] In some embodiments, nucleic acid libraries can be prepared by modifying (e.g., end repair) the 5' and / or 3' ends of the fragmented nucleic acids to convert the overhanging ends into blunt ends and / or to produce desired overhanging ends. For example, nucleic acid fragments can be treated with at least one enzyme to remove 3' overhanging ends. Suitable enzymes for use include, for example, but not limited to, DNA polymerase I, large (Klenow) fragments, T4 DNA polymerase and / or mung bean nuclease. In some embodiments, nucleic acid fragments can be treated with at least one enzyme to fill 5' overhanging ends. Suitable enzymes for use include, for example, but not limited to, T4 DNA polymerase, Tfi DNA polymerase, TliDNA polymerase, Taq DNA polymerase, large (Klenow) fragments, phi29 DNA polymerase and / or Mako DNA polymerase. Any of these polymerases can be a thermostable enzyme or a thermolabile enzyme. In some embodiments, nucleic acid fragments can be treated with at least one enzyme to remove 5' overhanging ends, for example, using S1 nuclease. In some embodiments, nucleic acid fragments can be treated with at least one enzyme to remove 5' or 3' overhanging ends, for example, using mung bean nuclease.

[0124] In some embodiments, nucleic acid libraries can be prepared by phosphorylating the 5' end of fragmented nucleic acids or removing the 5' or 3' phosphate. For example, nucleic acid fragments can be treated with T4 polynucleotide kinase to phosphorylate the 5' end of at least one strand of double-stranded DNA. In some embodiments, nucleic acid fragments can be treated with a phosphatase to remove the 5' or 3' phosphate, using, for example, but not limited to, shrimp alkaline phosphatase, calf intestinal alkaline phosphatase, bacterial alkaline phosphatase, thermosensitive phosphatase, and / or placental alkaline phosphatase.

[0125] In some embodiments, a nucleic acid library can be prepared by adding a non-template tail. In some embodiments, a DNA polymerase such as, but not limited to, Taq DNA polymerase (or a derivative thereof), Tfi (exo-minus) DNA polymerase, large fragment Klenow (e.g., 3' to 5' exo-minus) or T4 DNA polymerase can be used to append an A tail (e.g., a poly-A tail) comprising one or more non-template adenosine nucleotides to the end of a linear library molecule.

[0126] In some embodiments, a single non-template A tail (eg, a poly-A tail) can be appended to the 3' end of a linear library molecule using a proofreading DNA polymerase, Tfi (exo-) DNA polymerase, or Pfu DNA polymerase in the presence of dATP.

[0127] In some embodiments, a nucleic acid library can be prepared by attaching at least one adapter to one end of a nucleic acid fragment. In some embodiments, an adapter comprises an oligonucleotide that can be operably linked (appended) to a nucleic acid fragment, wherein the adapter is functionalized to a co-connected adapter-fragment molecule. The adapter comprises DNA, RNA, chimeric DNA / RNA or their analogs. The adapter may comprise at least one ribonucleoside residue. The adapter may be single-stranded, double-stranded or have a single-stranded and / or double-stranded portion. The adapter may be configured as a linear, stem-loop, hairpin or Y-shaped form. The adapter may be any length, including 4 to 100 nucleotides or longer, such as about 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleotides. The adapter may have a blunt end, an overhang end or a combination of the two. The overhang end comprises a 5' overhang end and a 3' overhang end. In some embodiments, the 5' end of a single-stranded adapter or one of the chains of a double-stranded adapter may have a 5' phosphate group or lack a 5' phosphate group. In some embodiments, the adapter may include a 5' tail that is not hybridized with a nucleic acid fragment (e.g., a tailed adapter), or the adapter may be tailless. At least a portion of the adapter includes a known and predetermined sequence. The adapter may include, for example, a sequence complementary to at least a portion of a primer such as an amplification primer, a sequencing primer, or a capture primer (e.g., a soluble or fixed capture primer). The adapter may include, for example, a random sequence or a degenerate sequence. In some embodiments, the adapter may include at least one inosine residue. In some embodiments, the adapter may include at least one phosphorothioate, a thiol phosphorothiate, and / or a phosphoramide bond. In some embodiments, the adapter may include at least one barcode / index sequence that can be used to distinguish polynucleotides (e.g., inserted sequences) from different sample sources in multiple determinations. In some embodiments, the adapter may include at least one unique identification sequence (e.g., a molecular identifier) ​​that can be used to uniquely identify the nucleic acid molecule to which the adapter is attached. In some embodiments, the unique recognition sequence comprises 2 to 12 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12) or more nucleotides with known sequences. For example, the unique recognition sequence comprises a known random sequence, wherein the nucleotides at each position are randomly selected from nucleotides with bases A, G, C, T or U. The adapter may comprise, for example, at least one restriction enzyme recognition sequence. In some embodiments, the adapter may comprise any combination of any one or two or more restriction enzyme recognition sequences. In some embodiments, the restriction enzyme recognition sequence is selected from the group consisting of: type I, type II, type III, type IV, type Hs or type IIB.

[0128] In some embodiments, adapters can be universal, for example, having universal sequences. In some embodiments, universal sequences and related terms refer to sequences common to two or more polynucleotide molecules in a nucleic acid molecule (e.g., adapter). For example, an adapter with a universal sequence can be operably joined to a plurality of polynucleotides so that a co-joined molecular population carries the same universal adapter sequence. Examples of universal adapter sequences include, but are not limited to, amplification primer sequences, sequencing primer sequences, or capture primer sequences (e.g., soluble or fixed capture primers).

[0129] In some embodiments, the adapter comprises a double-stranded nucleic acid Y-shaped adapter. In certain embodiments, each double-stranded adapter comprises a first oligonucleotide chain and a second oligonucleotide chain hybridized together, wherein the first oligonucleotide chain and the second oligonucleotide chain both comprise a complementary region and a mismatch region, thereby forming a Y-shaped adapter having a double-stranded annealing portion and a mismatch portion having two single strands.

[0130] In some embodiments, the 5' end of the first oligonucleotide and / or the second oligonucleotide chain forming the Y-shaped adapter can be phosphorylated. In some embodiments, the first oligonucleotide chain comprises a first universal adapter sequence, which comprises a binding sequence for a first sequencing primer or its complementary sequence. In some embodiments, the second oligonucleotide chain comprises a second universal adapter sequence, which comprises a binding sequence for a second sequencing primer or its complementary sequence. In some embodiments, in a population of Y-shaped adapters, each of the first oligonucleotide chains forming the Y-shaped adapter has the same sequence. In some embodiments, in a population of Y-shaped adapters, each of the second oligonucleotide chains forming the Y-shaped adapter has the same sequence. In some embodiments, the double-stranded annealing region of the Y-shaped adapter includes at least 4 consecutive base-paired nucleotides. In some embodiments, the double-stranded annealing region includes an end that can be joined to a nucleic acid fragment having a target sequence via an enzymatic ligation reaction. In some embodiments, the double-stranded annealing region includes a blunt end, or the end may have a 5' or 3' overhanging region. In some embodiments, the first oligonucleotide chain and the second oligonucleotide chain of the mismatched portion may be the same length or different lengths. In some embodiments, the first oligonucleotide strand and the second oligonucleotide strand of the mismatch portion can have different lengths.

[0131] In some embodiments, the first strand of the double-stranded annealing region of the Y-shaped adaptor comprises at least a portion of a binding sequence for a first sequencing primer (e.g., a reverse sequencing primer or a forward sequencing primer) or its complement. In some embodiments, the second strand of the double-stranded annealing region of the Y-shaped adaptor comprises at least a portion of a binding sequence for a second sequencing primer (e.g., a forward sequencing primer or a reverse sequencing primer) or its complement.

[0132] In some embodiments, the first strand of the mismatch region includes at least a portion of a binding sequence for a first sequencing primer (e.g., a reverse sequencing primer or a forward sequencing primer) or its complementary sequence. In some embodiments, the first strand of the mismatch region further includes at least a portion of a binding sequence for a first surface primer or its complementary sequence. In some embodiments, the first strand of the mismatch region includes a universal adapter sequence that includes a first sample index sequence.

[0133] In some embodiments, the second strand of the mismatch region includes at least a portion of a binding sequence for a second sequencing primer (e.g., a forward sequencing primer or a reverse sequencing primer) or its complementary sequence. In some embodiments, the second strand of the mismatch region also includes at least a portion of a binding sequence for a second surface primer or its complementary sequence. In some embodiments, the second strand of the mismatch region further includes a universal adapter sequence that includes a second sample index sequence.

[0134] In some embodiments, only the first strand of the mismatch region comprises a universal adapter, e.g., it comprises a first sample index sequence. In some embodiments, only the second strand of the mismatch region comprises a universal adapter, e.g., it comprises a second sample index sequence. In some embodiments, the first strand of the mismatch region comprises a first sample index sequence, and the second strand of the mismatch region comprises a second sample index sequence.

[0135] In some embodiments, double-stranded nucleic acid fragments with blunt ends or 5' overhangs or 3' overhangs can use ligation to add at least one adapter at one or both ends. The adapter ligation reaction can include linear double-stranded adapters and / or double-stranded Y-shaped adapters. In some embodiments, T4 DNA ligase, T3 DNA ligase, or T7 DNA ligase can be used to carry out ligation.

[0136] In some embodiments, a single-stranded tailed primer can be used to append an adapter sequence to one or both ends of a nucleic acid fragment. In some embodiments, at least one primer extension reaction is used to append an adapter sequence. In some embodiments, PCR is used to append an adapter sequence. In some embodiments, the 5' end of the tailed primer comprises an adapter sequence to be appended to the nucleic acid fragment. In some embodiments, the 5' end of the tailed primer does not hybridize with the nucleic acid fragment. In some embodiments, the 3' end of the tailed primer comprises a sequence that can hybridize with at least a portion of the nucleic acid fragment. In some embodiments, the adapter sequence can be appended to the nucleic acid fragment by performing at least one primer extension reaction using a single-stranded tailed primer, a polymerase, and a plurality of nucleotides. In some embodiments, a primer extension reaction can use one type of tailed primer to append an adapter sequence to, for example, one end of a nucleic acid fragment. In some embodiments, a primer extension reaction can use two types of tailed primers, for example, to append an adapter sequence to both ends of a nucleic acid fragment. In some embodiments, PCR can be used to adopt a multi-primer extension reaction. In certain embodiments, the heat from the PCR reaction can produce a nucleic acid library molecule comprising at least one deaminated nucleotide base.

[0137] In some embodiments, any of the above methods can be used to generate nucleic acid linear library molecules. In some embodiments, a single library molecule comprises a target sequence operably connected on both sides by at least one nucleic acid adapter sequence. In some embodiments, at least one library molecule carries at least one deaminated nucleotide base. In some embodiments, the library molecule can be treated with a reagent for removing deaminated bases. In some embodiments, the reagent for removing deaminated bases includes a compound that produces a baseless site at a uracil base in a nucleic acid molecule. For example, but not limited to, DNA glycosylase (UDG) can produce a baseless site at a uracil base. In some embodiments, the reagent for removing deaminated bases includes a compound that produces a gap at a baseless site in a nucleic acid chain. For example, but not limited to, an enzyme or a mixture of enzymes having, for example, a lyase activity that breaks a phosphodiester backbone at the 5' and 3' sides of the baseless site can be used to release abasic deoxyribose and generate a gap. In certain embodiments, AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase, Endo VIII glycosylase / AP lyase can be used to remove a baseless site, or any combination thereof. In some embodiments, a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII can be used to achieve the creation of abasic sites and the removal of abasic sites to create gaps. For example, but not limited to, a suitable DNA glycosylase-lyase endonuclease VIII can be USER TM (From New England Biolabs TMUracil-specific excision reagent enzyme) or thermolabile USER TM (Also from New England Biolabs TM ).

[0138] Preparation of circular library molecules with reduced deaminated nucleotide bases

[0139] On the other hand, the present disclosure provides methods for preparing nucleic acid library molecules with reduced deamination nucleotide bases. In some embodiments, linear library molecules can be circularized to produce circularized nucleic acid libraries. In some embodiments, circularized library molecules can be treated with reagents that remove deamination bases.

[0140] In some embodiments, any adapter and any adapter appending method described herein can be used to generate linear library molecules. In some embodiments, intramolecular ligation methods, padlock probes, or telomerase can be used to circularize linear library molecules. Other suitable methods for circularizing linear molecules are known in the art.

[0141] In some embodiments, the ends of single-stranded library molecules can be ligated using a single-stranded ligase (e.g., from Epicentre TM or Lucigen TM The CircLigase of the invention is used for intramolecular ligation to generate covalently closed circular library molecules. The covalently closed circular library molecules can be subjected to rolling circle amplification reaction.

[0142] In certain embodiments, padlock probes can be used to make single-stranded library molecules circular.In certain embodiments, the padlock probe generally includes a single-stranded oligonucleotide with a 5' portion, an internal joint portion, and a 3' portion.In the padlock probe, the 5' portion and the 3' portion are complementary to the target sequence in the linear library molecule, respectively, and the joint portion is designed to have little complementarity or no complementarity with the target sequence.The 5' portion and the 3' portion hybridize with the target sequence, causing the padlock probe to form a circular molecule.When the padlock probe hybridizes with the target sequence, it connects to form a covalently closed single-stranded circular nucleic acid molecule.In certain embodiments, the internal joint portion can be engineered to include one or more universal adapter sequences, barcode adapters, or unique identifier adapters.In certain embodiments, the covalently closed circular library molecule can carry out a rolling circle amplification reaction.

[0143] In some embodiments, circular DNA molecules can be produced without nucleic acid ligase. For example, but not limited to, the front-end mitogen-activated protein molecule recognizes the target enzyme recognition sequence in the nucleic acid molecule (for example, a linear library molecule), the enzyme recognition sequence is cleaved to produce an end with 5' and 3' exposed cleavage ends, and the 5' and 3' cleavage ends of the single exposed end are reconnected at the target site to form a single linear molecule from the cleaved 5' and 3' ends. When the reaction is performed at both ends of the double-stranded nucleic acid molecule (for example, a double-stranded library molecule) with a target enzyme recognition sequence at each end, the result is a ringed nucleic acid molecule. In some embodiments, the adapter carrying the enzyme recognition sequence can be appended to the double-stranded library molecule via connection or PCR using a tailed PCR primer. Many enzymes or enzyme combinations are compatible with the reaction, including, for example, but not limited to, front-end mitogen-activated protein molecule. A suitable type of front-end mitogen-activated protein molecule is a TelN front-end mitogen-activated protein molecule, such as a front-end mitogen-activated protein molecule from Escherichia coli phage N1. In some embodiments, covalently closed circular library molecules can undergo rolling circle amplification reactions.

[0144] In some embodiments, any adapter and any adapter appending method described herein can be used to generate linear library molecules. In some embodiments, single-stranded splint chains or double-stranded splint adapters can be used to make linear library molecules into rings. For example, linear library molecules can be hybridized with single-stranded splints, which can juxtapose the ends of linear molecules to each other for connection. In another example, linear library molecules can be hybridized with double-stranded splint adapters each having a short splint chain and a long splint chain. The long splint chain holds the linear library molecule in a ring form, and the ends of the short splint chains are juxtaposed with the ends of the linear library molecules for connection.

[0145] For example, Figure 1A schematic diagram of a linear single-stranded library molecule (100) hybridizing with a double-stranded (ds) splint molecule adapter (200) to thereby loop the library molecule to form a library-splint complex (500) with two gaps is shown. The library molecule (100) comprises: a first left universal adapter sequence (120); a first left unique identification sequence (180); a first left index sequence (160); a second left universal adapter sequence (140); a target sequence insert (110); a second right universal adapter sequence (150); a first right index sequence (170); and a first right universal adapter sequence (130). The double-stranded splint molecule comprises a first splint chain (long chain (300)), which is hybridized with a second splint chain (short chain (400)). The first splint chain includes a first region (320) hybridized with a sequence at one end of the linear single-stranded library molecule and a second region (330) hybridized with a sequence at the other end of the linear single-stranded library molecule. The inner region (310) of the first splint chain is hybridized with the second splint chain (400). The second splint chain (400) includes three sub-regions, wherein the first sub-region contains a universal binding sequence for the third surface primer, the second sub-region contains a universal binding sequence for the fourth surface primer, and the third sub-region contains a sample index sequence having 5 to 20 bases and / or a unique identification sequence (e.g., NN) having 2 to 10 or more bases. The inner region (310) of the first splint chain (300) includes three sub-regions, wherein the fourth sub-region is hybridized with the first sub-region of the second splint chain (400), the fifth sub-region is hybridized with the second sub-region of the second splint chain (400), and the sixth sub-region is hybridized with the third sub-region of the second splint chain (400).

[0146] In some embodiments, a linear library molecule can be circularized using a double-stranded splint adaptor (200) comprising a first splint strand (long splint strand (300)) and a second splint strand (short splint strand (400)), wherein the first and second splint strands are hybridized together to form a double-stranded splint adaptor (200) having a double-stranded region flanked by two single-stranded regions (e.g., see Figures 1 to 2). The second splint chain (400) carries a new adapter sequence to be introduced, such as, for example, a new universal binding sequence and / or a new index sequence. The first splint chain comprises a first region (320), an internal region (310) and a second region (330). The internal region of the first splint chain (310) hybridizes with the second splint chain (400). The two flanking single-stranded regions (e.g., (320) and (330)) of the double-stranded splint adapter are designed to hybridize with the universal adapter sequence at the end of a single-stranded linear library molecule (100) having a target sequence (110). For example, the first region (320) of the first splint chain hybridizes with one end of the library molecule, and the second region (330) of the first splint chain hybridizes with the other end of the library molecule, thereby circularizing the library molecule to produce a library-splint complex (500) comprising two gaps (e.g., see Figures 1 to 2 ). The gaps can be enzymatically ligated to produce a covalently closed circular molecule (600) in which the second splint strand (400) is covalently joined to the library molecule at both ends, thereby introducing a new adapter sequence into the library molecule.

[0147] In some embodiments, any of the above methods can be used to produce covalently closed circular library molecules. In some embodiments, each covalently closed circular library molecule is included in a target sequence operably connected to at least one nucleic acid adapter sequence on both sides. In some embodiments, at least one covalently closed circular library molecule carries at least one deaminated nucleotide base. In some embodiments, the covalently closed circular library molecule can be treated with a reagent for removing deaminated bases. In some embodiments, the reagent for removing deaminated bases is included in a compound that produces a baseless site at the uracil base in the nucleic acid molecule. For example, but not limited to, DNA glycosylase (UDG) can produce a baseless site at the uracil base. In some embodiments, the reagent for removing deaminated bases is included in a compound that produces a gap at the baseless site in the nucleic acid chain. For example, but not limited to, an enzyme or a mixture of enzymes with a lyase activity that breaks the phosphodiester backbone at the 5' and 3' sides of the baseless site can be used, for example, to release abasic deoxyribose and generate a gap. The abasic sites can be removed, for example, but not limited to, using AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase, Endo VIII glycosylase / AP lyase, or a combination thereof. In some embodiments, a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII can be used to achieve the creation of abasic sites and the removal of abasic sites to create gaps. For example, but not limited to, a suitable DNA glycosylase-lyase endonuclease VIII can be USER TM (From New England Biolabs TM Uracil-specific excision reagent enzyme) or thermolabile USER TM(Also from New England Biolabs TM ).

[0148] Methods for forming multiple library-splint complexes

[0149] Using double-stranded splint adapters

[0150] In some embodiments, any of the above methods can be used to generate nucleic acid linear library molecules, each of which comprises sequences arranged in 5' to 3' order: (i) a first left universal adapter sequence (120) having a binding sequence for a first surface primer; (ii) a first left index sequence (160); (iii) a second left universal adapter sequence (140) having a binding sequence for a first sequencing primer; (iv) a target sequence (110); (v) a second right universal adapter sequence (150) having a binding sequence for a second sequencing primer; (vi) a first right index sequence (170); and (vii) a first right universal adapter sequence (130) having a binding sequence for a second surface primer (e.g., see Figure 1 ).

[0151] In some embodiments, at least one linear library molecule carries at least one deaminated nucleotide base. In some embodiments, before cyclization, the linear library molecule can be treated with a reagent for removing the deaminated base. In some embodiments, the reagent for removing the deaminated base includes a compound that produces an abasic site at the uracil base in the nucleic acid molecule. For example, DNA glycosylase (UDG) can produce an abasic site at the uracil base. In some embodiments, the reagent for removing the deaminated base includes a compound that produces a gap at the abasic site in the nucleic acid chain. For example, but not limited to, an enzyme or a mixture of enzymes having a lyase activity that breaks the phosphodiester backbone at the 5' and 3' sides of the abasic site can be used to release abasic deoxyribose and generate a gap. For example, but not limited to AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase, Endo VIII glycosylase / AP lyase, or a combination thereof can be used to remove the abasic site. In some embodiments, a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII can be used to achieve the creation of abasic sites and the removal of abasic sites to create gaps. For example, but not limited to, a suitable DNA glycosylase-lyase endonuclease VIII can be USER TM (From New England Biolabs TM Uracil-specific excision reagent enzyme) or thermolabile USER TM (Also from New England Biolabs TM ).

[0152] In some embodiments, the present disclosure provides a method for forming a plurality of library-splint complexes (500), the method comprising: (a) providing a plurality of double-stranded splint adapters (200), wherein each of the plurality of double-stranded splint adapters (200) comprises a first splint strand (300) hybridized to a second splint strand (400), wherein the double-stranded splint adapter comprises a double-stranded region and two flanking single-stranded regions, wherein the first splint strand comprises a first region (320), an internal region (310), and a second region (330), and wherein the internal region (310) of the first splint strand hybridizes to the second splint strand (400). Exemplary double-stranded splint adapters (200) are shown in Figures 1 to 2 middle.

[0153] In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (b): hybridizing a plurality of double-stranded splint adaptors to a plurality of single-stranded nucleic acid library molecules (100), wherein each library molecule comprises a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and on the other side by at least a first right universal adaptor sequence (130) (e.g., Figures 1 to 2 ). The hybridization is performed under conditions suitable for hybridizing the first region (320) of the first splint strand to at least the first left universal adapter sequence (120) of the library molecule. The hybridization conditions are suitable for hybridizing the second region (330) of the first splint strand to at least the first right universal sequence (130) of the library molecule, thereby looping the plurality of library molecules to form a plurality of library-splint complexes (500).

[0154] In some embodiments, in a method for forming multiple library-splint complexes (500), the first region (320) of the first splint chain comprises a first universal adapter sequence that can hybridize with a first universal binding sequence at one end of a linear nucleic acid library molecule. In some embodiments, the first region (320) of the first splint chain comprises a first universal adapter sequence that comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compacted oligonucleotide. In some embodiments, the 5' end of the first splint chain (300) is phosphorylated. In some embodiments, the 5' end of the first splint chain (300) lacks a phosphate group. In some embodiments, the 3' end of the first splint chain (300) comprises a terminal 3' OH group or a terminal 3' blocking group.

[0155] In some embodiments, in a method for forming multiple library-splint complexes (500), the second region (330) of the first splint chain comprises a second universal adapter sequence that can hybridize with a second universal binding sequence at the other end of the linear nucleic acid library molecule. In some embodiments, the second region (330) of the first splint chain includes a second universal adapter sequence that includes a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compacted oligonucleotide. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated. In some embodiments, the 5' end of the second splint chain (400) lacks a phosphate group. In some embodiments, the 3' end of the second splint chain (400) includes a terminal 3'OH group or a terminal 3' blocking group.

[0156] In some embodiments, in a method for forming a plurality of library-splint complexes (500), a first region (320) of a first splint strand hybridizes to at least a first left universal adaptor sequence (120) of a library molecule, and a second region (330) of a first splint strand hybridizes to at least a first right universal sequence (130) of a library molecule, thereby circularizing the library molecule to produce a library-splint complex (500). The library-splint complex (500) comprises a first gap (e.g., Figures 1 to 2 The library-splint complex (500) further comprises a second gap (eg, Figures 1 to 2 ). In some embodiments, the first and second gaps are enzymatically ligatable.

[0157] In some embodiments, in a method for forming a plurality of library-splint complexes (500), a first region (320) of a first splint strand can hybridize with a sense strand or an antisense strand of a double-stranded nucleic acid library molecule. In a library-splint complex (500), a second region (330) of a first splint strand can hybridize with a sense strand or an antisense strand of a double-stranded nucleic acid library molecule. In some embodiments, a double-stranded nucleic acid library molecule can be denatured to produce single-stranded sense and antisense library strands.

[0158] In some embodiments, in a method for forming a plurality of library-splint complexes (500), the second splint strand (400) does not hybridize to the sequence of interest (110), and the internal region (310) of the first splint strand does not hybridize to the sequence of interest (110).

[0159] In some embodiments, in a method for forming a plurality of library-splint complexes (500), a first region (320) of a first splint strand does not hybridize to a sequence of interest (110), and a second region (330) of a first splint strand does not hybridize to a sequence of interest (110).

[0160] In some embodiments, in the method for forming a plurality of library-splint complexes (500), the 5' end of the single-stranded library molecule (100) is phosphorylated or lacks a phosphate group. In some embodiments, the 3' end of the single-stranded library molecule includes a terminal 3' OH group or a terminal 3' blocking group.

[0161] In some embodiments, in the method of forming a plurality of library-splint complexes (500), the nucleic acid library molecule (100) further comprises a second left universal adapter sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises a second right universal adapter sequence (150). In some embodiments, the nucleic acid library molecule (100) may further comprise additional left universal adapter sequences and / or right universal adapter sequences.

[0162] In some embodiments, in a method for forming a plurality of library-splint complexes (500), the nucleic acid library molecule (100) further comprises a first left index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises a first right index sequence (170). In some embodiments, the first left index sequence (160) comprises a sample index sequence. In some embodiments, the first right index sequence (170) comprises another sample index sequence. The sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiple assays. A list of exemplary first left index sequences (160) and first right index sequences (170) is provided in Tables 1 to 2 of FIG. 7. In some embodiments, the first left index sequence (160) may include a random sequence (e.g., NNN) or lack a random sequence. In some embodiments, the first right index sequence (170) may include a random sequence (e.g., NNN). Alternatively, in some embodiments, the first right index sequence (170) lacks a random sequence.

[0163] In some aspects, a multiplex workflow is initiated by preparing a library with a sample index using one or two index sequences (e.g., a left index sequence and / or a right index sequence). In some embodiments, a first left index sequence (160) and / or a first right index sequence (170) can be used to prepare a separate library with a sample index using input nucleic acids isolated from different sources. In some embodiments, libraries with sample indexes can be pooled together to produce a multiple library mixture, and the pooled libraries can be amplified and / or sequenced. In some embodiments, the sequence of the insertion region together with the first left index sequence (160) and / or the first right index sequence (170) can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample index libraries can be pooled together, for example, 2 to 10, 10 to 50, 50 to 100, 100 to 200, or more than 200 (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or more than 200) sample index libraries can be pooled together. Exemplary nucleic acid sources include, for example, but are not limited to, naturally occurring, recombinant, or chemically synthesized sources. Exemplary nucleic acid sources include, for example, but are not limited to, single cells, multiple cells, tissues, biological fluids, environmental samples, or whole organisms. Exemplary nucleic acid sources include, for example, but not limited to, fresh, frozen, fresh frozen, or archived sources (e.g., formalin fixed paraffin embedded (FFPE)). The skilled artisan will recognize that nucleic acids can be isolated from many other sources. In some embodiments, nucleic acid library molecules can be prepared in single-stranded or double-stranded form.

[0164] In some embodiments, in the method for forming a plurality of library-splint complexes (500), the nucleic acid library molecule (100) further comprises a first left unique identification sequence (180). In some embodiments, the nucleic acid library molecule (100) further comprises a first right unique identification sequence (190). In some embodiments, the first left unique identification sequence (180) and the first right unique identification sequence (190) each comprise a sequence that is used to uniquely identify each target sequence (e.g., insertion sequence) to which a unique adapter is attached in a population of other target molecule sequences. In some embodiments, the first left unique identification sequence (180) and / or the first right unique identification sequence (190) can be used for molecular labeling.

[0165] In some embodiments, in a method for forming multiple library-splint complexes (500), the nucleic acid library molecule (100) comprises any of the following: a first left universal adapter sequence (120); a second left universal adapter sequence (140); a first left index sequence (160); a first left unique identification sequence (180); a first right universal adapter sequence (130); a second right universal adapter sequence (150); a first right index sequence (170); and / or a first right unique identification sequence (190). In some embodiments, in a method for forming multiple library-splint complexes (500), the nucleic acid library molecule (100) comprises any combination of two or more: a first left universal adapter sequence (120); a second left universal adapter sequence (140); a first left index sequence (160); a first left unique identification sequence (180); a first right universal adapter sequence (130); a second right universal adapter sequence (150); a first right index sequence (170); and / or a first right unique identification sequence (190).

[0166] In some embodiments, in a method for forming a plurality of library-splint complexes (500), the first left universal adapter sequence (120) and / or the second left universal adapter sequence (140) include: a universal binding sequence for a forward sequencing primer or a reverse sequencing primer; a universal binding sequence for a first surface primer or a second surface primer; a universal binding sequence for a forward amplification primer or a reverse amplification primer; and / or a universal binding sequence for a compaction oligonucleotide. In some embodiments, the nucleic acid library molecule (100) may further include additional left universal adapter sequences.

[0167] In some embodiments, in a method for forming a plurality of library-splint complexes (500), the first right universal adapter sequence (130) and / or the second right universal adapter sequence (150) include: a universal binding sequence for a forward sequencing primer or a reverse sequencing primer; a universal binding sequence for a first surface primer or a second surface primer; a universal binding sequence for a forward amplification primer or a reverse amplification primer; or a universal binding sequence for a compacted oligonucleotide. In some embodiments, in a method for forming a plurality of library-splint complexes (500), the first right universal adapter sequence (130) and / or the second right universal adapter sequence (150) include any combination of two or more of the following: a universal binding sequence for a forward sequencing primer or a reverse sequencing primer; a universal binding sequence for a first surface primer or a second surface primer; a universal binding sequence for a forward amplification primer or a reverse amplification primer; or a universal binding sequence for a compacted oligonucleotide. In some embodiments, the nucleic acid library molecule (100) may further include additional right universal adapter sequences.

[0168] In some embodiments, in the method for forming a plurality of library-splint complexes (500), the second splint strand (400) comprises at least two sub-regions, including a first sub-region and a second sub-region (e.g., Figure 1 ). In some embodiments, the first subregion comprises a universal binding sequence for a third surface primer, and the second subregion comprises a universal binding sequence for a fourth surface primer. In certain embodiments, the first subregion and the second subregion do not hybridize with the first surface primer and the second surface primer (e.g., exhibit very little hybridization or no hybridization). In some embodiments, the second splint chain (400) further comprises an optional third subregion comprising a unique recognition sequence (e.g., NN) having 5 to 20 bases (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 bases) and / or having 2 to 10 or more (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10) bases. Figure 1). In some embodiments, the second splint chain (400) includes only one subregion and lacks a second subregion and a third subregion. In certain embodiments, the first subregion comprises a sample index sequence having 5 to 20 bases (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 bases). In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiple assays. In some embodiments, the unique identification sequence comprises a random sequence. In some embodiments, the unique identification sequence can be designed to exhibit reduced or no hybridization with the first, second, third and fourth surface primers. Non-limiting exemplary arrangements of subregions in the second splint chain (400) in the 5' to 3' direction include: 5'-[second subregion]–[first subregion]–3'. Another non-limiting exemplary arrangement of subregions in the second splint chain (400) in the 5' to 3' direction includes: 5'-[third subregion]-[second subregion]-[first subregion]-3'. In some embodiments, the length of the second splint chain (400) may be 20 to 100 (e.g., about 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100) nucleotides. In some embodiments, the length of the second splint chain (400) may be 30 to 80 (e.g., about 30, 35, 40, 45, 50, 60, 70 or 80) nucleotides. In some embodiments, the length of the second splint chain (400) may be 40 to 60 (e.g., about 40, 45, 50 or 60) nucleotides. In some embodiments, the second splint chain (400) includes one or more thiophosphate bonds at the 5' and / or 3' ends to confer resistance to nuclease exonucleases. In some embodiments, the second splint chain (400) includes one or more thiophosphate bonds at an internal position to confer resistance to nuclease endonucleases. In some embodiments, the second splint chain (400) includes one or more 2'-O-methylcytosine bases at the 5' and / or 3' ends or at an internal position. In some embodiments, the 5' end of the second splint chain (400) is phosphorylated. In some embodiments, the 5' end of the second splint chain (400) is non-phosphorylated. In some embodiments, the 3' end of the second splint chain (400) includes a terminal 3'OH group or a terminal 3' blocking group.

[0169] In some embodiments, in a method for forming a plurality of library-splint complexes (500), a first splint strand (300) includes an inner region (310) comprising at least two subregions, including a fourth subregion and a fifth subregion (e.g., Figure 1). In some embodiments, the fourth subregion hybridizes with the first subregion of the second splint strand (400). In some embodiments, the fifth subregion hybridizes with the second subregion of the second splint strand (400). In some embodiments, the fourth subregion and the fifth subregion do not hybridize with the first surface primer and the second surface primer (e.g., exhibit very little hybridization or no hybridization). In some embodiments, the interior region (310) of the first splint strand further comprises an optional sixth subregion that hybridizes with the third subregion of the second splint strand (400) (e.g., Figure 1 ). A non-limiting exemplary arrangement of the subregions of the first splint chain (300) in the 3' to 5' direction includes: 3'-[fourth subregion]-[fifth subregion]-5'. Another non-limiting exemplary arrangement of the subregions of the first splint chain (300) in the 3' to 5' direction includes: 3'-[fourth subregion]-[fifth subregion]-[sixth subregion]-5'. In some embodiments, the length of the first splint chain (300) may be 50 to 150 (e.g., about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150) nucleotides. In some embodiments, the length of the first splint chain (300) may be 60 to 100 (e.g., about 60, 70, 80, 90, or 100) nucleotides. In some embodiments, the length of the first splint strand (300) may be 70 to 90 (e.g., about 70, 75, 80, 85, or 90) nucleotides. In some embodiments, the first splint strand (300) comprises one or more phosphorothioate bonds at the 5' and / or 3' end to confer resistance to exonucleases. In some embodiments, the first splint strand (300) comprises one or more phosphorothioate bonds at an internal position to confer resistance to endonucleases. In some embodiments, the first splint strand (300) comprises one or more 2'-O-methylcytosine bases at the 5' and / or 3' end or at an internal position.

[0170] On the other hand, the present disclosure provides a method for forming a plurality of library-splint complexes (500), the method comprising: (a) providing a plurality of double-stranded splint adapters (200), wherein each double-stranded splint adapter (200) comprises a first splint chain (300) hybridized with a second splint chain (400). In some embodiments, the first splint chain (300) comprises regions arranged in 5' to 3' order: a first region (320), an internal region (310), and a second region (330). In some embodiments, the internal region (310) of the first splint chain hybridizes with the second splint chain (400). In certain embodiments, the second splint chain comprises regions arranged in 5' to 3' order: (i) a second subregion having a universal binding sequence for a fourth surface primer, and (ii) a first subregion having a universal binding sequence for a third surface primer. In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (b): hybridizing the plurality of double-stranded splint adapters with a plurality of single-stranded nucleic acid library molecules (100). In certain embodiments, each library molecule comprises regions arranged in 5' to 3' order: (i) a first left universal adapter sequence (120) having a binding sequence for a first surface primer; (ii) a second left universal adapter sequence (140) having a binding sequence for a first sequencing primer; (iii) a target sequence (110); (iv) a second right universal adapter sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adapter sequence (130) having a binding sequence for a second surface primer (130). In certain embodiments, hybridization is performed under conditions suitable for hybridizing the first splint strand (300) to the library molecule (100), thereby circularizing the library molecule to produce a library-splint complex (500). In some embodiments, the first region (320) of the first splint strand hybridizes to the binding sequence for the first surface primer (120), and the third region (330) of the first splint strand hybridizes to the binding sequence for the second surface primer (130). In certain embodiments, the library-splint complex (500) comprises a first gap between the 5' end of the library molecule and the 3' end of the second splint strand (300). In certain embodiments, the library-splint complex (500) comprises a second gap between the 5' end of the second splint strand (300) and the 3' end of the library molecule (100). In certain embodiments, the first and second gaps are enzymatically ligatable. In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further comprises a first left index sequence (160) and / or a first right index sequence (170) (e.g., see Figure 1 and 2). A list of exemplary first left index sequences (160) and first right index sequences (170) is provided in Tables 1 to 2 of Figure 7. In some embodiments, the first left index sequence (160) includes a short random sequence (e.g., NNN). In some embodiments, the first left index sequence (160) lacks a short random sequence (e.g., NNN). In some embodiments, the first right index sequence (170) includes a short random sequence (e.g., NNN). In some embodiments, the first right index sequence (170) lacks a short random sequence (e.g., NNN). In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further comprise a first left unique identification sequence (180) and / or a first right unique identification sequence (190). In certain embodiments, each unique identification sequence comprises a sequence that is used to uniquely identify each target sequence (e.g., an insertion sequence) to which a unique adapter is attached in a population of other target molecular sequences. In some embodiments, the first left unique identification sequence (180) and / or the first right unique identification sequence (190) can be used for molecular labeling. (For example, see Figure 1 ).

[0171] A multiplex workflow is initiated by preparing a library with a sample index using one or two index sequences (e.g., a left index sequence and / or a right index sequence). In some embodiments, a first left index sequence (160) and / or a first right index sequence (170) can be used to prepare a separate library with a sample index using input nucleic acids isolated from different sources. In some embodiments, libraries with sample indexes can be pooled together to produce a multiple library mixture, and the pooled libraries can be amplified and / or sequenced. In some embodiments, the sequence of the insertion region together with the first left index sequence (160) and / or the first right index sequence (170) can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample index libraries can be pooled together, such as 2 to 10 (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, or 10) libraries. In some embodiments, 10 to 50 (e.g., about 10, 20, 30, 40, or 50) sample index libraries are pooled together. In some embodiments, 50 to 100 (e.g., about 50, 60, 70, 80, 90 or 100) sample index libraries are brought together. In some embodiments, 100 to 200 (e.g., about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200) sample index libraries are brought together. In some embodiments, libraries of more than 200 sample indexes can be brought together. Exemplary nucleic acid sources include, but are not limited to, naturally occurring, recombinant or chemically synthesized sources. Exemplary nucleic acid sources include, but are not limited to, single cells, multiple cells, tissues, biological fluids, environmental samples or whole organisms. Exemplary nucleic acid sources include, but are not limited to, fresh, frozen, freshly frozen or archived sources (e.g., formalin fixed paraffin embedded; FFPE). Technicians will recognize that nucleic acids can be separated from many other sources. In some embodiments, nucleic acid library molecules can be prepared in single-stranded or double-stranded form.

[0172] In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further comprises a first left unique identification sequence (180) and / or a first right unique identification sequence (190) (e.g., see Figure 1 ). In some embodiments, the first left unique identification sequence (180) and the first right unique identification sequence (190) each comprise a sequence that is used to uniquely identify each target sequence (e.g., insertion sequence) to which a unique adapter is attached in a population of other target molecular sequences. In some embodiments, the first left unique identification sequence (180) and / or the first right unique identification sequence (190) can be used for molecular labeling.

[0173] In some embodiments, any method for forming a plurality of library-splint complexes (500) described herein may further include at least one enzymatic reaction, such as a phosphorylation reaction, a ligation reaction, a nuclease exonuclease reaction, or a combination thereof. The enzymatic reactions may be performed sequentially or substantially simultaneously. In some embodiments, the enzymatic reactions may be performed in a single reaction vessel. Alternatively, in some embodiments, a first enzymatic reaction may be performed in a first reaction vessel, then transferred to a second reaction vessel for performing a second enzymatic reaction, then transferred to a third reaction vessel for performing a third enzymatic reaction, etc.

[0174] In some embodiments, any of the methods for forming a plurality of library-splint complexes (500) described herein further comprises performing separate and sequential phosphorylation and ligation reactions, the phosphorylation and ligation reactions being performed in separate reaction vessels. In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (c1): contacting a plurality of double-stranded splint adapters (200) and / or a plurality of single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of a plurality of double-stranded splint adapters (200) and / or a plurality of single-stranded nucleic acid library molecules (100). In some embodiments, the phosphorylation reaction is transferred to a second reaction vessel. In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (d1): contacting a plurality of phosphorylated double-stranded splint adaptors (200) and a plurality of phosphorylated single-stranded nucleic acid library molecules (100) with a ligase in a second reaction vessel under conditions suitable for enzymatically ligating the first and second gaps, thereby generating a plurality of covalently closed circular library molecules (600), each of which is hybridized to the first splint strand (300). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0175] In some embodiments, any of the methods for forming a plurality of library-splint complexes (500) described herein further comprises performing consecutive phosphorylation and ligation reactions, which are performed consecutively in the same reaction vessel. In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (c2): contacting a plurality of double-stranded splint adapters (200) and a plurality of single-stranded nucleic acid library molecules (100) with T4 polynucleotide kinase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of a plurality of double-stranded splint adapters (200) and / or a plurality of single-stranded nucleic acid library molecules (100). In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (d2): contacting the phosphorylated double-stranded splint adaptor (200) and the phosphorylated single-stranded nucleic acid library molecule (100) with a ligase in the same first reaction vessel under conditions suitable for enzymatically ligating the first and second gaps, thereby generating a plurality of covalently closed circular library molecules (600), each of which is hybridized to the first splint strand (300). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0176] In some embodiments, any method for forming a plurality of library-splint complexes (500) described herein further comprises performing substantially simultaneous phosphorylation and ligation reactions, which are performed together in the same reaction vessel. In some embodiments, the method for forming a plurality of library-splint complexes (500) further comprises step (c3): contacting a plurality of double-stranded splint adapters (200) and a plurality of single-stranded nucleic acid library molecules (100) with (i) T4 polynucleotide kinase and (ii) ligase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of a plurality of double-stranded splint adapters (200) and a plurality of single-stranded nucleic acid library molecules (100). In some embodiments, the conditions are suitable for enzymatically ligating the first gap and the second gap, thereby generating a plurality of covalently closed circular library molecules (600), each of which is hybridized to the first splint strand (300). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0177] In some embodiments, any method for forming a plurality of library-splint complexes (500) described herein further comprises the following optional step: enzymatically removing a plurality of first splint chains (300) from a plurality of covalently closed circular library molecules (600), comprising: contacting a plurality of covalently closed circular library molecules (600) with at least one exonuclease to remove a plurality of first splint chains (300) and retain a plurality of covalently closed circular library molecules (600). In some embodiments, the exonuclease reaction can be performed in the same reaction buffer used for performing the phosphorylation and / or ligation reaction. In some embodiments, the exonuclease reaction can be performed in a different reaction buffer used for performing the phosphorylation and / or ligation reaction. In some embodiments, the exonuclease reaction can be performed in a third reaction vessel after the phosphorylation reaction (c1) is performed in the first reaction vessel and the ligation reaction (d1) is performed in the second reaction vessel. In some embodiments, the exonuclease reaction can be performed in the first reaction vessel after the phosphorylation reaction (c2) is performed in the first reaction vessel and the sequential ligation reaction (d2) is performed in the first reaction vessel. In some embodiments, the exonuclease reaction can be performed in the first reaction vessel after the substantially simultaneous phosphorylation and ligation reaction (c3) is performed in the first reaction vessel. In some embodiments, the at least one exonuclease comprises any combination of two or more of exonuclease I, thermolabile exonuclease I and / or T7 exonuclease.

[0178] In some embodiments, any of the above methods can be used to produce covalently closed circular library molecules (600). In some embodiments, each covalently closed circular library molecule comprises a target sequence operably connected on both sides by at least one nucleic acid adapter sequence. In some embodiments, at least one covalently closed circular library molecule carries at least one deaminated nucleotide base. In some embodiments, the covalently closed circular library molecule can be treated with a reagent for removing deaminated bases. In some embodiments, the reagent for removing deaminated bases is included in a compound that produces a baseless site at a uracil base in a nucleic acid molecule. For example, but not limited to, DNA glycosylase (UDG) can produce a baseless site at a uracil base. In some embodiments, the reagent for removing deaminated bases is included in a compound that produces a gap at a baseless site in a nucleic acid chain. For example, but not limited to, an enzyme or a mixture of enzymes having a lyase activity that breaks the phosphodiester backbone at the 5' and 3' sides of the baseless site can be used to release abasic deoxyribose and generate a gap. Abasic sites can be removed using, for example, but not limited to, AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase, Endo VIII glycosylase / AP lyase, and combinations thereof. In some embodiments, a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII can be used to achieve the creation of abasic sites and the removal of abasic sites to create gaps. Suitable uracil DNA glycosylases and DNA glycosylase-lyase endonucleases VIII include, for example, but not limited to, USER TM (From New England Biolabs TM Uracil-specific excision reagent enzyme) or thermolabile USER TM (Also from New England Biolabs TM ).

[0179] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the first subregion of the second splint strand (400) comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1). In some embodiments, the second subregion of the second splint strand (400) comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 2). In some embodiments, the second splint strand (400) comprises a first and a second subregion comprising the sequence 5'-AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 3). See Figure 3In some embodiments, the 5' end of the second splint strand (400) may be phosphorylated. In some embodiments, the 5' end of the second splint strand (400) may be non-phosphorylated.

[0180] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the first region (320) of the first splint strand comprises a first universal adapter sequence comprising a universal binding sequence (or its complement) for a first surface primer. In some embodiments, the first region (320) comprises the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO:4). For example, but not limited to, the first region (320) of the first splint strand can hybridize to a P5 surface primer or a complement of a P5 surface primer. For example, but not limited to, a P5 surface primer comprises the sequence

[0181] 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 204; short P5), or the P5 surface primer comprises the sequence 5'-AATGATACGGCGACCACCGAGATC-3' (SEQ ID NO: 205; long P5). In some embodiments, the second region (330) of the first splint strand comprises a second universal adapter sequence comprising a universal binding sequence (or its complement) for the second surface primer. In some embodiments, the second region (330) comprises the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 5). For example, but not limited to, the second region (330) of the first splint strand can hybridize with the P7 surface primer or the complement of the P7 surface primer. For example, but not limited to, the P7 surface primer comprises the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 5; short P7), or the P7 surface primer comprises the sequence 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO: 206; long P7). In some embodiments, the first splint strand (300) includes an internal region (310) comprising a fourth subregion having the following sequence

[0182] 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO:6). In some embodiments, the first splint strand (300) comprises an internal region (310) comprising a fifth subregion having the following sequence: 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO:7). In some embodiments, the first splint strand (300) comprises a first region (320), an internal region (310) having a fourth and a fifth subregion, and a second region (330) having the sequence 5'-TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGAG GCTGCGACGACTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:8). See Figure 3 . In some embodiments, the 5' end of the first splint chain (300) may be phosphorylated. In some embodiments, the 5' end of the first splint chain (300) may be non-phosphorylated. In some embodiments, the first subregion of the second splint chain (400) may hybridize with the fourth subregion of the first splint chain (300). In some embodiments, the second subregion of the second splint chain (400) may hybridize with the fifth subregion of the first splint chain (300).

[0183] In some embodiments, in any of the methods for forming multiple library-splint complexes (500) described herein, the first region (320) of the first splint chain comprises a sequence that can bind to the first left universal adapter sequence (120) of the library molecule, wherein the first region (320) of the first splint chain comprises the sequence 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO:6) or its complementary sequence.

[0184] In some embodiments, in any method for forming multiple library-splint complexes (500) described herein, the second region (330) of the first splint chain comprises a sequence that can bind to the first right universal adapter sequence (130) of the library molecule, wherein the second region (330) of the first splint chain comprises the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQID NO:7) or its complementary sequence.

[0185] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecule comprises a left universal binding sequence (120) that binds to a first region (320) of a first splint strand, wherein the left universal binding sequence (120) comprises the sequence

[0186] 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO:204).

[0187] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecule comprises a first left universal binding sequence (120) that binds to a first region (320) of a first splint strand, wherein the left universal binding sequence (120) comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1) or its complement.

[0188] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecules include a left universal binding sequence (140) for a sequencing primer, wherein the left universal binding sequence comprises the sequence 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO:207).

[0189] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecules include a left universal binding sequence for a sequencing primer (140), wherein the left universal binding sequence comprises the sequence 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO:208).

[0190] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecule comprises a left universal binding sequence (140) for a sequencing primer, wherein the left universal binding sequence comprises the sequence 5'-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3' (SEQ ID NO:209).

[0191] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecules include a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises the sequence 5'-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (SEQ ID NO:210).

[0192] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecule comprises a left universal binding sequence (150) for a sequencing primer, wherein the left universal binding sequence comprises the sequence 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO:211).

[0193] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecules include a left universal binding sequence for a sequencing primer (150), wherein the left universal binding sequence comprises the sequence 5'-ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT-3' (SEQ ID NO:212).

[0194] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecule comprises a right universal binding sequence (130) that binds to a first region (330) of a first splint strand, wherein the right universal binding sequence (130) comprises the sequence

[0195] 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 213).

[0196] In some embodiments, in any of the methods for forming a plurality of library-splint complexes (500) described herein, the library molecule comprises a right universal binding sequence (130) that binds to a first region (330) of a first splint strand, wherein the right universal binding sequence (130) comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO:2) or its complement.

[0197] Rolling circle amplification method

[0198] Using circular library molecules generated via double-stranded splint adapters

[0199] The present disclosure provides a method for performing a rolling circle amplification reaction on a covalently closed circular library molecule (600). In some embodiments, the rolling circle amplification reaction can be performed after both phosphorylation and ligation. In some embodiments, the rolling circle amplification reaction is performed after the ligation. In some embodiments, the rolling circle amplification reaction can be performed after the exonuclease reaction, when the covalently closed circular library molecule (600) is no longer hybridized with the first splint chain (300). In some embodiments, the rolling circle amplification reaction can be performed on the covalently closed circular library molecule (600) hybridized with the first splint chain (300). In some embodiments, the covalently closed circular library molecule (600) can be distributed on a support and then undergo a rolling circle amplification reaction. In some embodiments, the covalently closed circular library molecule (600) can undergo a rolling circle amplification reaction in a solution and then be distributed on a support. In some embodiments, the rolling circle amplification reaction can use the retained first splint chain (300) as an amplification primer, or the first splint chain (300) can be removed (e.g., by exonuclease digestion) and replaced with a soluble amplification primer.

[0200] Rolling circle amplification on support

[0201] Using circular library molecules generated via double-stranded splint adapters

[0202] In some embodiments, the method is used to perform a rolling circle amplification reaction on a plurality of covalently closed circular library molecules lacking a hybridized first splint strand (300). In certain embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a second splint strand region (400) comprising a universal binding sequence for a third surface primer, wherein the method further comprises (a): distributing the plurality of covalently closed circular library molecules (600) onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing each covalently closed circular library molecule (600) with each immobilized third surface primer, thereby immobilizing the plurality of covalently closed circular library molecules (600).

[0203] In some embodiments, a plurality of third surface primers immobilized on a support comprises a sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7). Each third surface primer can hybridize with a covalently closed circular library molecule (600) having a second splint strand region (400) comprising a universal binding sequence for the third surface primer. In certain embodiments, the universal binding sequence for the third surface primer comprises a second subregion comprising a sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 2).

[0204] In some embodiments, a plurality of covalently closed circular library molecules (600) can be dispensed onto a support that is coated with one or more compounds to create a passivation layer on the support (e.g., Figure 8 ). In some embodiments, the passivation layer forms a porous layer. In some embodiments, the passivation layer forms a semi-porous layer. In some embodiments, surface primers, concatemer template molecules, polymerases, or combinations thereof can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface that can improve the nucleic acid hybridization and amplification performance on the support. In general, the support may comprise one or more covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating that is covalently bound to at least a portion of the support, for example, via a chemical group on the support, a primer grafted to the functionalized polymer coating, or a water-soluble protective coating on the primer and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In certain embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). In certain embodiments, the hydrophilic polymer coating may comprise a branched PEG having at least 4 branches. In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured by a water contact angle. In certain embodiments, the water contact angle is no more than 45 degrees (e.g., no more than 5 degrees, no more than 10 degrees, no more than 15 degrees, no more than 20 degrees, no more than 25 degrees, no more than 30 degrees, no more than 35 degrees, no more than 40 degrees, or no more than 45 degrees). In some embodiments, the density of the covalently closed circular library molecules (600) immobilized to the support or to the coating on the support is about 10 2 -10 6 / mm 2 (For example, about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of the covalently closed circular library molecules (600) immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7 , 10 8or 10 9 In some embodiments, the density of the covalently closed circular library molecules (600) immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 10 9 , 10 10 , 10 11 or 10 12 ) / mm 2 In some embodiments, a plurality of covalently closed circular library molecules (600) are immobilized to a support or to a coating on a support at predetermined sites on the support (or coating on a support). In some embodiments, a plurality of covalently closed circular library molecules (600) are immobilized to a support or to a coating on a support at random sites on the support (or coating on a support).

[0205] In some embodiments, the partitioning of step (a) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 (e.g., less than 10, or about 10, 15, 20, 30, or 40) and having a polarity index of 4-9 (e.g., 4, 5, 6, 7, 8, or 9); (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 (e.g., less than 10, 10, 15, 20, 30, 40, 50, 75, 100, 105, 105, 110, or 115) and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8 (e.g., 4, 5, 6, 7, or 8); and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% (e.g., 25%, 30%, 35%, 40%, 45% or 50%) of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% (e.g., 5%, 6%, 7%, 8%, 9% or 10%) of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5 (e.g., about 5.0, 5.5, 6.0 or 6.5); and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% (e.g., 5%, 10%, 15%, 20%, 25%, 30% or 35%) of the hybridization buffer volume. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0206] In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (b): under conditions suitable for using a plurality of third surface primers as fixed amplification primers and using a plurality of covalently closed circular library molecules (600) as template molecules, a rolling circle amplification reaction is performed on a support, and a plurality of fixed covalently closed circular library molecules (600) are contacted with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U), thereby generating a plurality of nucleic acid concatemer molecules fixed to the third surface primers. In some embodiments, the plurality of nucleotides comprises any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each fixed concatemer is covalently bonded to each third surface primer. In some embodiments, each covalently closed circular library molecule (600) in a plurality of covalently closed circular library molecules comprises a second splint strand region (400) which also comprises a universal binding sequence for a fourth surface primer, such that a rolling circle amplification reaction produces a concatemer molecule having multiple copies of the universal binding sequence for a third and fourth surface primer. In some embodiments, the method comprises: distributing the covalently closed circular library molecule (600) to a support comprising a plurality of fixed third and fourth surface primers, performing a rolling circle amplification reaction under conditions suitable for hybridizing at least one second splint strand region (400) of the concatemer molecule with the fixed fourth surface primer to produce a concatemer molecule, thereby solidifying at least a portion of the concatemer molecule to the support. In some embodiments, the fixed concatemers may be subjected to a sequencing reaction.

[0207] In some embodiments, the plurality of fourth surface primers immobilized on the support comprise the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1) or its complementary sequence). The individual fourth surface primers can hybridize with a portion of a concatamer molecule having a second splint strand region (400), wherein the second splint strand region comprises a universal binding sequence for the fourth surface primer (or its complementary sequence), wherein the universal binding sequence for the fourth surface primer comprises a first subregion comprising the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1).

[0208] In-solution rolling circle amplification using soluble amplification primers

[0209] Using circular library molecules generated via double-stranded splint adapters

[0210] In some embodiments, the method is used to perform a rolling circle amplification reaction on a plurality of covalently closed circular library molecules lacking a hybridized first splint strand (300), wherein each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a first left universal adapter sequence (120) and a second (140) left universal adapter sequence for a universal binding sequence of a forward amplification primer. In some embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a second splint strand region (400) comprising a universal binding sequence for a third surface primer. In some embodiments, the method comprises: (a) hybridizing a plurality of soluble forward amplification primers with the first left universal adapter sequence or the second left universal adapter sequence comprising the universal binding sequence for the forward amplification primer in a solution; and (b) performing a first rolling circle amplification reaction by contacting a plurality of covalently closed circular library molecules (600) with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U) under conditions suitable for performing a rolling circle amplification reaction in a solution using a plurality of forward amplification primers and a plurality of covalently closed circular library molecules (600) as template molecules, thereby generating a plurality of nucleic acid concatemer molecules. In certain embodiments, the nucleic acid concatemer molecules are still hybridized with the covalently closed circular library molecules (600). In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (c): distributing the plurality of concatemer molecules to a support on which a plurality of third surface primers are fixed under conditions suitable for hybridizing at least a portion of the concatemer molecules with a plurality of fixed third surface primers, thereby fixing the plurality of concatemer molecules. In some embodiments, the plurality of fixed concatemer molecules are still hybridized with the covalently closed circular library molecules (600). In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (d): contacting the fixed plurality of concatemer molecules with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U) under conditions suitable for performing a second rolling circle amplification reaction on a support using a plurality of covalently closed circular library molecules (600) as template molecules, thereby extending a plurality of fixed nucleic acid concatemer molecules. In some embodiments, the first rolling circle amplification reaction and / or the second rolling circle amplification reaction can be performed with a plurality of nucleotides comprising any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each immobilized concatemer hybridizes to each third surface primer. In some embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a second splint strand region (400) that also comprises a universal binding sequence for a fourth surface primer, such that a first rolling circle amplification reaction in solution generates concatemer molecules having multiple copies of universal binding sequences for the third and fourth surface primers.In some embodiments, the method includes distributing the concatemer molecules onto a support comprising a plurality of fixed third and fourth surface primers, and incubating the concatemer molecules under conditions suitable for hybridizing at least one second splint strand region (400) of the concatemer molecules with the fixed third and fourth surface primers, thereby immobilizing at least a portion of the concatemer molecules to the support. In some embodiments, the fixed concatemers can be subjected to a sequencing reaction.

[0211] In some embodiments, the plurality of concatemer molecules of step (c) can be distributed onto a support comprising a plurality of third surface primers immobilized thereon, the third surface primer comprising the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7). In some embodiments, each third surface primer can hybridize with a portion of the concatemer molecules having a universal binding sequence for the third surface primer, wherein the universal binding sequence for the third surface primer comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 2 or its complementary sequence).

[0212] In some embodiments, the plurality of concatemer molecules of step (c) can be distributed onto a support comprising a plurality of fourth surface primers immobilized thereon, the fourth surface primer comprising the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1 or its complementary sequence). In some embodiments, each fourth surface primer can hybridize with a portion of a concatemer molecule having a universal binding sequence (or its complementary sequence) for the fourth surface primer, wherein the universal binding sequence of the fourth surface primer comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1).

[0213] In some embodiments, the plurality of concatemer molecules of step (c) can be dispensed onto a support that is coated with one or more compounds to produce a passivation layer on the support (e.g., Figure 8). In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, surface primers, concatemer template molecules and / or polymerases can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface, which can improve the nucleic acid hybridization and amplification performance on the support. In general, the support may comprise one or more layers of covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating, which is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In some embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). In some embodiments, the hydrophilic polymer coating may comprise a branched PEG having at least 4 branches. In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured as a water contact angle, wherein the water contact angle does not exceed 45 degrees (e.g., does not exceed 5 degrees, does not exceed 10 degrees, does not exceed 15 degrees, does not exceed 20 degrees, does not exceed 25 degrees, does not exceed 30 degrees, does not exceed 35 degrees, does not exceed 40 degrees, or does not exceed 45 degrees). In some embodiments, the density of concatemer molecules immobilized to the support or to the coating on the support is about 10 2 -10 6 / mm 2 (For example, about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7 , 10 8 or 10 9 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 10 9 , 10 10 , 1011 or 10 12 ) / mm 2 In some embodiments, a plurality of concatemer molecules are immobilized to a support or to a coating on a support at predetermined sites on the support (or a coating on a support). In some embodiments, a plurality of concatemer molecules are immobilized to a support or to a coating on a support at random sites on the support (or a coating on a support).

[0214] In some embodiments, the partitioning of step (c) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 (e.g., less than 10, or about 10, 15, 20, 30, or 40) and having a polarity index of 4-9 (e.g., 4, 5, 6, 7, 8, or 9); (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 (e.g., less than 10, 10, 15, 20, 30, 40, 50, 75, 100, 105, 105, 110, or 115) and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8 (e.g., 4, 5, 6, 7, or 8); and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% (e.g., 25%, 30%, 35%, 40%, 45% or 50%) of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% (e.g., 5%, 6%, 7%, 8%, 9% or 10%) of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5 (e.g., about 5.0, 5.5, 6.0 or 6.5); and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% (e.g., 5%, 10%, 15%, 20%, 25%, 30% or 35%) of the hybridization buffer volume. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0215] In some embodiments, the method is used to perform a rolling circle amplification reaction on a plurality of covalently closed circular library molecules lacking a hybridized first splint strand (300), wherein each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a first right universal adapter sequence (130) and a second (150) right universal adapter sequence for a universal binding sequence of a forward amplification primer. In some embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a second splint strand region (400), the second splint strand region comprising a universal binding sequence for a third surface primer, and the method comprises: (a) hybridizing a plurality of soluble forward amplification primers with a first right universal adapter sequence or a second right universal adapter sequence comprising a universal binding sequence for the forward amplification primer in a solution; and (b) performing a first rolling circle amplification reaction by contacting the plurality of covalently closed circular library molecules (600) with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U) under conditions suitable for performing a rolling circle amplification reaction in a solution using a plurality of forward amplification primers and a plurality of covalently closed circular library molecules (600) as template molecules, thereby generating a plurality of nucleic acid concatemer molecules that are still hybridized to the covalently closed circular library molecules (600). In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (c): distributing the plurality of concatemer molecules to a support on which a plurality of third surface primers are fixed under conditions suitable for hybridizing at least a portion of the concatemer molecules with a plurality of fixed third surface primers, thereby fixing the plurality of concatemer molecules. In certain embodiments, the plurality of fixed concatemer molecules are still hybridized with the covalently closed circular library molecules (600). In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (d): contacting the fixed plurality of concatemer molecules with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U) under conditions suitable for performing a second rolling circle amplification reaction on a support using a plurality of covalently closed circular library molecules (600) as template molecules, thereby extending a plurality of fixed nucleic acid concatemer molecules. In some embodiments, the first rolling circle amplification reaction and / or the second rolling circle amplification reaction can be performed with a plurality of nucleotides comprising any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each immobilized concatemer hybridizes to each third surface primer. In some embodiments, each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a second splint strand region (400) that also comprises a universal binding sequence for a fourth surface primer, such that a first rolling circle amplification reaction in solution generates concatemer molecules having multiple copies of universal binding sequences for the third and fourth surface primers.In some embodiments, the method includes distributing the concatemer molecules onto a support comprising a plurality of fixed third and fourth surface primers, and incubating the concatemer molecules under conditions suitable for hybridizing at least one second splint strand region (400) of the concatemer molecules with the fixed third and fourth surface primers, thereby immobilizing at least a portion of the concatemer molecules to the support. In some embodiments, the fixed concatemers can be subjected to a sequencing reaction.

[0216] In some embodiments, the plurality of concatemer molecules of step (c) can be distributed onto a support comprising a plurality of third surface primers immobilized thereon, the third surface primer comprising the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7). In some embodiments, each third surface primer can hybridize with a portion of the concatemer molecules having a universal binding sequence for the third surface primer, wherein the universal binding sequence for the third surface primer comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 2 or its complementary sequence).

[0217] In some embodiments, the plurality of concatemer molecules of step (c) can be distributed onto a support comprising a plurality of fourth surface primers immobilized thereon, the fourth surface primer comprising the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1 or its complementary sequence). In some embodiments, each fourth surface primer can hybridize with a portion of a concatemer molecule having a universal binding sequence (or its complementary sequence) for the fourth surface primer, wherein the universal binding sequence of the fourth surface primer comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1).

[0218] In some embodiments, the plurality of concatemer molecules of step (c) can be dispensed onto a support that is coated with one or more compounds to produce a passivation layer on the support (e.g., Figure 8). In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, surface primers, concatemer template molecules and / or polymerases can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface, which can improve the nucleic acid hybridization and amplification performance on the support. In general, the support may comprise one or more layers of covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating, which is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In some embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). The hydrophilic polymer coating may comprise a branched PEG having at least 4 branches (e.g., 4, 5, 6, 7, 8, 9, 10 or more branches). In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured as a water contact angle, wherein the water contact angle does not exceed 45 degrees (e.g., does not exceed 5 degrees, does not exceed 10 degrees, does not exceed 15 degrees, does not exceed 20 degrees, does not exceed 25 degrees, does not exceed 30 degrees, does not exceed 35 degrees, does not exceed 40 degrees, or does not exceed 45 degrees). In some embodiments, the density of concatemer molecules immobilized to the support or to the coating on the support is about 10 2 -10 6 / mm 2 (For example, about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7 , 10 8 or 10 9 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 10 9, 10 10 , 10 11 or 10 12 ) / mm 2 In some embodiments, a plurality of concatemer molecules are immobilized to a support or to a coating on a support at predetermined sites on the support (or a coating on a support). In some embodiments, a plurality of concatemer molecules are immobilized to a coating on a support at random sites on the support (or a coating on a support).

[0219] In some embodiments, the partitioning of step (c) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 (e.g., less than 10, or about 10, 15, 20, 30, or 40) and having a polarity index of 4-9 (e.g., 4, 5, 6, 7, 8, or 9); (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 (e.g., less than 10, 10, 15, 20, 30, 40, 50, 75, 100, 105, 105, 110, or 115) and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8 (e.g., 4, 5, 6, 7, or 8); and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% (e.g., 25%, 30%, 35%, 40%, 45% or 50%) of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% (e.g., 5%, 6%, 7%, 8%, 9% or 10%) of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5 (e.g., about 5.0, 5.5, 6.0 or 6.5); and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% (e.g., 5%, 10%, 15%, 20%, 25%, 30% or 35%) of the hybridization buffer volume. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0220] In-solution rolling amplification using the first splint strand

[0221] Using circular library molecules generated via double-stranded splint adapters

[0222] In some embodiments, the method is used to perform a rolling circle amplification reaction on a plurality of covalently closed circular library molecules hybridized to a first splint strand (300), wherein each covalently closed circular library molecule (600) in the plurality of covalently closed circular library molecules comprises a second splint strand region (400), the second splint strand region comprising a universal binding sequence for a third surface primer. In some embodiments, the method comprises (a): contacting a plurality of covalently closed circular library molecules (600) hybridized to a first splint strand (300) with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U) in a solution under conditions suitable for performing a first rolling circle amplification reaction using the first splint strand (300) as an amplification primer, thereby producing a plurality of concatemer molecules that are still hybridized to the covalently closed circular library molecules (600). See Figure 2 .

[0223] In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (b): distributing the plurality of concatamer molecules hybridized to the covalently closed circular library molecules (600) onto a support having a plurality of third surface primers immobilized thereon, under conditions suitable for hybridizing at least a portion of the concatamer to a plurality of fixed third surface primers, thereby immobilizing the plurality of concatamer molecules hybridized to the covalently closed circular library molecules (600).

[0224] In some embodiments, the plurality of concatemer molecules of step (b) can be distributed onto a support comprising a plurality of third surface primers immobilized thereon, the third surface primer comprising the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7). In some embodiments, each third surface primer can hybridize with a portion of the concatemer molecule having a universal binding sequence for the third surface primer. In certain embodiments, the universal binding sequence for the third surface primer comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 2 or its complementary sequence).

[0225] In some embodiments, the plurality of concatemer molecules of step (b) can be distributed onto a support comprising a plurality of fourth surface primers immobilized thereon, the fourth surface primer comprising the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1 or its complementary sequence). In some embodiments, each fourth surface primer can hybridize with a portion of a concatemer molecule having a universal binding sequence (or its complementary sequence) of the fourth surface primer. In certain embodiments, the universal binding sequence for the fourth surface primer comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1).

[0226] In some embodiments, the plurality of concatemer molecules of step (b) can be dispensed onto a support that is coated with one or more compounds to produce a passivation layer on the support (e.g., Figure 8 ). In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, surface primers, concatemer template molecules and / or polymerases can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface, which can improve the nucleic acid hybridization and amplification performance on the support. In some embodiments, the support may comprise one or more layers of covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating, which is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In some embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). In some embodiments, the hydrophilic polymer coating may comprise a branched PEG having at least 4 branches (e.g., 4, 5, 6, 7, 8, 9, 10 or more branches). In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured as a water contact angle, wherein the water contact angle does not exceed 45 degrees (e.g., does not exceed 5 degrees, does not exceed 10 degrees, does not exceed 15 degrees, does not exceed 20 degrees, does not exceed 25 degrees, does not exceed 30 degrees, does not exceed 35 degrees, does not exceed 40 degrees, or does not exceed 45 degrees). In some embodiments, the density of concatemer molecules immobilized to the support or to the coating on the support is about 10 2 -10 6 / mm 2 (For example, about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7 , 108 or 10 9 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 10 9 , 10 10 , 10 11 or 10 12 ) / mm 2 In some embodiments, a plurality of concatemer molecules are immobilized to a support or to a coating on a support at predetermined sites on the support (or a coating on a support). In some embodiments, a plurality of concatemer molecules are immobilized to a coating on a support at random sites on the support (or a coating on a support).

[0227] In some embodiments, the partitioning of step (b) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 (e.g., less than 10, or about 10, 15, 20, 30, or 40) and having a polarity index of 4-9 (e.g., 4, 5, 6, 7, 8, or 9); (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 (e.g., less than 10, 10, 15, 20, 30, 40, 50, 75, 100, 105, 105, 110, or 115) and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8 (e.g., 4, 5, 6, 7, or 8); and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% (e.g., 25%, 30%, 35%, 40%, 45% or 50%) of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% (e.g., 5%, 6%, 7%, 8%, 9% or 10%) of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5 (e.g., about 5.0, 5.5, 6.0 or 6.5); and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% (e.g., 5%, 10%, 15%, 20%, 25%, 30% or 35%) of the hybridization buffer volume. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0228] In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (c): contacting a plurality of fixed concatemer molecules with a plurality of strand displacement polymerases and a plurality of nucleotides (e.g., comprising bases A, G, C, T and / or U) under conditions suitable for performing a second rolling circle amplification reaction on a support using a plurality of covalently closed circular library molecules (600) as template molecules, thereby extending the plurality of fixed nucleic acid concatemer molecules.

[0229] In some embodiments, the first rolling circle amplification reaction and / or the second rolling circle amplification reaction can be performed with multiple nucleotides including any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each covalently closed circular library molecule (600) in a plurality of covalently closed circular library molecules comprises a second splint chain region (400), which also comprises a universal binding sequence for a fourth surface primer, so that the first rolling circle amplification reaction in the solution generates a concatemer molecule having multiple copies of a universal binding sequence for a third and fourth surface primer. In some embodiments, the method comprises distributing the concatemer molecule to a support comprising a plurality of fixed third and fourth surface primers, and incubating a plurality of fixed nucleic acid concatemer molecules under conditions suitable for hybridizing at least one second splint chain region (400) of the concatemer molecule with the fixed third and fourth surface primers, connecting the concatemer molecule to the fixed third and fourth surface primers, thereby solidifying at least a portion of the concatemer molecule to the support. In some embodiments, each fixed concatemer hybridizes with each third surface primer. In some embodiments, the immobilized concatemers may be subjected to a sequencing reaction.

[0230] Methods for forming multiple library-splint complexes

[0231] Use a single-strand cleat chain

[0232] In some embodiments, any of the methods described above can be used to generate nucleic acid linear library molecules, each comprising sequences arranged in 5' to 3' order.

[0233] In some embodiments, the nucleic acid linear library molecules are arranged from 5' to 3': (i) a first left universal adapter sequence (720) having a binding sequence for a first surface primer; (ii) a first left index sequence (760); (iii) a second left universal adapter sequence (740) having a binding sequence for a first sequencing primer; (iv) a target sequence (710); (v) a second right universal adapter sequence (750) having a binding sequence for a second sequencing primer; (vi) a first right index sequence (770); and (vii) a first right universal adapter sequence (730) having a binding sequence for a second surface primer (e.g., see Figures 4 to 5 ).

[0234] In some embodiments, at least one linear library molecule carries at least one deaminated nucleotide base. In some embodiments, before cyclization, the linear library molecule can be treated with a reagent for removing deaminated bases. In some embodiments, the reagent for removing deaminated bases includes a compound that produces a baseless site at the uracil base in the nucleic acid molecule. For example, but not limited to, DNA glycosylase (UDG) can produce a baseless site at the uracil base. In some embodiments, the reagent for removing deaminated bases includes a compound that produces a gap at the baseless site in the nucleic acid chain. For example, but not limited to, an enzyme or a mixture of enzymes having a lyase activity that breaks the phosphodiester backbone at the 5' and 3' sides of the baseless site can be used to release abasic deoxyribose and generate a gap. In some embodiments, AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase, Endo VIII glycosylase / AP lyase can be used to remove the baseless site, and combinations thereof. In some embodiments, a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII can be used to achieve the generation of abasic sites and the removal of abasic sites to create gaps. For example, but not limited to, the generation of abasic sites and the removal of abasic sites can be achieved using USER TM (From New England Biolabs TM Uracil-specific excision reagent enzyme) or thermolabile USER TM (Also from New England Biolabs TM ) to carry out.

[0235] In another aspect, the present disclosure provides a method for forming a plurality of library-splint complexes (900), the method comprising: (a) providing a plurality of single-stranded nucleic acid library molecules (700), wherein each library molecule in the plurality of single-stranded nucleic acid library molecules comprises a sequence of interest (710) flanked on one side by at least a first left universal adapter sequence (720) and on another side by at least a first right universal adapter sequence (730) (e.g., see Figures 4 to 5 ).

[0236] In some embodiments, the method for forming a plurality of library-splint complexes (900) further comprises step (b): providing a plurality of single-stranded splint chains (800), wherein each single-stranded splint chain (800) in the plurality of single-stranded splint chains comprises a first region (810) and a second region (820), wherein the first region is capable of hybridizing with at least the first left universal adapter sequence (720) of each library molecule, and the second region is capable of hybridizing with at least the first right universal adapter sequence (730) of each library molecule. An exemplary single-stranded splint chain (800) is shown in Figures 4 to 5 In some embodiments, the single-stranded splint strand (800) may be 20-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length, or 60-80 nucleotides in length.

[0237] In some embodiments, the method of forming a plurality of library-splint complexes (900) further comprises step (c): hybridizing a plurality of single-stranded splint chains (800) with a plurality of single-stranded nucleic acid library molecules (700). In certain embodiments, the hybridization is performed under conditions suitable for hybridizing each library molecule with each single-stranded splint chain, such that a first region (810) of one of the single-stranded splint chains anneals to at least a first left universal adapter sequence (720) of the library molecule, and a second region (820) of the single-stranded splint chain anneals to at least a first right universal sequence (730) of the library molecule, thereby looping each library molecule to form a plurality of library-splint complexes (900). In some embodiments, the library-splint complex (900) comprises a gap between the 5' and 3' ends of the library molecule (e.g., Figures 4 to 5 ). In some embodiments, the gap is enzymatically ligatable.

[0238] In some embodiments, in the method of forming a plurality of library-splint complexes (900), the first region (810) of the single-stranded splint strand comprises a first universal adapter sequence that can hybridize to a first universal binding sequence at one end of a linear nucleic acid library molecule (720). In some embodiments, the first region (810) of the single-stranded splint strand comprises a first universal adapter sequence that comprises a universal binding sequence for a forward sequencing primer or a reverse sequencing primer, a universal binding sequence for a first surface primer or a second surface primer, a universal binding sequence for a forward amplification primer or a reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.

[0239] In some embodiments, in a method for forming a plurality of library-splint complexes (900), the second region (820) of the single-stranded splint strand comprises a second universal adapter sequence that can hybridize to a second universal binding sequence at the other end of the linear nucleic acid library molecule. In some embodiments, the second region (820) of the single-stranded splint strand comprises a second universal adapter sequence that comprises a universal binding sequence for a forward sequencing primer or a reverse sequencing primer, a universal binding sequence for a first surface primer or a second surface primer, a universal binding sequence for a forward amplification primer or a reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.

[0240] In some embodiments, in a method of forming a plurality of library-splint complexes (900), a single-stranded splint chain (800) comprises one or more phosphorothioate bonds at its 5' and / or 3' ends to confer resistance to exonucleases. In some embodiments, a single-stranded splint chain (800) comprises one or more phosphorothioate bonds at an internal position to confer resistance to endonucleases. In some embodiments, a single-stranded splint chain (800) comprises one or more 2'-O-methylcytosine bases at its 5' and / or 3' ends or at an internal position. In some embodiments, the 5' end of a single-stranded splint chain (800) is phosphorylated or non-phosphorylated. In some embodiments, the 3' end of a single-stranded splint chain (800) comprises a terminal 3'OH group or a terminal 3' blocking group.

[0241] In some embodiments, in the method of forming a plurality of library-splint complexes (900), the first region (810) of the single-stranded splint chain can hybridize with the sense strand or antisense strand of the double-stranded nucleic acid library molecule. In some embodiments, in the library-splint complex (900), the second region (820) of the single-stranded splint chain can hybridize with the sense strand or antisense strand of the double-stranded nucleic acid library molecule. In some embodiments, the double-stranded nucleic acid library molecule can be denatured to produce single-stranded sense and antisense library strands. In certain embodiments, the double-stranded nucleic acid library molecule can be denatured to produce the single-stranded nucleic acid library molecule (700) of step (a).

[0242] In some embodiments, in the method for forming a plurality of library-splint complexes (900), the first and second regions (210 and 220, respectively) of the single-stranded splint strand do not hybridize to the sequence of interest (710).

[0243] In some embodiments, in the method of forming a plurality of library-splint complexes (900), the nucleic acid library molecule (700) further comprises a second left universal adapter sequence (740). In some embodiments, the nucleic acid library molecule (700) further comprises a second right universal adapter sequence (750). In some embodiments, the nucleic acid library molecule (700) may further comprise additional left universal adapter sequences and / or right universal adapter sequences.

[0244] In some embodiments, in the method of forming a plurality of library-splint complexes (900), the nucleic acid library molecule (700) further comprises a first left index sequence (760) and / or a first right index sequence (770). In some embodiments, the first left index sequence (760) comprises a sample index sequence. The length of the first left index sequence (760) may be 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleotides. In some embodiments, the first right index sequence (770) comprises another sample index sequence. In some embodiments, the length of the first right index sequence (770) may be 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) nucleotides. In some embodiments, the sequences of the left sample index sequence and the right sample index sequence (e.g., (760) and (770)) may be the same or different from each other. In some embodiments, the sample index sequence can be used to distinguish target sequences obtained from different sample sources in multiple determinations. A list of exemplary first left index sequences (760) and first right index sequences (770) is provided in Table 2 of Figure 7. In some embodiments, the first left index sequence (760) may include a short random sequence (e.g., NNN) or lack a short random sequence. In some embodiments, the first right index sequence (770) may include a short random sequence (e.g., NNN) or lack a short random sequence. In some embodiments, the short random sequence (e.g., NNN) may be 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleotides in length.

[0245] In some embodiments, a multiplex workflow is initiated by preparing a library with a sample index using one or two index sequences (e.g., a left index sequence and / or a right index sequence). In some embodiments, a first left index sequence (760) and / or a first right index sequence (770) can be used to prepare a separate library with a sample index using input nucleic acids isolated from different sources. In some embodiments, libraries with sample indexes can be pooled together to produce a multiple library mixture, and the pooled libraries can be looped, amplified, and / or sequenced. In some embodiments, the sequence of the insertion region together with the first left index sequence (760) and / or the first right index sequence (770) can be used to identify the source of the input nucleic acid. In some embodiments, any number of sample index libraries can be pooled together, such as 2 to 10 (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, or 10) libraries. In some embodiments, 10 to 50 (e.g., about 10, 20, 30, 40, or 50) sample index libraries are pooled together. In some embodiments, 50 to 100 (e.g., about 50, 60, 70, 80, 90 or 100) sample index libraries are brought together. In some embodiments, 100 to 200 (e.g., about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200) sample index libraries are brought together. Exemplary nucleic acid sources include naturally occurring, recombinant or chemically synthesized sources. Exemplary nucleic acid sources include, but are not limited to, single cells, multiple cells, tissues, biological fluids, environmental samples or whole organisms. Exemplary nucleic acid sources include, but are not limited to, fresh, frozen, fresh frozen or archived sources (e.g., formalin fixed paraffin embedded; FFPE). Technicians will recognize that nucleic acids can be separated from many other sources. In some embodiments, nucleic acid library molecules can be prepared in single-stranded or double-stranded form.

[0246] In some embodiments, in a method for forming a plurality of library-splint complexes (900), the nucleic acid library molecule (700) further comprises: an optional first left unique identification sequence (780) and / or an optional first right unique identification sequence (790). In some embodiments, the first left unique identification sequence (780) and the first right unique identification sequence (790) each comprise a sequence that is used to uniquely identify each target sequence (e.g., insertion sequence) to which a unique adapter is attached in a population of other target molecular sequences. In some embodiments, the first left unique identification sequence (780) and / or the first right unique identification sequence (790) can be used for molecular labeling. In some embodiments, the unique identification sequence comprises 2 to 12 or more (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more than 12) nucleotides with a known sequence. For example, but not limited to, the unique identification sequence comprises a known random sequence, wherein the nucleotide at each position is randomly selected from nucleotides having bases A, G, C, T or U. In some embodiments, the unique identification sequence (780) and / or (790) may be used in a molecular labeling procedure.

[0247] In some embodiments, in a method for forming multiple library-splint complexes (900), the nucleic acid library molecule (700) comprises any one of the following or any combination of two or more in any order: a first left universal adapter sequence (720); a second left universal adapter sequence (740); a first left index sequence (760); a first left unique identification sequence (780); a first right universal adapter sequence (730); a second right universal adapter sequence (750); a first right index sequence (770); and / or a first right unique identification sequence (790).

[0248] In some embodiments, in a method for forming a plurality of library-splint complexes (900), the first left universal adapter sequence (720) and / or the second left universal adapter sequence (740) include: a universal binding sequence for a forward sequencing primer or a reverse sequencing primer; a universal binding sequence for a first surface primer or a second surface primer; a universal binding sequence for a forward amplification primer or a reverse amplification primer; and / or a universal binding sequence for a compaction oligonucleotide. In some embodiments, the nucleic acid library molecule (700) may further comprise an additional left universal adapter sequence.

[0249] In some embodiments, in a method for forming a plurality of library-splint complexes (900), the first right universal adapter sequence (730) and / or the second right universal adapter sequence (750) include: a universal binding sequence for a forward sequencing primer or a reverse sequencing primer; a universal binding sequence for a first surface primer or a second surface primer; a universal binding sequence for a forward amplification primer or a reverse amplification primer; and / or a universal binding sequence for a compaction oligonucleotide. In some embodiments, the nucleic acid library molecule (700) may further comprise an additional right universal adapter sequence.

[0250] On the other hand, the present disclosure provides a method for forming a plurality of library-splint complexes (900), the method comprising: (a) providing a plurality of single-stranded splint chains (800), wherein each single-stranded splint chain (800) comprises regions arranged in 5' to 3' order: (i) a first region (810) having a universal binding sequence that hybridizes with a sequence on one end of a linear single-stranded library molecule (e.g., 120), and (ii) a second region (820) having a universal binding sequence that hybridizes with a sequence on the other end of the linear single-stranded library molecule (e.g., 130). In some embodiments, the method for forming multiple library-splint complexes (900) further includes step (b): hybridizing multiple single-stranded splint chains (800) with multiple single-stranded nucleic acid library molecules (700), wherein each library molecule comprises regions arranged in 5' to 3' order: (i) a first left universal adapter sequence (720) having a binding sequence for a first surface primer; (ii) a second left universal adapter sequence (740) having a binding sequence for a first sequencing primer or a second sequencing primer; (iii) a target sequence (710); (iv) a second right universal adapter sequence (750) having a binding sequence for a second sequencing primer or a first sequencing primer; and (v) a first right universal adapter sequence (730) having a binding sequence for a second surface primer. In certain embodiments, hybridization is performed under conditions suitable for hybridizing the single-stranded splint strand (800) to the library molecule (700), thereby looping the library molecule to produce a library-splint complex (900), such that the first region (810) of the single-stranded splint strand hybridizes to the binding sequence for the first surface primer (720), and the second region (820) of the single-stranded splint strand hybridizes to the binding sequence for the second surface primer (730). In certain embodiments, the library-splint complex (900) includes a gap between the 5' and 3' ends of the library molecule. In certain embodiments, the gap is enzymatically ligatable (e.g., see Figure 4 In some embodiments, the plurality of single-stranded nucleic acid library molecules (700) further comprises a first left index sequence (760) and / or a first right index sequence (770) (e.g., see Figure 4). In some embodiments, in a plurality of given library-splint complexes (900), the sequences of the first left index (760) and the first right index (770) are the same or different from each other. In some embodiments, the length of the first left index sequence (760) may be 3 to 20 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases) nucleotides. The length of the first right index sequence (770) may be 3 to 20 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases) nucleotides. In some embodiments, the first left index sequence (760) and / or the first right index sequence (770) may include a short random sequence (e.g., NNN). In some embodiments, the length of the short random sequence may be 3 to 20 (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 bases) nucleotides. A list of exemplary first left index sequences (760) and first right index sequences (770) is provided in Tables 1 to 2 of Figure 7. In some embodiments, the plurality of single-stranded nucleic acid library molecules (700) further comprises a first left unique identification sequence (780) and / or a first right unique identification sequence (790) that can be used for molecular labeling (e.g., see Figure 4 ).

[0251] In some embodiments, in the method, the first left universal adaptor sequence (720) in the library molecule comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1).

[0252] In some embodiments, in the method, the first left universal adaptor sequence (720) in the library molecule comprises the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 204).

[0253] In some embodiments, in the method, the second left universal adaptor sequence (740) in the library molecule comprises the sequence 5'-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3' (SEQ ID NO: 209).

[0254] In some embodiments, in the method, the second left universal adaptor sequence (740) in the library molecule comprises the sequence 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 207).

[0255] In some embodiments, in the method, the second left universal adaptor sequence (740) in the library molecule comprises the sequence 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 208).

[0256] In some embodiments, in the method, the second right universal adaptor sequence (750) in the library molecule comprises the sequence 5'-ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT-3' (SEQ ID NO: 212).

[0257] In some embodiments, in the method, the second right universal adaptor sequence (750) in the library molecule comprises the sequence 5'-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' (SEQ ID NO: 210).

[0258] In some embodiments, in the method, the second right universal adaptor sequence (750) in the library molecule comprises the sequence 5'-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO: 211).

[0259] In some embodiments, in the method, the first right universal adaptor sequence (730) in the library molecule comprises the sequence 5'-AGTCGTCGCAGCCTCACCTGATC-3' (SEQ ID NO: 2).

[0260] In some embodiments, in the method, the first right universal adaptor sequence (730) in the library molecule comprises the sequence 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 213).

[0261] In some embodiments, in the method, the first region (810) of the single-stranded splint strand comprises a universal binding sequence of a first left universal adapter sequence (720) of the library molecule, wherein the first region (810) comprises the sequence 5'-ACCCTGAAAGTACGTGCATTACATG-3' (SEQ ID NO:6).

[0262] In some embodiments, in the method, the second region (820) of the single-stranded splint strand comprises a universal binding sequence of the first right universal adaptor sequence (730) of the library molecule, wherein the second region (820) comprises the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO:7).

[0263] In some embodiments, in the method, the single-stranded splint chain (800) comprises the sequence 5'-ACCCTGAAAGTACGTGCATTACATGGATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 8). For example, see Figure 6 .

[0264] In some embodiments, in the method, the first region (810) of the single-stranded splint strand comprises a universal binding sequence for a first left universal adapter sequence (720) of the library molecule, wherein the first region (810) comprises the sequence 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO:4).

[0265] In some embodiments, in the method, the second region (820) of the single-stranded splint strand comprises a universal binding sequence of the first right universal adaptor sequence (730) of the library molecule, wherein the second region (820) comprises the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:5).

[0266] In some embodiments, in the method, the single-stranded splint strand (800) comprises the sequence 5'-TCGGTGGTCGCCGTATCATTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 214).

[0267] In some embodiments, any method for forming a plurality of library-splint complexes (900) described herein may further include at least one enzymatic reaction, including a phosphorylation reaction, a ligation reaction, and / or a nuclease exonuclease reaction. In some embodiments, the enzymatic reactions may be performed sequentially. In some embodiments, the enzymatic reactions may be performed substantially simultaneously. In some embodiments, the enzymatic reactions may be performed in a single reaction vessel. Alternatively, in some embodiments, a first enzymatic reaction may be performed in a first reaction vessel, then transferred to a second reaction vessel for performing a second enzymatic reaction, then transferred to a third reaction vessel for performing a third enzymatic reaction, etc.

[0268] In some embodiments, any method for forming a plurality of library-splint complexes (900) described herein further comprises performing separate and sequential phosphorylation and ligation reactions, the phosphorylation and ligation reactions being performed in separate reaction vessels. In some embodiments, the method for forming a plurality of library-splint complexes (900) further comprises step (c1): contacting a plurality of single-stranded splint chains (800) and a plurality of single-stranded nucleic acid library molecules (700) with T4 polynucleotide kinase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of a plurality of single-stranded splint chains (800) and / or a plurality of single-stranded nucleic acid library molecules (700); and transferring the phosphorylation reaction to a second reaction vessel. In some embodiments, the method for forming a plurality of library-splint complexes (900) further comprises a step (d1): contacting a plurality of phosphorylated single-stranded splint strands (800) and a plurality of phosphorylated single-stranded nucleic acid library molecules (700) with a ligase in a second reaction vessel under conditions suitable for enzymatically ligating the gaps, thereby generating a plurality of covalently closed circular library molecules (1000) each hybridized to the single-stranded splint strands (800). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0269] In some embodiments, any method for forming a plurality of library-splint complexes (900) described herein further comprises performing consecutive phosphorylation and ligation reactions, which are performed consecutively in the same reaction vessel. In some embodiments, the method for forming a plurality of library-splint complexes (900) further comprises step (c2): contacting a plurality of single-stranded splint chains (800) and a plurality of single-stranded nucleic acid library molecules (700) with T4 polynucleotide kinase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of a plurality of single-stranded splint chains (800) and a plurality of single-stranded nucleic acid library molecules (700). In some embodiments, the method for forming a plurality of library-splint complexes (900) further comprises step (d2): contacting a phosphorylated single-stranded splint chain (800) and a phosphorylated single-stranded nucleic acid library molecule (700) with a ligase in the same first reaction vessel under conditions suitable for enzymatically ligating a gap, thereby generating a plurality of covalently closed circular library molecules (1000) each hybridized to a single-stranded splint chain (800). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0270] In some embodiments, any of the methods for forming a plurality of library-splint complexes (900) described herein further comprises performing substantially simultaneous phosphorylation and ligation reactions, which are performed together in the same reaction vessel. In some embodiments, the method for forming a plurality of library-splint complexes (900) further comprises step (c3): contacting a plurality of single-stranded splint chains (800) and a plurality of single-stranded nucleic acid library molecules (700) with (i) T4 polynucleotide kinase and (ii) ligase in a first reaction vessel under conditions suitable for phosphorylating the 5' ends of a plurality of single-stranded splint chains (800) and a plurality of single-stranded nucleic acid library molecules (700), and the conditions are suitable for enzymatic ligation of gaps, thereby generating a plurality of covalently closed circular library molecules (1000) each hybridized to a single-stranded splint chain (800). In some embodiments, the ligase comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.

[0271] In some embodiments, any method for forming a plurality of library-splint complexes (900) described herein further comprises the following optional step: enzymatically removing a plurality of single-stranded splint chains (800) from a plurality of covalently closed circular library molecules (1000), comprising the step of contacting a plurality of covalently closed circular library molecules (1000) with at least one exonuclease to remove a plurality of single-stranded splint chains (800) and retain a plurality of covalently closed circular library molecules (1000). In some embodiments, the exonuclease reaction can be performed in the same reaction buffer used for the phosphorylation and / or ligation reaction, or in a different reaction buffer. In some embodiments, the exonuclease reaction can be performed in a third reaction vessel after the phosphorylation reaction (step c1, see above) is performed in a first reaction vessel and the ligation reaction (step d1, see above) is performed in a second reaction vessel. In some embodiments, the exonuclease reaction can be performed in a first reaction vessel after the phosphorylation reaction (step c2, see above) is performed in a first reaction vessel and the sequential ligation reaction (step d2, see above) is performed in a first reaction vessel. In some embodiments, the exonuclease reaction can be performed in the first reaction vessel after substantially simultaneous phosphorylation and ligation reactions (step c3, see above). In some embodiments, the at least one exonuclease comprises any combination of two or more of exonuclease I, thermolabile exonuclease I and / or T7 exonuclease.

[0272] In some embodiments, any of the above methods can be used to produce covalently closed circular library molecules (1000). In some embodiments, each covalently closed circular library molecule comprises a target sequence operably connected on both sides by at least one nucleic acid adapter sequence. In some embodiments, at least one covalently closed circular library molecule carries at least one deaminated nucleotide base. In some embodiments, the covalently closed circular library molecule can be treated with a reagent for removing deaminated bases. In some embodiments, the reagent for removing deaminated bases is included in a compound that produces a baseless site at a uracil base in a nucleic acid molecule. For example, but not limited to, DNA glycosylase (UDG) can produce a baseless site at a uracil base. In some embodiments, the reagent for removing deaminated bases is included in a compound that produces a gap at a baseless site in a nucleic acid chain. For example, but not limited to, an enzyme or a mixture of enzymes having a lyase activity that breaks the phosphodiester backbone at the 5' and 3' sides of the baseless site can be used to release abasic deoxyribose and generate a gap. In some embodiments, AP lyase, Endo IV endonuclease, FPG glycosylase / AP lyase, Endo VIII glycosylase / AP lyase, and combinations thereof can be used to remove abasic sites. In some embodiments, a mixture of uracil DNA glycosylase and DNA glycosylase-lyase endonuclease VIII can be used to achieve the generation of abasic sites and the removal of abasic sites to create gaps. For example, but not limited to, the generation of abasic sites and the removal of abasic sites to create gaps can be achieved using USER TM (From New England Biolabs TM Uracil-specific excision reagent enzyme) or thermolabile USER TM (Also from NewEngland Biolabs TM ) to carry out.

[0273] Rolling circle amplification method

[0274] Using circular library molecules generated via double-stranded splint chains

[0275] On the other hand, the present disclosure provides a method for performing a rolling circle amplification reaction on a covalently closed circular library molecule (1000). In some embodiments, the rolling circle amplification reaction can be performed after phosphorylation and ligation, or after ligation. In some embodiments, the rolling circle amplification reaction can be performed on a covalently closed circular library molecule (1000) hybridized with a single-stranded splint chain (800). In some embodiments, for example, the rolling circle amplification reaction can be performed after a nuclease exonuclease reaction, at which point the covalently closed circular library molecule (1000) is no longer hybridized with the single-stranded splint chain (800). In some embodiments, the covalently closed circular library molecule (1000) can be distributed on a support and then undergo a rolling circle amplification reaction. In some embodiments, the covalently closed circular library molecule (1000) can undergo a rolling circle amplification reaction in a solution and then be distributed on a support. In some embodiments, the rolling circle amplification reaction can employ the retained single-stranded splint strand (800) as an amplification primer, or the single-stranded splint strand (800) can be removed (eg, via exonuclease digestion) and replaced with a soluble amplification primer.

[0276] Rolling circle amplification on support

[0277] Using circular library molecules generated via double-stranded splint chains

[0278] In some embodiments, the method is used to perform a rolling circle amplification reaction on a plurality of covalently closed circular library molecules lacking a hybridized single-stranded splint strand (800). In some embodiments, each covalently closed circular library molecule (1000) in the plurality of covalently closed circular library molecules comprises a universal binding sequence for a first surface primer, and the method comprises step (a): distributing the plurality of covalently closed circular library molecules (1000) onto a support having a plurality of first surface primers immobilized on the support under conditions suitable for hybridizing each covalently closed circular library molecule (1000) to each immobilized first surface primer, thereby immobilizing the plurality of covalently closed circular library molecules (1000) to the support.

[0279] In some embodiments, in the method of performing a rolling circle amplification reaction, the plurality of first surface primers immobilized on the support comprises the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7).

[0280] In some embodiments, in the method of performing a rolling circle amplification reaction, the plurality of first surface primers immobilized on the support comprises the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 5).

[0281] In some embodiments, each first surface primer can hybridize to a covalently closed circular library molecule (1000) having a universal binding sequence for the first surface primer.

[0282] In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (b): contacting a plurality of fixed covalently closed circular library molecules (1000) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction on a support using a plurality of first surface primers as fixed amplification primers and using a plurality of covalently closed circular library molecules (1000) as template molecules, thereby generating a plurality of nucleic acid concatemer molecules fixed to the first surface primers. In some embodiments, the plurality of nucleotides comprises any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each fixed concatemer is covalently attached to each first surface primer. In some embodiments, each covalently closed circular library molecule (1000) in the plurality of covalently closed circular library molecules comprises a universal binding sequence for the first surface primer and the second surface primer (e.g., (720) and (730), respectively), such that the rolling circle amplification reaction generates a concatemer molecule having a plurality of tandem copies of the universal binding sequence for the first surface primer and the second surface primer. In certain embodiments, the support further comprises a plurality of second surface primers. In certain embodiments, the second fixed surface primer is used to fix at least a portion of the concatemer molecule to the support. In certain embodiments, the second fixed surface primer has an unextendable 3' end and cannot be used for amplification. In certain embodiments, the fixed concatemer can be subjected to sequencing reaction.

[0283] In some embodiments, the plurality of second surface primers immobilized on the support comprises the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1 or its complementary sequence).

[0284] In some embodiments, the plurality of second surface primers immobilized on the support comprises the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 204 or its complement).

[0285] In certain embodiments, each second surface primer can hybridize with a portion of a concatemer molecule having a universal binding sequence of a second surface primer. In certain embodiments, a fixed second surface primer is used to fix at least a portion of a concatemer molecule to a support. In certain embodiments, a fixed second surface primer has a non-extendable 3' end and cannot be used for amplification. In certain embodiments, a fixed concatemer can be subjected to sequencing reaction.

[0286] In some embodiments, in a method of performing a rolling circle amplification reaction, a plurality of covalently closed circular library molecules (1000) can be dispensed onto a support that is coated with one or more compounds to create a passivation layer on the support (e.g., Figure 8 ). In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, one or more types of surface primers, concatemer template molecules and / or polymerases can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface, which can improve the nucleic acid hybridization and amplification performance on the support. In some embodiments, the support may comprise one or more layers of covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating, which is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In some embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). In some embodiments, the hydrophilic polymer coating may comprise a branched PEG having at least 4 branches (e.g., 4, 5, 6, 7, 8, 9, 10 or more branches). In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured as a water contact angle, wherein the water contact angle does not exceed 45 degrees (e.g., does not exceed 5 degrees, does not exceed 10 degrees, does not exceed 15 degrees, does not exceed 20 degrees, does not exceed 25 degrees, does not exceed 30 degrees, does not exceed 35 degrees, does not exceed 40 degrees, or does not exceed 45 degrees). In some embodiments, the density of the covalently closed circular library molecules (1000) immobilized to the support or to the coating on the support is about 10 2 -10 6 (For example, about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of the covalently closed circular library molecules (600) immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7, 10 8 or 10 9 In some embodiments, the density of the covalently closed circular library molecules (600) immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 10 9 , 10 10 , 10 11 or 10 12 ) / mm 2 In some embodiments, a plurality of covalently closed circular library molecules (1000) are immobilized to a support or to a coating on a support at predetermined sites on the support (or a coating on a support). In some embodiments, a plurality of covalently closed circular library molecules (600) are immobilized to a support or to a coating on a support at random sites on the support (or a coating on a support).

[0287] In some embodiments, in a method for performing a rolling circle amplification reaction, the dispensing of step (a) (e.g., dispensing a plurality of covalently closed circular library molecules (1000) onto a support) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8; and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile accounting for 25-50% of the volume of the hybridization buffer; (ii) a second polar aprotic solvent comprising formamide accounting for 5-10% of the volume of the hybridization buffer; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) a crowding agent comprising polyethylene glycol (PEG) accounting for 5-35% of the volume of the hybridization buffer. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0288] In-solution rolling circle amplification using soluble amplification primers

[0289] Using circular library molecules generated via double-stranded splint chains

[0290] In some embodiments, the method is used to perform a rolling circle amplification reaction on a plurality of covalently closed circular library molecules (1000) lacking hybridized single-stranded splint strands (800), wherein each covalently closed circular library molecule (1000) in the plurality of covalently closed circular library molecules comprises a universal binding sequence for a forward amplification primer and a universal binding sequence for a first surface primer. In some embodiments, the method comprises: (a) hybridizing a plurality of covalently closed circular library molecules and a plurality of soluble forward amplification primers in a solution; and (b) performing a first rolling circle amplification reaction by contacting the plurality of covalently closed circular library molecules (1000) with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a rolling circle amplification reaction in a solution using a plurality of forward amplification primers and using a plurality of covalently closed circular library molecules (1000) as template molecules, thereby generating a plurality of nucleic acid concatemer molecules having portions that are still hybridized to the covalently closed circular library molecules (1000). In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (c): distributing the multiple concatemer molecules to a support on which multiple first surface primers are fixed under conditions suitable for hybridizing at least a portion of the concatemer molecules with multiple fixed first surface primers, thereby fixing the multiple concatemer molecules. In some embodiments, the multiple fixed concatemer molecules are still hybridized with their covalently closed circular library molecules (1000). In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (d): contacting the fixed multiple concatemer molecules with multiple strand displacement polymerases and multiple nucleotides under conditions suitable for performing a second rolling circle amplification reaction on a support using multiple covalently closed circular library molecules (1000) as template molecules, thereby extending multiple fixed nucleic acid concatemer molecules. In some embodiments, the first rolling circle amplification reaction and / or the second rolling circle amplification reaction can be performed with multiple nucleotides including any combination of two or more of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each fixed concatemer hybridizes with each first surface primer. In some embodiments, each covalently closed circular library molecule (1000) in the multiple covalently closed circular library molecules comprises a universal binding sequence of a first surface primer and a second surface primer (e.g., (720) and (730) respectively), such that a rolling circle amplification reaction in solution produces a concatemer molecule having multiple tandem copies of the universal binding sequence for the first surface primer and the second surface primer. In some embodiments, the support further comprises a plurality of second surface primers. In some embodiments, the fixed second surface primer is used to fix at least a portion of the concatemer molecule to the support. In some embodiments, the fixed second surface primer has a non-extendable 3' end and cannot be used for amplification. In some embodiments, the fixed concatemer can be subjected to a sequencing reaction.

[0291] In some embodiments, in the method of performing a rolling circle amplification reaction, the plurality of first surface primers immobilized on the support include the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7). In some embodiments, each first surface primer can hybridize to a covalently closed circular library molecule (1000) having a universal binding sequence of the first surface primer.

[0292] In some embodiments, in the method of performing a rolling circle amplification reaction, the plurality of first surface primers immobilized on the support include the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 5). In some embodiments, each first surface primer can hybridize to a covalently closed circular library molecule (1000) having a universal binding sequence of the first surface primer.

[0293] In some embodiments, the plurality of second surface primers immobilized on the support include the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1 or its complementary sequence). In some embodiments, each second surface primer can hybridize to a portion of a concatemer molecule having a universal binding sequence of the second surface primer.

[0294] In some embodiments, the plurality of second surface primers immobilized on the support include the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 204 or its complementary sequence). In some embodiments, each second surface primer can hybridize to a portion of a concatemer molecule having a universal binding sequence of the second surface primer.

[0295] In some embodiments, the fixed second surface primer is used to fix at least a portion of the concatemer molecule to a support. In some embodiments, the fixed second surface primer has a non-extendable 3' end and cannot be used for amplification. In some embodiments, the fixed concatemer can be subjected to a sequencing reaction.

[0296] In some embodiments, the plurality of concatemer molecules of step (c) can be dispensed onto a support that is coated with one or more compounds to produce a passivation layer on the support (e.g., Figure 8). In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, one or more types of surface primers, concatemer template molecules and / or polymerases can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface, which can improve the nucleic acid hybridization and amplification performance on the support. In some embodiments, the support may comprise one or more layers of covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating, which is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In some embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). In some embodiments, the hydrophilic polymer coating may comprise a branched PEG having at least 4 branches (e.g., 4, 5, 6, 7, 8, 9, 10 or more branches). In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured as a water contact angle, wherein the water contact angle does not exceed 45 degrees (e.g., not more than 5 degrees, not more than 10 degrees, not more than 15 degrees, not more than 20 degrees, not more than 25 degrees, not more than 30 degrees, not more than 35 degrees, not more than 40 degrees, or not more than 45 degrees). In some embodiments, the density of concatemer molecules immobilized to the support or to the coating on the support is about (e.g., about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7 , 10 8 or 10 9 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 10 9 , 10 10 , 1011 or 10 12 ) / mm 2 In some embodiments, a plurality of concatemer molecules are immobilized to a support or to a coating on a support at predetermined sites on the support (or a coating on a support). In some embodiments, a plurality of concatemer molecules are immobilized to a coating on a support at random sites on the support (or a coating on a support).

[0297] In some embodiments, the partitioning of step (c) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 (e.g., less than 10, or about 10, 15, 20, 30, or 40) and having a polarity index of 4-9 (e.g., 4, 5, 6, 7, 8, or 9); (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 (e.g., less than 10, 10, 15, 20, 30, 40, 50, 75, 100, 105, 105, 110, or 115) and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8 (e.g., 4, 5, 6, 7, or 8); and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% (e.g., 25%, 30%, 35%, 40%, 45% or 50%) of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% (e.g., 5%, 6%, 7%, 8%, 9% or 10%) of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5 (e.g., about 5.0, 5.5, 6.0 or 6.5); and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% (e.g., 5%, 10%, 15%, 20%, 25%, 30% or 35%) of the hybridization buffer volume. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0298] In-solution rolling circle amplification using single-stranded splint strands

[0299] Using circular library molecules generated via double-stranded splint chains

[0300] In some embodiments, a method for performing a rolling circle amplification reaction on a plurality of covalently closed circular library molecules hybridized to a single-stranded splint strand (800), wherein each covalently closed circular library molecule (1000) in the plurality of covalently closed circular library molecules comprises a universal binding sequence for a first surface primer, the method comprising: (a) contacting the plurality of covalently closed circular library molecules (1000) hybridized to the single-stranded splint strand (800) with a plurality of strand displacement polymerases and a plurality of nucleotides in a solution under conditions suitable for performing a first rolling circle amplification reaction using the single-stranded splint strand (800) as an amplification primer, thereby generating a plurality of concatemer molecules (e.g., see Figures 4 to 5 ).

[0301] In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (b): distributing the plurality of concatemer molecules hybridized with the covalently closed circular library molecules (1000) to a support on which the plurality of first surface primers are immobilized, under conditions suitable for hybridizing at least a portion of the concatemer with the plurality of immobilized first surface primers, thereby immobilizing the plurality of concatemer molecules. In some embodiments, the plurality of immobilized concatemer molecules remain hybridized with the covalently closed circular library molecules (1000).

[0302] In some embodiments, the method for performing a rolling circle amplification reaction further comprises step (c): contacting a plurality of fixed concatemer molecules with a plurality of strand displacement polymerases and a plurality of nucleotides under conditions suitable for performing a second rolling circle amplification reaction on a support using a plurality of covalently closed circular library molecules (1000) as template molecules, thereby extending the plurality of fixed nucleic acid concatemer molecules.

[0303] In some embodiments, the first rolling circle amplification reaction and / or the second rolling circle amplification reaction can be carried out with multiple nucleotides including two or more of any combination of dATP, dGTP, dCTP, dTTP and / or dUTP. In some embodiments, each fixed concatemer hybridizes with each first surface primer. In some embodiments, each covalently closed circular library molecule (1000) in each of the multiple covalently closed circular library molecules comprises a universal binding sequence of a first surface primer and a second surface primer (e.g., respectively (720) and (730)), so that the rolling circle amplification reaction in the solution produces a concatemer molecule with multiple tandem copies of the universal binding sequence for the first surface primer and the second surface primer. In some embodiments, the support further comprises multiple second surface primers. In some embodiments, the fixed second surface primer is used to fix at least a portion of the concatemer molecule to the support. In some embodiments, the fixed second surface primer has an unextendable 3' end and cannot be used for amplification. In some embodiments, the fixed concatemer can be subjected to sequencing reaction.

[0304] In some embodiments, in the method of performing a rolling circle amplification reaction, the plurality of first surface primers immobilized on the support include the sequence 5'-GATCAGGTGAGGCTGCGACGACT-3' (SEQ ID NO: 7). In some embodiments, each first surface primer can hybridize to a covalently closed circular library molecule (1000) having a universal binding sequence of the first surface primer.

[0305] In some embodiments, in the method of performing a rolling circle amplification reaction, the plurality of first surface primers immobilized on the support include the sequence 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 5). In some embodiments, each first surface primer can hybridize to a covalently closed circular library molecule (1000) having a universal binding sequence of the first surface primer.

[0306] In some embodiments, the plurality of second surface primers immobilized on the support include the sequence 5'-CATGTAATGCACGTACTTTCAGGGT-3' (SEQ ID NO: 1 or its complementary sequence). In some embodiments, each second surface primer can hybridize to a portion of a concatemer molecule having a universal binding sequence of the second surface primer.

[0307] In some embodiments, the plurality of second surface primers immobilized on the support include the sequence 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 204 or its complement). A single second surface primer can hybridize to a portion of a concatemer molecule having a universal binding sequence of a second surface primer.

[0308] In some embodiments, the fixed second surface primer is used to fix at least a portion of the concatemer molecule to a support. In some embodiments, the fixed second surface primer has a non-extendable 3' end and cannot be used for amplification. In some embodiments, the fixed concatemer can be subjected to a sequencing reaction.

[0309] In some embodiments, the plurality of concatemer molecules of step (b) can be dispensed onto a support that is coated with one or more compounds to produce a passivation layer on the support (e.g., Figure 8). In some embodiments, the passivation layer forms a porous or semi-porous layer. In some embodiments, surface primers, concatemer template molecules and / or polymerases can be attached to the passivation layer to be fixed to the support. In some embodiments, the support comprises a low non-specific binding surface, which can improve the nucleic acid hybridization and amplification performance on the support. In some embodiments, the support may comprise one or more layers of covalently or non-covalently attached low binding chemical modification layers, such as silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used to fix multiple nucleic acid concatemer molecules to the support. In some embodiments, the support may comprise a functionalized polymer coating, which is covalently bound to at least a portion of the support via chemical groups on the support, primers grafted to the functionalized polymer coating, and a water-soluble protective coating on the primers and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM). In some embodiments, the support comprises a surface coating having at least one layer of a hydrophilic polymer coating and at least one layer of a plurality of oligonucleotides. In some embodiments, the hydrophilic polymer coating may comprise polyethylene glycol (PEG). In some embodiments, the hydrophilic polymer coating may comprise a branched PEG having at least 4 branches (e.g., 4, 5, 6, 7, 8, 9, 10 or more branches). In some embodiments, the low nonspecific binding coating has a degree of hydrophilicity that can be measured as a water contact angle, wherein the water contact angle does not exceed 45 degrees (e.g., does not exceed 5 degrees, does not exceed 10 degrees, does not exceed 15 degrees, does not exceed 20 degrees, does not exceed 25 degrees, does not exceed 30 degrees, does not exceed 35 degrees, does not exceed 40 degrees, or does not exceed 45 degrees). In some embodiments, the density of concatemer molecules immobilized to the support or to the coating on the support is about 10 2 -10 6 / mm 2 (For example, about 10 2 , 10 3 , 10 4 , 10 5 or 10 6 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 6 -10 9 / mm 2 (For example, about 10 6 , 10 7 , 10 8 or 10 9 In some embodiments, the density of concatemer molecules immobilized to the support or to a coating on the support is about 10 9 -10 12 (For example, about 109 , 10 10 , 10 11 or 10 12 ) / mm 2 In some embodiments, a plurality of concatemer molecules are immobilized to a support or to a coating on a support at predetermined sites on the support (or a coating on a support). In some embodiments, a plurality of concatemer molecules are immobilized to a coating on a support at random sites on the support (or a coating on a support).

[0310] In some embodiments, the partitioning of step (b) can be performed in the presence of a high efficiency hybridization buffer comprising: (i) a first polar aprotic solvent having a dielectric constant of no greater than 40 (e.g., less than 10, or about 10, 15, 20, 30, or 40) and having a polarity index of 4-9 (e.g., 4, 5, 6, 7, 8, or 9); (ii) a second polar aprotic solvent having a dielectric constant of no greater than 115 (e.g., less than 10, 10, 15, 20, 30, 40, 50, 75, 100, 105, 105, 110, or 115) and present in the hybridization buffer formulation in an amount effective to denature double-stranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in the range of about 4-8 (e.g., 4, 5, 6, 7, or 8); and (iv) a crowding agent in an amount sufficient to enhance or promote molecular crowding. In some embodiments, the high efficiency hybridization buffer comprises: (i) a first polar aprotic solvent comprising acetonitrile at 25-50% (e.g., 25%, 30%, 35%, 40%, 45% or 50%) of the hybridization buffer volume; (ii) a second polar aprotic solvent comprising formamide at 5-10% (e.g., 5%, 6%, 7%, 8%, 9% or 10%) of the hybridization buffer volume; (iii) a pH buffer system comprising 2-(N-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5 (e.g., about 5.0, 5.5, 6.0 or 6.5); and (iv) a crowding agent comprising polyethylene glycol (PEG) at 5-35% (e.g., 5%, 10%, 15%, 20%, 25%, 30% or 35%) of the hybridization buffer volume. In some embodiments, the high efficiency hybridization buffer further comprises betaine.

[0311] Methods used for sequencing

[0312] On the other hand, the present disclosure provides a method for sequencing any fixed concatemer molecule described herein. In some embodiments, any method for performing a rolling circle amplification reaction described herein can be used to produce a plurality of concatemer molecules fixed to a support, and the fixed concatemer molecules can be subjected to a sequencing reaction. In some embodiments, the sequencing reaction uses a detectably labeled nucleotide analog. In some embodiments, the sequencing reaction uses a two-stage sequencing reaction, including combining a detectably labeled multivalent molecule and incorporating a nucleotide analog. The terms concatemer molecule and template molecule are used interchangeably herein.

[0313] In some embodiments, using at least one reagent to remove deaminated nucleotide bases from linear library molecules and / or circular library molecules can improve the quality of sequencing data, for example, by reducing the level of low-quality T base calls or A base calls.

[0314] In some embodiments, fixed concatemers can self-collapse into compact nucleic acid nanoballs. In some embodiments, one or more compacting oligonucleotides can be included during the RCA reaction to further compact the size and / or shape of the nanoballs. In some embodiments, the increase in the number of tandem repeat units in a given concatemer increases the number of sites for the number of sites for hybridization with multiple sequencing primers (e.g., sequencing primers with universal sequences) around the concatemer, which are used as multiple starting sites for sequencing reactions catalyzed by polymerase. In some embodiments, when sequencing reactions employ detectably labeled nucleotides and / or detectably labeled multivalent molecules (e.g., with nucleotide units), the signal emitted by the nucleotides or nucleotide units participating in the parallel sequencing reactions along the concatemers produces an increased signal intensity for each concatemer. In certain embodiments, multiple parts of a given concatemer can be sequenced simultaneously. In addition, in some embodiments, multiple binding complexes can be formed along specific concatemer molecules, and each binding complex comprises a sequencing polymerase bound to a multivalent molecule. In certain embodiments, multiple binding complexes remain stable and do not dissociate, resulting in an increase in duration, for example, which increases signal intensity and reduces imaging time.

[0315] Methods for sequencing using nucleotide analogs

[0316] On the other hand, the present disclosure provides a method for sequencing, the method comprising the step (a): contacting a sequencing polymerase with (i) a nucleic acid concatemer molecule and (ii) a nucleic acid primer, wherein the contact is performed under conditions suitable for binding the sequencing polymerase to the nucleic acid concatemer molecule (the nucleic acid concatemer molecule hybridizes with the nucleic acid primer), wherein the nucleic acid concatemer molecule hybridized with the nucleic acid primer forms a nucleic acid duplex. In some embodiments, the sequencing polymerase comprises a recombinant mutant sequencing polymerase. In some embodiments, the primer comprises a 3' extendable end.

[0317] In some embodiments, the method for sequencing further comprises step (b): contacting the sequencing polymerase with the plurality of nucleotides under conditions suitable for binding at least one nucleotide to a sequencing polymerase that binds to a nucleic acid duplex and suitable for polymerase-catalyzed incorporation of the nucleotides. In some embodiments, the sequencing polymerase is contacted with the plurality of nucleotides in the presence of at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, the plurality of nucleotides comprises at least one nucleotide analog having a chain termination moiety at the 2' or 3' position of the sugar. In some embodiments, the plurality of nucleotides comprises at least one nucleotide lacking a chain termination moiety.

[0318] In some embodiments, the method for sequencing further comprises step (c): incorporating at least one nucleotide into the 3' end of the extendable primer under conditions suitable for incorporating at least one nucleotide. In some embodiments, the conditions suitable for nucleotide binding polymerase and incorporating nucleotides can be the same or different. In some embodiments, the conditions suitable for incorporating nucleotides include adding at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, at least one nucleotide binds to the sequencing polymerase and is incorporated into the 3' end of the extendable primer. In some embodiments, incorporating the nucleotide into the 3' end of the primer in step (c) comprises a primer extension reaction.

[0319] In some embodiments, the method for sequencing further comprises step (d): repeating at least one nucleotide incorporating into the 3' end of the extendable primer in step (c) at least once. In some embodiments, the plurality of nucleotides comprises a plurality of nucleotides labeled with a detectable reporter gene moiety. In some embodiments, the detectable reporter gene moiety comprises a fluorophore. In some embodiments, the fluorophore is attached to a nucleotide base. In some embodiments, the fluorophore is attached to a nucleotide base with a joint that can be cleaved / removed from a base. In some embodiments, at least one nucleotide in the nucleotides in the plurality of nucleotides is not labeled with a detectable reporter gene moiety. In some embodiments, a specific detectable reporter gene moiety (e.g., a fluorophore) attached to a nucleotide may correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP or dUTP) to allow detection and identification of a nucleotide base. In some embodiments, the method further comprises: detecting the at least one incorporated nucleotide at step (c) and / or (d). In some embodiments, the method further comprises: identifying the at least one incorporated nucleotide at step (c) and / or (d). In some embodiments, the sequence of the nucleic acid concatemer molecule can be determined by detecting and identifying nucleotides bound to a sequencing polymerase, thereby determining the sequence of the concatemer molecule. In some embodiments, the sequence of the nucleic acid concatemer molecule can be determined by detecting and identifying nucleotides incorporated into the 3' end of the primer, thereby determining the sequence of the concatemer molecule.

[0320] In some embodiments, in a method for sequencing, a plurality of sequencing polymerases bound to a nucleic acid duplex comprises a plurality of composite polymerases having at least a first composite polymerase and a second composite polymerase, wherein (a) the first composite polymerase comprises a first sequencing polymerase bound to a first nucleic acid duplex, wherein the first nucleic acid duplex comprises a first nucleic acid template sequence hybridized to a first nucleic acid primer, (b) the second composite polymerase comprises a second sequencing polymerase bound to a second nucleic acid duplex, wherein the second nucleic acid duplex comprises a second nucleic acid template sequence hybridized to a second nucleic acid primer, (c) the first nucleic acid template sequence and the second nucleic acid template sequence comprise the same or different sequences, (d) the first nucleic acid concatemer and the second nucleic acid concatemer are clonally amplified, (e) the first primer and the second primer comprise an extendable 3' end or a non-extendable 3' end, and (f) the plurality of composite polymerases are immobilized to a support. In some embodiments, the plurality of composite polymerases immobilized to the support are immobilized at a density of 10 2 -10 15 (For example, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 109 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 or 10 15 ) complex polymerase / mm 2 .

[0321] Two-stage method for sequencing nucleic acids

[0322] In another aspect, the present disclosure provides a two-stage method for sequencing nucleic acid molecules. In some embodiments, the first stage generally includes combining a multivalent molecule with a complex polymerase to form a multivalent-complex polymerase, and detecting the multivalent-complex polymerase.

[0323] In some embodiments, the first stage comprises the step (a): contacting a plurality of first sequencing polymerases with (i) a plurality of nucleic acid concatemer molecules and (ii) a plurality of nucleic acid primers, wherein the contacting is performed under conditions suitable for binding the plurality of first sequencing polymerases to the plurality of nucleic acid concatemer molecules and the plurality of nucleic acid primers, thereby forming a plurality of first composite polymerases, each first composite polymerase comprising a first sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises a nucleic acid concatemer molecule hybridized to a nucleic acid primer. In some embodiments, the first polymerase comprises a recombinant mutant sequencing polymerase.

[0324] In some embodiments, in a method for sequencing concatemer molecules, the primer comprises a 3' extendable end or a 3' non-extendable end. In some embodiments, a plurality of nucleic acid concatemer molecules comprise amplified template molecules (e.g., clonally amplified template molecules). In some embodiments, a plurality of nucleic acid concatemer molecules comprise a copy of a target sequence of interest. In some embodiments, a plurality of nucleic acid molecules comprise two or more tandem copies of a target sequence of interest (e.g., concatemers). In some embodiments, the nucleic acid concatemer molecules in a plurality of nucleic acid concatemer molecules comprise the same target sequence of interest or different target sequences of interest. In some embodiments, a plurality of nucleic acid concatemer molecules and / or a plurality of nucleic acid primers are in solution or fixed to a support. In some embodiments, when a plurality of nucleic acid concatemer molecules and / or a plurality of nucleic acid primers are fixed to a support, binding to a first sequencing polymerase produces a plurality of fixed first composite polymerases. In some embodiments, a plurality of nucleic acid concatemer molecules and / or nucleic acid primers are fixed to 10 on a support. 2 -10 15 (For example, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 108 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 or 10 15 ) different sites. In some embodiments, the combination of multiple concatemer molecules and nucleic acid primers with multiple first sequencing polymerases produces 10 2 -10 15 (For example, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 or 10 15 ) at different sites on the support. In some embodiments, the plurality of immobilized first composite polymerases on the support are fixed to predetermined or random sites on the support. In some embodiments, the plurality of immobilized first composite polymerases are in fluid communication with each other to allow a solution of reagents (e.g., an enzyme including a sequencing polymerase, a multivalent molecule, a nucleotide, and / or a divalent cation) to flow onto the support, such that the plurality of immobilized composite polymerases on the support react with the solution of reagents in a massively parallel manner.

[0325] In some embodiments, the method for sequencing further comprises step (b): contacting the plurality of first complex polymerases with the plurality of multivalent molecules to form a plurality of multivalent-complex polymerases (e.g., binding complexes). In some embodiments, each multivalent molecule in the plurality of multivalent molecules comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide (e.g., a nucleotide unit) (e.g., Figures 9 to 13 In some embodiments, the contacting of step (b) is performed under conditions suitable for binding the complementary nucleotide units of the multivalent molecule to at least two of the plurality of first composite polymerases, thereby forming a plurality of multivalent composite polymerases. In some embodiments, the conditions are suitable for inhibiting polymerase-catalyzed incorporation of the complementary nucleotide units into primers of the plurality of multivalent-complex polymerases. In some embodiments, the plurality of multivalent molecules comprises at least one having a plurality of nucleotide arms (e.g., Figures 9 to 13), each nucleotide arm is attached with a nucleotide analog (e.g., a nucleotide analog unit), wherein the nucleotide analog includes a chain termination portion located at the 2' and / or 3' position of the sugar. In some embodiments, the plurality of multivalent molecules includes at least one multivalent molecule comprising a plurality of nucleotide arms, each nucleotide arm being attached with a nucleotide unit lacking a chain termination portion. In some embodiments, at least one of the multivalent molecules in the plurality of multivalent molecules is labeled with a detectable reporter gene portion. In some embodiments, any portion of the multivalent molecule may be labeled, including the core, nucleotide arms, or nucleobases. In some embodiments, the detectable reporter gene portion includes a fluorophore. In some embodiments, the contacting of step (b) is performed in the presence of at least one non-catalytic cation comprising strontium, barium, and / or calcium.

[0326] In some embodiments, the method for sequencing further comprises step (c): detecting a plurality of multivalent-complex polymerases. In some embodiments, the detection comprises detecting a multivalent molecule bound to a complex polymerase, wherein the complementary nucleotide unit of the multivalent molecule is bound to a primer, but the incorporation of the complementary nucleotide unit is inhibited. In some embodiments, the multivalent molecule is labeled with a detectable reporter moiety to allow detection. In some embodiments, the labeled multivalent molecule comprises a fluorophore attached to a core, a linker, and / or a nucleotide unit of the multivalent molecule.

[0327] In some embodiments, the method for sequencing further comprises step (d): identifying the bases of complementary nucleotide units bound to the plurality of first composite polymerases, thereby determining the sequence of the concatemer molecule. In some embodiments, the multivalent molecule is labeled with a detectable reporter moiety corresponding to a specific nucleotide unit attached to the nucleotide arm to allow identification of complementary nucleotide units (e.g., nucleotide bases adenine, guanine, cytosine, thymine, or uracil) bound to the plurality of first composite polymerases.

[0328] In some embodiments, the second stage of the two-stage sequencing method generally comprises nucleotide incorporation. In some embodiments, the method for sequencing further comprises step (e): dissociating the plurality of multivalent-complex polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes.

[0329] In some embodiments, the method for sequencing further comprises step (f): contacting the plurality of retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contact is performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second composite polymerases, each second composite polymerase comprising a second sequencing polymerase bound to a nucleic acid duplex. In some embodiments, the second sequencing polymerase comprises a recombinant mutant sequencing polymerase.

[0330] In some embodiments, the plurality of first sequencing polymerases of step (a) have an amino acid sequence that is 100% identical to the amino acid sequence of the plurality of second sequencing polymerases of step (f). In some embodiments, the plurality of first sequencing polymerases of step (a) have an amino acid sequence that is different from the amino acid sequence of the plurality of second sequencing polymerases of step (f).

[0331] In some embodiments, the method for sequencing further comprises step (g): contacting a plurality of second composite polymerases with a plurality of nucleotides, wherein the contact is carried out under conditions suitable for combining complementary nucleotides from a plurality of nucleotides with at least two of the composite polymerases, thereby forming a plurality of nucleotide-composite polymerases. In some embodiments, the contact of step (g) is carried out under conditions suitable for promoting the incorporation of the complementary nucleotides of the binding into the primer of the nucleotide composite-polymerase through polymerase catalysis, thereby forming a plurality of nucleotide-composite polymerases. In some embodiments, the incorporation of nucleotides into the 3' end of the primer in step (g) includes a primer extension reaction. In some embodiments, the contact of step (g) is carried out in the presence of at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, the contact of step (g) is carried out in the presence of magnesium and / or manganese. In some embodiments, the plurality of nucleotides include natural nucleotides (e.g., non-analog nucleotides) or nucleotide analogs. In some embodiments, the plurality of nucleotides include removable or non-removable 2' and / or 3' chain termination parts. In some embodiments, the plurality of nucleotides include a plurality of nucleotides labeled with a detectable reporter gene portion. In some embodiments, the detectable reporter gene portion includes a fluorophore. In some embodiments, the fluorophore is attached to a nucleotide base. In some embodiments, the fluorophore is attached to the nucleotide base with a linker that is cleavable / removable from the base or that is not removable from the base. In some embodiments, at least one of the nucleotides in the plurality of nucleotides is not labeled with a detectable reporter moiety. In some embodiments, the specific detectable reporter moiety (e.g., a fluorophore) attached to the nucleotide can correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) to allow detection and identification of the nucleotide base.

[0332] In some embodiments, the method for sequencing further comprises step (h): detecting complementary nucleotides in the primers incorporated into the nucleotide-complex polymerase. In some embodiments, the plurality of nucleotides are labeled with a detectable reporter moiety to allow detection. In some embodiments, in the method for sequencing concatemer molecules, the detection step is omitted.

[0333] In some embodiments, the method for sequencing further comprises step (i): identifying the base of the complementary nucleotide in the primer incorporated into the nucleotide-complex polymerase. In some embodiments, the complementary nucleotide identified and incorporated in step (i) can be used to confirm the identity of the complementary nucleotide of the multivalent molecule bound to the plurality of first complex polymerases in step (d). In some embodiments, the identification of step (i) can be used to determine the sequence of the nucleic acid concatemer molecule. In some embodiments, in the method for sequencing the concatemer molecule, the identification step is omitted.

[0334] In some embodiments, the method for sequencing further comprises step (j): removing the chain terminating moiety from the incorporated nucleotides when step (g) is performed by contacting a plurality of second composite polymerases with a plurality of nucleotides comprising at least one nucleotide having a 2' and / or 3' chain terminating moiety.

[0335] In some embodiments, the method for sequencing further comprises step (k): repeating steps (a)-(j) at least once (e.g., once, twice, three times, four times, five times, or more than six times). In some embodiments, the sequence of the nucleic acid concatemer molecule can be determined by detecting and identifying the multivalent molecule that binds to the sequencing polymerase but is not incorporated into the 3' end of the primer in steps (c) and (d). In some embodiments, the sequence of the nucleic acid concatemer molecule can be determined (or confirmed) by detecting and identifying the nucleotide that is incorporated into the 3' end of the primer in steps (h) and (i).

[0336] In some embodiments, in any method for sequencing a nucleic acid molecule, a plurality of first complex polymerases are bound to a plurality of multivalent molecules to form at least one affinity complex, the method comprising the following steps: (a) binding a first nucleic acid primer, a first sequencing polymerase, and a first multivalent molecule to a first portion of a concatemer template molecule, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule is bound to the first sequencing polymerase. (b) binding a second nucleic acid primer, a second sequencing polymerase, and a first multivalent molecule to a second portion of the same concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule is bound to the second sequencing polymerase, wherein the first binding complex and the second binding complex of the same multivalent molecule form an affinity complex. In some embodiments, the first sequencing polymerase comprises any wild-type or mutant polymerase described herein. In some embodiments, the second sequencing polymerase comprises any wild-type or mutant polymerase described herein. In some embodiments, the concatemer template molecule comprises a tandem repeat sequence of a sequence of interest and at least one universal sequencing primer binding site. In some embodiments, the first nucleic acid primer and the second nucleic acid primer may bind to the sequencing primer binding site along the concatemer template molecule. Exemplary multivalent molecules are shown in Figures 9 to 13 middle.

[0337] In some embodiments, in any method for sequencing a nucleic acid molecule, wherein the method comprises combining a plurality of first composite polymerases with a plurality of multivalent molecules to form at least one affinity complex, the method comprises the following steps: (a) contacting a plurality of sequencing polymerases and a plurality of nucleic acid primers with different portions of a concatemer nucleic acid concatemer molecule to form at least a first and a second composite polymerase on the same concatemer template molecule; (b) contacting the plurality of multivalent molecules with at least a first composite polymerase and a second composite polymerase on the same concatemer template molecule under conditions suitable for combining a single multivalent molecule from the plurality of multivalent molecules with the first composite polymerase and the second composite polymerase, wherein at least a first nucleotide unit of the single multivalent molecule is bound to the first composite polymerase, the first composite polymerase comprising a first primer that hybridizes to a first portion of the concatemer template molecule, thereby forming a first binding complex (e.g., a first triplet). complex), and wherein at least a second nucleotide unit of the single multivalent molecule is bound to a second composite polymerase, the second composite polymerase comprising a second primer that hybridizes to a second portion of the concatemer template molecule, thereby forming a second binding complex (e.g., a second ternary complex), wherein the contacting is performed under conditions suitable for inhibiting the polymerase-catalyzed incorporation of the bound first and second nucleotide units into the first and second binding complexes, and wherein the first and second binding complexes bound to the same multivalent molecule form an affinity complex; and (c) detecting the first and second binding complexes on the same concatemer template molecule, and (d) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule. In some embodiments, the plurality of sequencing polymerases comprises any wild-type or mutant sequencing polymerase described herein. The concatemer template molecule comprises a tandem repeat sequence of a target sequence and at least one universal sequencing primer binding site. In some embodiments, a plurality of nucleic acid primers may bind to the sequencing primer binding sites along the concatemer template molecule. Exemplary multivalent molecules are shown in Figures 9 to 13 middle.

[0338] Combined sequencing

[0339] On the other hand, the present disclosure provides a method for sequencing any fixed concatemer molecule described herein. In some embodiments, the sequencing method includes a combined sequencing (SBB) procedure using unlabeled chain termination nucleotides. In some embodiments, the combined sequencing (SBB) method includes step (a) sequentially contacting the primer template nucleic acid with at least two separate mixtures under ternary complex stable conditions, wherein the at least two separate mixtures each contain a polymerase and a nucleotide. In some embodiments, sequential contact causes the template nucleic acid triggered to contact the nucleotide homologues for the first base type, the second base type and the third base type in the template under ternary complex stable conditions. In some embodiments, SBB further includes (b) checking at least two separate mixtures to determine whether a ternary complex is formed. In some embodiments, SBB further includes (c) identifying the next correct nucleotide of the template nucleic acid molecule triggered, wherein if a ternary complex is detected in step (b), the next correct nucleotide is identified as a homologue of the first base type, the second base type or the third base type. In certain embodiments, if there is no ternary complex in step (b), the next correct nucleotide is calculated as a nucleotide homologue of the fourth base type. In some embodiments, SBB further comprises (d) adding the next correct nucleotide to the primer of the primed template nucleic acid after step (b), thereby generating an extended primer. In some embodiments, SBB further comprises (e) repeating steps (a) to (d) at least once for the primed template nucleic acid comprising the extended primer. In certain embodiments, each of steps (a), (b), (c), (d) and (e) is performed, for example, sequentially. Exemplary combined sequencing methods are described in U.S. Pat. Nos. 10,246,744 and 10,731,141 (the contents of which are incorporated herein by reference in their entirety).

[0340] Sequencing polymerase

[0341] The present disclosure provides methods for sequencing nucleic acid molecules, wherein any sequencing method described herein employs at least one type of sequencing polymerase and a plurality of nucleotides, or employs at least one type of sequencing polymerase and a plurality of nucleotides and a plurality of multivalent molecules. In some embodiments, the sequencing polymerase is capable of incorporating complementary nucleotides relative to the nucleotides in the concatemer template molecule. In some embodiments, the sequencing polymerase is capable of binding to complementary nucleotide units of multivalent molecules relative to the nucleotides in the concatemer template molecule. In some embodiments, a plurality of sequencing polymerases comprises a recombinant mutant polymerase.

[0342] Examples of suitable polymerases for sequencing with nucleotides and / or multivalent molecules include, but are not limited to: Klenow DNA polymerase; Thermus aquaticus DNA polymerase I (Taq polymerase); KlenTaq polymerase; Candidatus altiarchaeales archaea; Candidatus Hadarchaeum Yellowstonense; Hadesarchaea archaea; Euryarchaeota archaea; Thermoplasma archaea; Thermococcus litoralis polymerases, bacteriophage T7 DNA polymerase; human α, δ, and ε DNA polymerases; phage polymerases, such as T4, RB69, and phi29 phage DNA polymerases; Pyrococcus furiosus DNA polymerase (Pfu polymerase); Bacillus subtilis DNA polymerase III; Escherichia coli DNA polymerase III α and ε; 9 degree N polymerase; reverse transcriptases, such as HIV M-type or O-type reverse transcriptase; avian myeloblastosis virus reverse transcriptase; Moloney murine leukemia virus (MMLV) reverse transcriptase; or telomerase. Additional non-limiting examples of DNA polymerases include those from various Archaea (such as Aeropyrum, Archaeglobus, Desulfurococcus, Pyrococcus, Pyrococcus, Pyrolobus, Thermomyces, Thermophilus, Stetella, Sulfolobus, Thermococcus, and Volcanobacterium, etc. or variants thereof), including such polymerases as are known in the art, such as 9 degrees N, Pfu, KOD, Pfx, Tgo and RB69 polymerases.

[0343] Nucleotides

[0344] The present disclosure provides a method for sequencing nucleic acid molecules using nucleotides, wherein at least one nucleotide in a plurality of nucleotides comprises a base, a sugar and at least one phosphate group. In certain embodiments, at least one nucleotide in a plurality of nucleotides comprises an aromatic base, a pentose (e.g., ribose or deoxyribose) and one or more phosphate groups (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphate groups). The plurality of nucleotides may include at least one type of nucleotide selected from the group consisting of the following items: dATP, dGTP, dCTP, dTTP and dUTP. The plurality of nucleotides include a mixture of any combination of two or more types of nucleotides selected from the group consisting of the following items: dATP, dGTP, dCTP, dTTP, dUTP and combinations thereof. In certain embodiments, at least one nucleotide in the plurality of nucleotides is not a nucleotide analog. In certain embodiments, at least one nucleotide in the plurality of nucleotides comprises a nucleotide analog.

[0345] In some embodiments, in any method described herein for sequencing nucleic acid molecules, at least one of the multiple nucleotides comprises a chain of one, two or three phosphorus atoms, wherein the chain is typically attached to the 5' carbon of the sugar moiety via an ester bond or a phosphoramide bond. In some embodiments, at least one of the multiple nucleotides is an analog with a phosphorus chain, wherein the phosphorus atom is linked together with an intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atom in the chain comprises a substituted side group, including O, S or BH3. In some embodiments, the chain comprises a phosphate group substituted with an analog, including phosphoramide, phosphorothioate, phosphorodithioate and O-methylphosphoramidite groups.

[0346] In some embodiments, in any method described herein for sequencing nucleic acid molecules, at least one nucleotide in a plurality of nucleotides includes a terminator nucleotide analog having a chain termination portion (e.g., a blocking portion) at a sugar 2' position, at a sugar 3' position, or at a sugar 2' and 3' position. In some embodiments, the chain termination portion can inhibit the polymerase-catalyzed incorporation of subsequent nucleotide units or free nucleotides in the nascent chain during the primer extension reaction. In some embodiments, the chain termination portion is attached to the 3' sugar hydroxyl position, wherein the sugar includes a ribose or deoxyribose portion. In some embodiments, the chain termination portion can be removed / cleaved from the 3' sugar hydroxyl position to generate a nucleotide with a 3'OH sugar group. In certain embodiments, the 3'OH sugar group can be extended with subsequent nucleotides in a polymerase-catalyzed nucleotide incorporation reaction. In some embodiments, the chain termination portion comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group. In some embodiments, the chain-terminating moiety can be cleaved / removed from the nucleotide, for example, but not limited to, by reacting the chain-terminating moiety with a chemical agent, a pH change, light, or heat. In some embodiments, the chain-terminating moiety alkyl, alkenyl, alkynyl, and allyl groups can be cleaved with tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) with piperidine or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the chain-terminating moiety aryl and benzyl groups can be cleaved with H2Pd / C. In some embodiments, the chain-terminating moiety amine, amide, ketone, isocyanate, phosphate, sulfur, and / or disulfide can be cleaved with a phosphine or with a thiol group (including, for example, but not limited to, β-mercaptoethanol or dithiothreitol (DTT)). In some embodiments, the chain-terminating moiety carbonate can be cleaved with potassium carbonate (K2CO3) in MeOH, with triethylamine in pyridine, or with Zn in acetic acid (AcOH). In some embodiments, the chain terminating moieties urea and silyl can be cleaved with tetrabutylammonium fluoride, pyridine-HF, with ammonium fluoride, or with triethylamine trihydrofluoride.

[0347] In some embodiments, in any method described herein for sequencing a nucleic acid molecule, at least one of the plurality of nucleotides comprises a terminator nucleotide analog having a chain termination moiety (e.g., a blocking moiety) at the sugar 2' position, at the sugar 3' position, or at the sugar 2' and 3' positions. In some embodiments, the chain termination moiety comprises an azide, an azido, or an azidomethyl group. In some embodiments, the chain termination moiety comprises a 3'-O-azido or a 3'-O-azidomethyl group. In some embodiments, the chain termination moiety azide, an azido, and an azidomethyl group can be cleaved / removed with a phosphine compound. In some embodiments, the phosphine compound comprises a derived trialkylphosphine moiety or a derived triarylphosphine moiety. In some embodiments, the phosphine compound comprises: tris(2-carboxyethyl)phosphine (TCEP), or bissulfotriphenylphosphine (BS-TPP), or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP).

[0348] In some embodiments, in any of the methods described herein for sequencing a nucleic acid molecule, the nucleotide comprises a chain terminating moiety selected from the group consisting of 3'-deoxynucleotide, 2',3'-dideoxynucleotide, 3'-methyl, 3'-azido, 3'-azidomethyl, 3'-O-azidoalkyl, 3'-O-ethynyl, 3'-O-aminoalkyl, 3'-O-fluoroalkyl, 3'-fluoromethyl, 3'-difluoromethyl, 3'-trifluoromethyl, 3'-sulfonyl, 3'-malonyl, 3'-amino, 3'-O-amino, 3'-thiol, 3'-aminomethyl, 3'-ethyl, 3'butyl, 3'-tert-butyl, 3'-fluorenylmethoxycarbonyl, 3'tert-butoxycarbonyl, 3'-O-alkylhydroxylamino, 3'-phosphorothioate, and 3-O-benzyl, or derivatives thereof.

[0349] In some embodiments, in any method described herein for sequencing nucleic acid molecules, a plurality of nucleotides include a plurality of nucleotides labeled with a detectable reporter moiety. In some embodiments, the detectable reporter moiety includes a fluorophore. In some embodiments, the fluorophore is attached to a nucleotide base. In some embodiments, the fluorophore is attached to a nucleotide base with a joint that can be cleaved / removed from a base. In some embodiments, at least one of the nucleotides in the plurality of nucleotides is not labeled with a detectable reporter moiety. In some embodiments, a specific detectable reporter moiety (e.g., a fluorophore) attached to a nucleotide may correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP or dUTP) to allow detection and identification of a nucleotide base.

[0350] In some embodiments, in any method described herein for sequencing nucleic acid molecules, the cleavable joint on the nucleotide base comprises a cleavable part. In certain embodiments, the cleavable part comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonic acid group, a urea group or a silyl group. In some embodiments, by reacting the cleavable part with a chemical agent, pH change, light or heat, the cleavable joint on the base can be cleaved / removed from the base. In some embodiments, the cleavable part alkyl, alkenyl, alkynyl and allyl can be cleaved with tetrakis(triphenylphosphine)palladium(0)(Pd(PPh3)4) and piperidine or with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the cleavable part aryl and benzyl can be cleaved with H2Pd / C. In some embodiments, the cleavable part of amine, amide, ketone, isocyanate, phosphate, sulfur and / or disulfide can be cleaved with phosphine or with a thiol group including β-mercaptoethanol or dithiothreitol (DTT). In some embodiments, the cleavable part of carbonate can be cleaved with potassium carbonate (K2CO3) in MeOH, with triethylamine in pyridine or with Zn in acetic acid (AcOH). In some embodiments, the cleavable part of urea and silyl can be cleaved with tetrabutylammonium fluoride, pyridine-HF, ammonium fluoride or triethylamine trihydrofluoride.

[0351] In some embodiments, in any method described herein for sequencing nucleic acid molecules, the cleavable linker on the nucleotide base comprises a cleavable portion. In certain embodiments, the cleavable portion comprises an azide, an azido or an azidomethyl group. In some embodiments, the cleavable portion azide, an azido and an azidomethyl group can be cleaved / removed by a phosphine compound. In some embodiments, the phosphine compound comprises a derived trialkylphosphine portion or a derived triarylphosphine portion. In some embodiments, the phosphine compound comprises: tris(2-carboxyethyl)phosphine (TCEP), or bissulfotriphenylphosphine (BS-TPP), or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP).

[0352] In some embodiments, in any of the methods described herein for sequencing nucleic acid molecules, the chain-terminating moiety (e.g., at the sugar 2' and / or sugar 3' position) and the cleavable linker on the nucleotide base have the same or different cleavable moieties. In some embodiments, the chain-terminating moiety (e.g., at the sugar 2' and / or sugar 3' position) linked to the base and the detectable reporter moiety can be chemically cleaved / removed with the same chemical agent. In some embodiments, the chain-terminating moiety (e.g., at the sugar 2' and / or sugar 3' position) linked to the base and the detectable reporter moiety can be chemically cleaved / removed with different chemical agents.

[0353] Multivalent molecules

[0354] The present disclosure provides methods for sequencing nucleic acid molecules using multivalent molecules. In some embodiments, the multivalent molecules comprise a plurality of nucleotide arms attached to a core and having any configuration, including a starburst, spiral ladder, or bottle brush configuration (e.g., Figures 9 to 13 ). In some embodiments, the multivalent molecule comprises: (1) a core; and (2) a plurality of nucleotide arms. In some embodiments, the nucleotide arms comprise: (i) a core attachment portion, (ii) a spacer comprising a PEG portion, (iii) a linker, and (iv) a nucleotide unit, e.g., wherein the core is attached to the plurality of nucleotide arms, wherein the spacer is attached to the linker, and wherein the linker is attached to the nucleotide unit. In some embodiments, the nucleotide unit comprises a base, a sugar, and at least one phosphate group, and the linker is attached to the nucleotide unit via the base. In some embodiments, the linker comprises an aliphatic chain or an oligoethylene glycol chain, e.g., both linker chains have 2 to 6 (e.g., 2, 3, 4, 5, or 6) subunits. In some embodiments, the linker also comprises an aromatic portion.

[0355] Fig.13 and 20 An exemplary nucleotide arm is shown in FIG. An exemplary multivalent molecule is shown in Figures 9 to 13 An exemplary spacer is Fig.14 (top) and exemplary linkers are shown in Fig.14 (bottom) and Fig.15 Exemplary nucleotides attached to the linker are shown in Figures 16 to 19 middle. Fig. 20 An exemplary biotinylated nucleotide arm is shown in FIG.

[0356] In some embodiments, the multivalent molecule comprises a core attached to a plurality of nucleotide arms.In certain embodiments, the plurality of nucleotide arms have the same type of nucleotide units selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

[0357] In some embodiments, the multivalent molecule comprises a core attached to a plurality of nucleotide arms, wherein each arm comprises a nucleotide unit. In some aspects, the polynucleotide unit comprises an aromatic base, a pentose (e.g., ribose or deoxyribose) and one or more phosphate groups (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphate groups). The plurality of multivalent molecules may comprise a type of multivalent molecule having a type of nucleotide unit selected from the group consisting of the following items: dATP, dGTP, dCTP, dTTP and dUTP. The plurality of multivalent molecules may comprise a mixture of any combination of two or more types of multivalent molecules, wherein the independent multivalent molecule in the mixture comprises a nucleotide unit selected from the group consisting of the following items: dATP, dGTP, dCTP, dTTP and / or dUTP.

[0358] In some embodiments, the nucleotide unit comprises a chain of one, two or three phosphorus atoms, wherein the chain is generally connected to the 5' carbon of the sugar moiety by, for example, but not limited to, an ester bond or a phosphoramide bond. In some embodiments, at least one nucleotide unit is a nucleotide analog with a phosphorus chain, wherein the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups, including, for example, but not limited to O, S or BH3. In some embodiments, the chain i...

Claims

1. A method for reducing deaminated nucleotide bases in a nucleic acid library, comprising: a) providing a plurality of linear nucleic acid library molecules, wherein each library molecule of the plurality of linear nucleic acid library molecules comprises a sequence of interest joined to at least one universal adapter sequence having a binding sequence for a surface capture primer and one universal adapter sequence having a binding sequence for a sequencing primer, and wherein at least one library molecule of the library molecules carries one or more deaminated nucleotide bases; b) contacting the plurality of nucleic acid library molecules with a reagent that removes deaminated nucleotide bases, thereby generating at least one library molecule carrying an abasic site; c) circularizing the plurality of nucleic acid library molecules to generate a plurality of covalently closed circular library molecules; d) distributing the plurality of covalently closed circular library molecules onto a support having a plurality of immobilized surface capture primers under conditions suitable for hybridizing each covalently closed circular library molecule to the surface capture primer; e) performing a rolling circle amplification reaction to generate a plurality of nucleic acid concatemer template molecules fixed to the support; as well as f) sequencing the plurality of nucleic acid concatemer template molecules to determine the sequence of at least a portion of the concatemer template molecules.

2. The method according to claim 1, further comprising: (g) contacting the plurality of covalently closed circular library molecules with a reagent that removes deaminated nucleotide bases, thereby generating at least one circular library molecule carrying an abasic site.

3. The method according to claim 1 or 2, wherein the reagent for removing deaminated nucleotide bases in step (b) comprises DNA glycosylase (UDG) and (i) AP lyase, (ii) Endo IV endonuclease, (iii) FPG glycosylase / AP lyase, and / or (iv) Endo VIII glycosylase / AP lyase, or a combination thereof.

4. The method according to claim 2 or 3, wherein the reagent for removing deaminated nucleotide bases in step (g) comprises DNA glycosylase (UDG) and (i) AP lyase, (ii) Endo IV endonuclease, (iii) FPG glycosylase / AP lyase, and / or (iv) Endo VIII glycosylase / AP lyase, or a combination thereof.

5. The method according to any one of claims 1 to 4, wherein the plurality of immobilized surface capture primers are tethered to a polymer coating on the support.

6. The method according to any one of claims 1 to 5, wherein the rolling circle amplification reaction of step (e) comprises a strand displacement polymerase and a plurality of nucleotides, the plurality of nucleotides comprising dATP, dGTP, dCTP, dTTP and / or dUTP.

7. The method according to any one of claims 1 to 6, wherein the plurality of immobilized surface capture primers are located at predetermined positions on the support.

8. The method according to any one of claims 1 to 6, wherein the plurality of immobilized surface capture primers are located at random positions on the support.

9. The method according to any one of claims 1 to 8, wherein the plurality of immobilized concatemeric template molecules on the support are in fluid communication with each other to allow a solution of a reagent to flow onto the support.

10. The method of claim 9, wherein the solution of reagents comprises enzymes, nucleotides and divalent cations.

11. The method of claim 9 or 10, wherein the plurality of immobilized concatemeric template molecules react with the reagent substantially simultaneously in a massively parallel manner.

12. The method according to any one of claims 1 to 11, wherein the density of the plurality of immobilized concatemer template molecules on the polymer-coated support is 10 2 –10 12 / mm 2 .

13. The method of any one of claims 1 to 12, wherein sequencing the plurality of fixed concatemers comprises: a) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of composite polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; b) contacting the plurality of composite sequencing polymerases with a plurality of nucleotides under conditions suitable for binding at least one nucleotide to the composite sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the 3' position of the sugar; c) incorporating at least one nucleotide into the 3' end of the hybridized sequencing primer, thereby generating a plurality of nascent extended sequencing primers; as well as d) detecting the incorporated nucleotide and identifying the nucleobase of the incorporated nucleotide.

14. The method of claim 13, wherein the plurality of nucleotides comprises a removable chain-terminating moiety at the 3' sugar group, wherein the removable chain-terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group.

15. The method of claim 14, wherein the removable chain-terminating moiety is cleavable with a chemical compound to generate an extendable 3'OH moiety on the sugar group.

16. The method of any one of claims 13 to 15, wherein the plurality of nucleotides comprises one type of nucleotide selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

17. The method according to any one of claims 13 to 15, wherein the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of: dATP, dGTP, dCTP, dTTP and dUTP.

18. The method of any one of claims 13 to 17, wherein sequencing the plurality of fixed concatemers comprises: a) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of soluble sequencing primers, wherein the contacting is performed under conditions suitable for forming a plurality of first composite polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex, wherein the nucleic acid duplex comprises concatemer molecules hybridized to the soluble sequencing primers; b) contacting the plurality of composite sequencing polymerases with a plurality of detectably labeled multivalent molecules under conditions suitable for combining complementary nucleotide units of the multivalent molecules with at least two first composite polymerases of the plurality of first composite polymerases to form a plurality of multivalent-complex polymerases, thereby forming a plurality of multivalent-complex polymerases, and The conditions inhibit incorporation of the complementary nucleotide unit into sequencing primers of the plurality of multivalent-complex polymerases, wherein each multivalent molecule of the plurality of multivalent molecules comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit; c) detecting the plurality of multivalent-complex polymerases; as well as d) identifying the nucleobase of the complementary nucleotide unit bound to the plurality of first composite polymerases among the plurality of multivalent composite polymerases, thereby determining the sequence of the nucleic acid template.

19. The method according to claim 18, further comprising: e) dissociating the plurality of multivalent-complex polymerases, removing the plurality of first sequencing polymerases and the multivalent molecules bound thereto, and retaining the plurality of nucleic acid duplexes; f) contacting the plurality of retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contacting is performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second composite polymerases, each second composite polymerase comprising a second sequencing polymerase that binds to a retained nucleic acid duplex; g) contacting the plurality of second composite polymerases with a plurality of nucleotides, the plurality of nucleotides comprising at least one nucleotide analogue labeled with a fluorophore and having a removable chain terminating portion at the 3' position of the sugar, wherein the contacting is performed under conditions suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the second composite polymerases of step (f), thereby forming a plurality of nucleotide-composite polymerases, and the conditions are suitable for promoting incorporation of the bound complementary nucleotides into the sequencing primer of the nucleotide-composite polymerase.

20. The method of claim 19, further comprising: h) detecting the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

21. The method of claim 19, further comprising: h) detecting the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase; as well as i) recognizing the nucleobase of the complementary nucleotide incorporated into the sequencing primer of the nucleotide-complex polymerase.

22. A method for sequencing by forming at least one affinity complex, comprising: a) generating nucleic acid concatemers by rolling circle amplification of a closed circular nucleic acid molecule comprising at least one abasic site, wherein the abasic site is generated by contacting the closed circular nucleic acid molecule or the corresponding linear nucleic acid molecule with an agent that removes deaminated nucleotide bases; b) binding a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule to a first portion of the concatemer molecule, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule is bound to the first sequencing polymerase; c) combining a second universal sequencing primer, a second sequencing polymerase, and the first detectably labeled multivalent molecule with a second portion of the same concatemer molecule, thereby forming a second binding complex, wherein the second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, wherein the first binding complex and the second binding complex comprising the same multivalent molecule form an affinity complex, wherein the first detectably labeled multivalent molecule comprises a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide unit, wherein the concatemer molecule comprises two or more tandem repeats of a sequence of interest (110) and a universal primer binding site that binds the first universal sequencing primer and the second universal sequencing primer, and wherein the contacting is performed under conditions suitable for inhibiting polymerase-catalyzed incorporation of the bound first nucleotide unit and the second nucleotide unit in the first binding complex and the second binding complex; d) detecting the first binding complex and the second binding complex on the same concatemer molecule, and e) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule.

23. The method of any one of claims 18 to 22, wherein the plurality of nucleotide arms attached to the core of the respective multivalent molecules have the same type of nucleotide units, and wherein the type of nucleotide units is selected from the group consisting of: dATP, dGTP, dCTP, dTTP and dUTP.

24. The method of any one of claims 18 to 23, wherein the plurality of multivalent molecules comprises a mixture of two or more types of multivalent molecules, each type having a nucleotide unit selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

25. The method of any one of claims 18 to 24, wherein the plurality of nucleotides comprises a removable chain-terminating moiety at the 3' sugar group, wherein the removable chain-terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azido group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group.

26. The method of claim 25, wherein the removable chain-terminating moiety is cleavable with a chemical compound to generate an extendable 3'OH moiety on the sugar group.

27. The method of any one of claims 18 to 26, wherein the plurality of nucleotides comprises one type of nucleotide selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

28. The method of any one of claims 18 to 26, wherein the plurality of nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of: dATP, dGTP, dCTP, dTTP, and dUTP.

29. The method of any one of claims 1 to 28, wherein the support comprises a glass substrate.

30. The method of any one of claims 1 to 28, wherein the support comprises a plastic substrate.

31. The method of any one of claims 1 to 30, wherein the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no greater than 45 degrees.

32. The method of claim 31 , wherein the at least one hydrophilic polymer coating comprises a molecule selected from the group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxyethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), polylysine, polyglucoside, streptavidin, and dextran.

33. The method according to any one of claims 1 to 32, further comprising: The base calling error percentage is determined according to the sequencing of step (f).

34. The method of claim 33, further comprising determining a quality score for sequencing data based on the base calling error percentage.

35. The method of claim 34, wherein the mass score is a Phred mass score.

Images